ID: 1009449530

View in Genome Browser
Species Human (GRCh38)
Location 6:63785060-63785082
Sequence ATGCTGATATTGCTGACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 2, 2: 17, 3: 92, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009449526_1009449530 28 Left 1009449526 6:63785009-63785031 CCTGAGTTTCTGGTTCAATTACA 0: 1
1: 0
2: 3
3: 21
4: 252
Right 1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG 0: 1
1: 2
2: 17
3: 92
4: 448
1009449525_1009449530 29 Left 1009449525 6:63785008-63785030 CCCTGAGTTTCTGGTTCAATTAC 0: 1
1: 0
2: 4
3: 28
4: 268
Right 1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG 0: 1
1: 2
2: 17
3: 92
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009449530 Original CRISPR ATGCTGATATTGCTGACCCA GGG Intronic
900857827 1:5200208-5200230 ATGCTGGTATTGTTGATCCTTGG + Intergenic
901439046 1:9266399-9266421 AAGCAGGTATTGCTGGCCCATGG - Exonic
901792381 1:11661226-11661248 ATGCTGCTGTTGGTGACCCTCGG - Exonic
902271889 1:15310581-15310603 ATGCTGATGCTGCTGGTCCAGGG - Intronic
904126086 1:28240299-28240321 ATGCTGACACTGCTGGCTCATGG - Intronic
904608291 1:31710826-31710848 ATGCTGATGTTGTGGACCCAGGG + Intergenic
904653940 1:32028223-32028245 ATTCTGATATTGCTGGTCCAGGG - Intronic
904975229 1:34451092-34451114 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
906579842 1:46927428-46927450 GTGCTGGTAGTGCTGACCCTGGG - Intergenic
906603883 1:47151471-47151493 GTGCTGGTACTGCTGACCCTGGG + Intergenic
906819612 1:48915605-48915627 ATGCTGATTCCGCTGACCAAGGG - Intronic
906946970 1:50302863-50302885 ATGCTGATGCTGCTGATTCATGG - Intergenic
907009373 1:50949135-50949157 ATGCTGATGCTTCTGATCCAAGG - Intronic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
907788048 1:57633397-57633419 ATGCTGATGCTGCTGAACCTGGG + Intronic
910179696 1:84468673-84468695 ATGCCGATGCTGCTGATCCAAGG + Intergenic
912261883 1:108118975-108118997 ATGCTAATATTCTTGACCTACGG - Intergenic
912498038 1:110103860-110103882 AAGCTCATATTGGTGACCCCTGG + Intergenic
912738515 1:112172110-112172132 ATGCTTATGATGCTAACCCAGGG + Intergenic
915349192 1:155213934-155213956 ATGCTGACACTGCTGCTCCACGG + Intergenic
915352379 1:155234561-155234583 ATGCTGACACTGCTGCTCCACGG + Exonic
915600883 1:156922691-156922713 ATGCTGAAGTTGCTGGTCCAAGG - Intronic
915674052 1:157514601-157514623 ATGCTGATGCTGCTGGCCCTGGG - Exonic
915892543 1:159784868-159784890 AGGCTGATTTTGCTCCCCCAGGG - Intergenic
916196920 1:162233175-162233197 ATACTGATATTGCTGCTCCAGGG + Intronic
916472609 1:165138643-165138665 ATGCTGATGCTGCTGATCCATGG + Intergenic
917510818 1:175667950-175667972 ATGCTAACAGTGCTAACCCATGG - Intronic
917672676 1:177287853-177287875 ATGCTGATGCTGCTGGTCCATGG + Intergenic
917706631 1:177641285-177641307 ATGCTGATATTCCTGATCCGTGG - Intergenic
917739404 1:177947808-177947830 ATGCTGGTGTCGCTTACCCAGGG + Exonic
918594667 1:186279185-186279207 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
919380142 1:196848828-196848850 ATGATGGTATTGCTGACCGCAGG - Intronic
919468680 1:197952328-197952350 ATGCTGATGTTGCTGGTCCATGG + Intergenic
