ID: 1009445653

View in Genome Browser
Species Human (GRCh38)
Location 6:63739241-63739263
Sequence CTGGGATGGAACTTAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009445648_1009445653 12 Left 1009445648 6:63739206-63739228 CCTCCTGTCTCAGGTTATTTTTC No data
Right 1009445653 6:63739241-63739263 CTGGGATGGAACTTAGTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 136
1009445647_1009445653 19 Left 1009445647 6:63739199-63739221 CCTGTGTCCTCCTGTCTCAGGTT 0: 1
1: 0
2: 1
3: 31
4: 255
Right 1009445653 6:63739241-63739263 CTGGGATGGAACTTAGTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 136
1009445649_1009445653 9 Left 1009445649 6:63739209-63739231 CCTGTCTCAGGTTATTTTTCTAG 0: 1
1: 0
2: 3
3: 92
4: 625
Right 1009445653 6:63739241-63739263 CTGGGATGGAACTTAGTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009445653 Original CRISPR CTGGGATGGAACTTAGTGTA TGG Intronic