919821998 1:201479308-201479330 GTGCTGATGTTGCTGATCCTGGG - Intergenic
920414834 1:205791953-205791975 ATGCTGATGTGGGTGACCCTGGG - Intronic
920830829 1:209464218-209464240 CTGTTGAAATTTCTGACCCATGG + Intergenic
921424123 1:214982809-214982831 ACGCTGATGCTGCTGGCCCAGGG - Intergenic
921452127 1:215321654-215321676 ATTTTGATATTGCTGACAAAGGG + Intergenic
922033091 1:221823362-221823384 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
923542381 1:234897791-234897813 ATGCTGATGATGCTGGCCCAAGG + Intergenic
924305594 1:242685559-242685581 ATGATGAGATTATTGACCCATGG + Intergenic
1063293715 10:4779526-4779548 ATGCTGATGTGCCTGATCCATGG - Intergenic
1065389681 10:25169867-25169889 ATGCTAATACTGCTGGCCCAGGG - Intergenic
1066716034 10:38287314-38287336 ATGCTGATGTTGTAGGCCCAGGG - Intergenic
1067281070 10:44873342-44873364 ATGCCGATGGTGCTGGCCCAAGG + Intergenic
1067696696 10:48541095-48541117 ATGCTGATGCAGCTGGCCCATGG + Intronic
1067791643 10:49292885-49292907 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1068012775 10:51475282-51475304 ATGCTGATGCTGCTGTTCCAGGG - Intronic
1068705933 10:60075450-60075472 TTGCAGATATTGACGACCCAAGG + Exonic
1069262236 10:66413227-66413249 GTGCCAATAGTGCTGACCCATGG - Intronic
1069295264 10:66835937-66835959 ATGCTGATACTGCTGATCTAAGG + Intronic
1070407184 10:76107344-76107366 ATGCTGAGGCTGCTGACCTAGGG + Intronic
1070553596 10:77511227-77511249 ATGCTGATGCTGTTGACCCAGGG + Intronic
1071120365 10:82269824-82269846 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1071278750 10:84080146-84080168 ATGCAAATACTGCTGGCCCACGG + Intergenic
1071460294 10:85887462-85887484 ATGCTGATACTGTTGGCCCATGG - Intronic
1071750299 10:88467810-88467832 TTGCTGATGTTGCTGGTCCATGG - Intronic
1071762337 10:88622571-88622593 ATTCTGACAGTACTGACCCAGGG + Intergenic
1072096026 10:92180793-92180815 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1072192222 10:93085399-93085421 ATACAGATGCTGCTGACCCATGG - Intergenic
1073635560 10:105194822-105194844 ATGCTGATGTTGCTGGCCCCAGG - Intronic
1074143299 10:110695995-110696017 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1074176003 10:111003770-111003792 ATGCTGATATTGCTCTTCCTTGG + Intronic
1074310828 10:112321953-112321975 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1074954969 10:118379886-118379908 ATGCTGGCATTGCTGGCCCAAGG + Intergenic
1075070666 10:119318032-119318054 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1075548095 10:123370804-123370826 ATGCTGGAAATGCTGACCAAGGG - Intergenic
1078252211 11:9625539-9625561 ATTCTGATACTGCTGGTCCAGGG + Intergenic
1078722302 11:13896437-13896459 ATGCAGCTATTCCTGACCCCAGG + Intergenic
1080249326 11:30215317-30215339 ATGCTGATCCTGCTGGCCCAGGG + Intergenic
1082175082 11:49049476-49049498 AGGCTGATACCGCTGGCCCAGGG - Intergenic
1082243410 11:49893074-49893096 AGGCTGATGCTGCTGGCCCAGGG - Intergenic
1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG + Intergenic
1082960614 11:58915557-58915579 GTGTTGATCTTGCTGGCCCAGGG - Intronic
1083061574 11:59878216-59878238 CTGCTGATGCTGCTGACCCCAGG - Intergenic
1086290183 11:85299796-85299818 ATGCTGGTGTTGCTGGTCCAGGG + Intronic
1087025716 11:93647532-93647554 ATGCTGATACTGATGGTCCACGG - Intergenic
1087467894 11:98532547-98532569 ATACTGATGTTGCTGGTCCAAGG - Intergenic
1088574040 11:111252413-111252435 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1089024742 11:115257944-115257966 ATGCTGACACTGCTGATCCAGGG + Intronic
1089947598 11:122493721-122493743 ATGCTGATGCTGCTGATACATGG - Intergenic
1090434220 11:126673481-126673503 ATGCTGATTTTCAGGACCCAAGG + Intronic
1090900869 11:131029949-131029971 AGTCTGACAGTGCTGACCCATGG + Intergenic
1092034851 12:5324187-5324209 ATGCAAATCTTGCAGACCCAGGG - Intergenic
1092378452 12:7975256-7975278 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1095883816 12:47167661-47167683 TAGATGATATTGCTGAACCATGG + Intronic
1096235635 12:49924291-49924313 ATAATGATATTGCTGACTAAGGG + Intergenic
1096395008 12:51259246-51259268 ATGCAGATCCTGCAGACCCAGGG + Intronic
1097336725 12:58391957-58391979 ATGCTGATACTTCTCATCCAGGG - Intergenic
1098140261 12:67443751-67443773 ATGCTTGTATTGCTGATTCAGGG + Intergenic
1098376237 12:69818471-69818493 AAAGTGAAATTGCTGACCCATGG - Exonic
1098701400 12:73632402-73632424 ATGCTGTTGTTGCTGGTCCAGGG - Intergenic
1098911434 12:76213211-76213233 CAACTGAAATTGCTGACCCAAGG - Intergenic
1100208774 12:92379689-92379711 ATGATAATATTGCCGACCCAGGG + Intergenic
1100337926 12:93650045-93650067 AAGCTGATGCTGCTGACCCAAGG + Intergenic
1100527962 12:95437838-95437860 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1100625433 12:96326716-96326738 CTGCTGACATTGCTGGTCCAGGG + Intronic
1101706718 12:107227405-107227427 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1101897633 12:108768468-108768490 ATACTGAGAATGCAGACCCACGG + Intergenic
1102178218 12:110892006-110892028 ATGCTGCCACTGCTGTCCCAGGG - Intronic
1102202271 12:111065759-111065781 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1103065004 12:117890109-117890131 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1104053787 12:125214232-125214254 CTTCTGATGTGGCTGACCCAGGG + Intronic
1104794692 12:131509336-131509358 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1105029498 12:132872947-132872969 ATGCAGATGCTGCTGACCCAGGG + Intronic
1105054202 12:133081851-133081873 ATGCTGATACTGCTGGTCCAAGG - Intronic
1105239283 13:18595909-18595931 ATGCTCCTGGTGCTGACCCAGGG - Intergenic
1105842625 13:24268012-24268034 ATGCTGATACTGCTGGTCCATGG + Intronic
1106303279 13:28488550-28488572 ATGCTGATGTTGCTGGACCTCGG + Intronic
1107088767 13:36453258-36453280 ATGCTGATGTTGCTGATCCATGG - Intergenic
1108095112 13:46893404-46893426 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1108382687 13:49869234-49869256 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1110070382 13:71168640-71168662 ATGCTGATGTTGCTAATCTATGG - Intergenic
1110416265 13:75256541-75256563 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1112323063 13:98424495-98424517 AGGCTGATATTTGTAACCCAGGG + Intronic
1112365999 13:98756000-98756022 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1114304989 14:21414635-21414657 ATGCTAATTCTGCTGATCCATGG + Intronic
1115922094 14:38386728-38386750 ATGCTCATATTGCTTCCCCTCGG - Intergenic
1116427742 14:44810834-44810856 ATGCTGACCTTGTTGACCCCAGG + Intergenic
1116576983 14:46587519-46587541 AAGCTCATATTGCTGTCTCATGG - Intergenic
1118970894 14:70636705-70636727 CTGCTGATATTGCTGGTCCCTGG - Intergenic
1119499838 14:75115717-75115739 ATGCTGATGCTGCTGGTCCATGG - Intronic
1120033541 14:79669722-79669744 AAGCTGATGCTGCTGATCCATGG - Intronic
1120986193 14:90337266-90337288 TTGCTGATATTTCTGTCCAAAGG - Intergenic
1121469272 14:94139308-94139330 ATGCTGACACTGCTGGTCCATGG + Intergenic
1121556627 14:94842783-94842805 ATGCTGATGCTGCTCGCCCATGG + Intergenic
1122652510 14:103233117-103233139 GTGGTGATATTGCTGCTCCAGGG - Intergenic
1123491961 15:20788177-20788199 ATGCTCCTGGTGCTGACCCAGGG + Intergenic
1123548466 15:21357267-21357289 ATGCTCCTGGTGCTGACCCAGGG + Intergenic
1124415732 15:29471942-29471964 ATGCTGACAGTGGTCACCCAAGG + Intronic
1124639604 15:31389089-31389111 AAGCTGATCTTGCTGTCTCAGGG - Intronic
1125289850 15:38133958-38133980 ATGCTGATGCTGCTGATCCAGGG + Intergenic
1125487238 15:40120490-40120512 ATGCTGATGCTGCTGAACCAGGG - Intergenic
1125723526 15:41856621-41856643 ATGCGGATGTTGCTGACCCTTGG + Intronic
1126924063 15:53562492-53562514 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1127904956 15:63369613-63369635 ATGCTAATGCTGCTGGCCCAGGG + Intronic
1128347771 15:66865303-66865325 ATCCTGATGTTGCTGCCCTAGGG - Intergenic
1128378223 15:67092428-67092450 ATGCTGACGCTGCTGGCCCAGGG - Intronic
1128510812 15:68313049-68313071 AGGCAGACATTGCTCACCCATGG - Intronic
1128941011 15:71787643-71787665 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1129032182 15:72627502-72627524 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129217715 15:74109737-74109759 ATGCTGATGCTGTTGGCCCAGGG + Intronic
1129406948 15:75326240-75326262 ATGCTGATGTTGCTGGCCCAGGG - Intergenic
1129470154 15:75749110-75749132 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129734876 15:77954032-77954054 ATGCTGATGCTGCTGGCTCAGGG + Intergenic
1129840715 15:78741959-78741981 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1130217948 15:81989961-81989983 ATGCTGATGTTTCTGGTCCATGG + Intergenic
1130380481 15:83367932-83367954 ATGCTGATGCTGCTGGCCCCTGG + Intergenic
1130402812 15:83573401-83573423 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1130556354 15:84925266-84925288 ATGCTGACAATGCTGGTCCATGG - Intronic
1130771178 15:86925341-86925363 ATGCTGATACTGCTGGTCCAAGG + Intronic
1131208253 15:90470475-90470497 ATGTTGATGCTGCTGGCCCAAGG + Intronic
1131670055 15:94610340-94610362 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1132028596 15:98422365-98422387 ATGCTGATGTTGCTGGTCCGGGG + Intergenic
1132250222 15:100330430-100330452 ATGCTGATGCTGCTGGCCCGGGG + Intronic
1202956799 15_KI270727v1_random:84498-84520 ATGCTCCTGGTGCTGACCCAGGG + Intergenic
1133907528 16:10035665-10035687 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1133911513 16:10070309-10070331 ATGCTGATGCTGCTGGCCCATGG - Intronic
1134419799 16:14075607-14075629 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1134888624 16:17818423-17818445 ATGCTGATGCTGCTGATTCAGGG + Intergenic
1135046318 16:19158913-19158935 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1135126364 16:19813053-19813075 ATGCTGATATTTCTGATCCATGG + Intronic
1137024084 16:35456016-35456038 ATGCTGCTGTTGCTGCTCCAGGG + Intergenic
1137725711 16:50655303-50655325 ATGCTGATGCTGCTGATCTAAGG + Intergenic
1137846110 16:51689849-51689871 ATGCTGAAGTTGCTAATCCATGG - Intergenic
1138237333 16:55395747-55395769 ATACTGATGTTGCTGGTCCAGGG - Intronic
1138876274 16:60954240-60954262 ATGCTGATGCTGCTGTTCCAAGG - Intergenic
1138882874 16:61037260-61037282 ATGCTGACATTGCTGAACATAGG + Intergenic
1139153766 16:64415894-64415916 ATGCTGATAGTGCTGGTCTAGGG + Intergenic
1139683310 16:68582109-68582131 ATGTTGATACTGCTGGCCCAGGG + Intergenic
1140628438 16:76822712-76822734 ATGTTGATACAGCTGACCTAGGG + Intergenic
1140748228 16:77999726-77999748 ATGTTCCGATTGCTGACCCATGG - Intergenic
1141102588 16:81208978-81209000 ATCCTGACATTGCTGGCCCAGGG + Intergenic
1143925470 17:10365526-10365548 ATGCAGATGCTGCTGATCCAGGG + Intronic
1143945999 17:10592612-10592634 GTGCTGATGCTGCTGGCCCATGG - Intergenic
1144088587 17:11833067-11833089 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144099389 17:11930585-11930607 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1144146664 17:12405474-12405496 ATGCTGATGCTGCTGGCCCGTGG - Intergenic
1144194243 17:12875213-12875235 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144337458 17:14284466-14284488 ATGCTAATACTGCTGGTCCAAGG + Intergenic
1146521574 17:33529405-33529427 ATGCTGATGCCGCTGGCCCAGGG - Intronic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1148699872 17:49580932-49580954 ATGCTGATGCTGCTGCTCCAGGG + Intronic
1148824267 17:50380632-50380654 GTGTTGCTAATGCTGACCCAGGG + Intronic
1149407249 17:56366083-56366105 ATGTTGATAATGTTGACCCTAGG + Intronic
1149636651 17:58176366-58176388 ATGCTGATATTGCTTATCTGGGG + Intergenic
1151204842 17:72498860-72498882 ATGCTGATGTCGCTGGTCCAAGG + Intergenic
1151372913 17:73660303-73660325 ATGCTGATGATGCTGGTCCAGGG + Intergenic
1153555595 18:6310081-6310103 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1153689131 18:7573918-7573940 ATGCTGATGCTGCTGGCTCAAGG - Intronic
1154449511 18:14462728-14462750 ATGCTCCTGGTGCTGACCCAGGG + Intergenic
1155248958 18:23937641-23937663 ATGCTTATGCTGCTGACACACGG + Intronic
1155518489 18:26645779-26645801 ATGCTGATGCTGCTGTCCGAGGG - Intronic
1155862775 18:30924581-30924603 ATGCTGAAACTGCTGTCCTAAGG - Intergenic
1156173441 18:34514409-34514431 ATGCTGACACTGCTGACCCAGGG + Intronic
1156367183 18:36440169-36440191 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1156420395 18:36946425-36946447 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1156460413 18:37318539-37318561 TTGGTGATAGTGCTGACTCAGGG + Intronic
1157059545 18:44271764-44271786 AGGCTGATGCTGCTGACCCAGGG + Intergenic
1157093903 18:44668849-44668871 CTGCTTATCTTGCTGACCCATGG + Intergenic
1157226318 18:45868253-45868275 ATGCTGATGCTGCTGTCCCAGGG + Intronic
1157296282 18:46447613-46447635 ATGCTGATAGTGCTGAGGGATGG - Exonic
1157395984 18:47341552-47341574 ATGCTGAGGCTGCTGATCCAGGG + Intergenic
1157710435 18:49846357-49846379 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1158225248 18:55194523-55194545 ATGCTGATGTTGCTGATTCAGGG - Intergenic
1158476707 18:57786490-57786512 ATGCTGATGTTGCTGGTCCAGGG + Intronic
1161334335 19:3704345-3704367 AGGCTGATGTGGCTGGCCCAGGG - Intergenic
1163330917 19:16637179-16637201 ATGCTAATACTGCTGGTCCACGG - Intronic
1163876722 19:19876173-19876195 ATGCTGATGTTGCTCCCCCTGGG - Intronic
1163882645 19:19940182-19940204 ATGCTGATGTTGCTCCCCCTTGG + Intergenic
1164007423 19:21163411-21163433 ATGCTGATGTTGCTACCCCTGGG - Intronic
1164015011 19:21247435-21247457 ATGCTGATATTGCTCCCCCTGGG + Intronic
1164140934 19:22462222-22462244 ATGCTGATGTTGCTTCCCCTGGG - Intronic
1166799678 19:45448887-45448909 AGGCTGAGATTGCTAAACCATGG - Intronic
1167109214 19:47448971-47448993 ATGGTGATATGGCTCTCCCATGG - Intronic
1167778137 19:51575737-51575759 ATGCTTATATTGCTGCCTCTTGG + Intronic
1167782528 19:51608452-51608474 ATGCTGATGTTGCTGGCTCTTGG + Intergenic
925493076 2:4417313-4417335 ATGCGGAGATTGCTTACACAGGG - Intergenic
925782149 2:7390881-7390903 ATGCTTATGCTGCTGATCCAGGG + Intergenic
926760669 2:16276216-16276238 ATGCTGATACTGCTTTTCCAGGG - Intergenic
926768828 2:16350021-16350043 TTGCTGATACTGCTGGTCCAGGG + Intergenic
927281498 2:21312592-21312614 AGGCTGATCTTGCTGACCAATGG + Intergenic
927290634 2:21401745-21401767 ATGCTGATACTGCTGGTTCAAGG + Intergenic
927340503 2:21978433-21978455 ATGCTGATATTGCTGGTCCCAGG - Intergenic
927503093 2:23595418-23595440 ATGCTGATATTCCTGACCCAAGG + Intronic
929016675 2:37504214-37504236 AGGCTTATATTGCTGAAGCACGG + Intergenic
929123080 2:38499448-38499470 ATGCTGATGTTGTTGGTCCAGGG - Intergenic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
930671983 2:54160990-54161012 ATGCTGATGCTACTGATCCAAGG - Intronic
930804742 2:55479161-55479183 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
931206236 2:60148669-60148691 ATGCTGATTTTGCTGTTTCAGGG - Intergenic
931381567 2:61758207-61758229 ATGCTGATGCTGCTGATTCATGG + Intergenic
931440808 2:62289073-62289095 ATGCTGATATTGCTGGTCCTGGG + Intergenic
931700122 2:64902545-64902567 ATGCCGATGCTGCTGGCCCAGGG + Intergenic
931778324 2:65558703-65558725 ATGCTGACGTTGCTGATTCAAGG - Intergenic
932042655 2:68317747-68317769 ATGCTGATACTGCTGGTCCAGGG - Intronic
932130729 2:69185114-69185136 ATGCTGATGCTGCTGTTCCAGGG - Intronic
932416745 2:71578200-71578222 ATGCTGATGCTGCTGGTCCAGGG + Intronic
932712471 2:74077362-74077384 ATGCTGATGCTGCTGGCCCTGGG + Intronic
932744747 2:74324523-74324545 CTGCTGATGATGCTGATCCAGGG + Intronic
932753751 2:74390696-74390718 ATGCTAATGCTGCTGGCCCATGG - Intronic
932906162 2:75754675-75754697 ATGCTCAGACTTCTGACCCATGG - Intergenic
933196593 2:79397054-79397076 ATGCTGACACTGCTGGTCCAGGG + Intronic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
933891845 2:86779027-86779049 ATGCTGATGCTGCTGGTCCATGG - Intergenic
934733420 2:96673737-96673759 ATGCGGATGCTGCTGGCCCAGGG - Intergenic
935557493 2:104526258-104526280 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
935619073 2:105113060-105113082 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
936652761 2:114448492-114448514 ATGCTGATACTGCTGGTCTAGGG - Intronic
936937571 2:117853059-117853081 ATGCTGGTCCTGCTGATCCAGGG - Intergenic
936947412 2:117942968-117942990 ATGCTGGAATTTCTGACACAAGG - Intronic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
938481928 2:131670016-131670038 ATGCTCCTGGTGCTGACCCAGGG - Intergenic
938590005 2:132727439-132727461 ATGCTGATGCTGCTGATCCATGG - Intronic
938590325 2:132729615-132729637 ATGCTGATGATGCTGGCCCATGG + Intronic
938923920 2:136021488-136021510 ATGCTGTTGCTGCTGATCCACGG + Intergenic
939220999 2:139301471-139301493 ATGCTGATAATGCTGGATCAAGG - Intergenic
941039048 2:160599810-160599832 CTGCTGAAAAGGCTGACCCAAGG - Intergenic
941316473 2:163999369-163999391 ATGCTGATGTTGCTAGTCCAGGG + Intergenic
941689440 2:168483953-168483975 ATGCTGATGTTGCTAGTCCAGGG + Intronic
941711440 2:168718357-168718379 ATGCTGCTACTGCTAATCCAGGG - Intronic
941746761 2:169095196-169095218 ATGCTGATGCTGCTGGTCCAGGG - Intronic
941758206 2:169211660-169211682 ATGCTGACGGTGCTGGCCCATGG - Intronic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
944556773 2:200894940-200894962 ATGCTGATGTTGCTGGTCCAAGG - Intronic
944658979 2:201904674-201904696 ATGCTGATGTTGCTGGTACAGGG - Intergenic
945435825 2:209816631-209816653 ATGCTGATGCTGCTGGTCCAGGG + Intronic
945446254 2:209941738-209941760 ATGCTGATGCTGCTGGCCCAGGG - Intronic
947861093 2:233357867-233357889 ATGCTGATGCTGCTGGTCCATGG + Intronic
947896468 2:233678401-233678423 ATGTTGATTTTGCTGTCTCAGGG + Intronic
1168850203 20:971325-971347 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1169509200 20:6245410-6245432 ATGCTGATGCTGCTGTTCCAGGG + Intergenic
1169714820 20:8603568-8603590 ATGCTGATGTTGCTGGTCTAGGG - Intronic
1169775842 20:9252288-9252310 ATGCTGACATTGCTGGTCCTTGG - Intronic
1169947371 20:11003481-11003503 ATGCTTATGTTGCTGATCCAGGG - Intergenic
1169995897 20:11556270-11556292 ATGTTGATATTGCTAATTCAAGG - Intergenic
1169998181 20:11582979-11583001 ATGCTGATGTTGGTAGCCCAAGG - Intergenic
1170034290 20:11973679-11973701 ATGCTAATATTCCTGGTCCATGG - Intergenic
1170096720 20:12653314-12653336 ATGCTGACACTGCTGGCCCAAGG + Intergenic
1170097147 20:12658472-12658494 ATGCCGATATTTCTCATCCATGG + Intergenic
1170364734 20:15586311-15586333 ATGCTAATACTGCTGGCCCAGGG + Intronic
1170412284 20:16104625-16104647 ATGCTGATACTGCTGGGCAAGGG - Intergenic
1170737319 20:19023135-19023157 TGGCTGATATTGCTGGTCCAAGG - Intergenic
1170759109 20:19234189-19234211 ATGCTGATGCTGCTGTTCCAAGG - Intronic
1170777503 20:19390603-19390625 ATGCTGAGTTTGCTGGACCATGG + Intronic
1170784974 20:19460006-19460028 ATGCTGATACTGCTGGCCCGTGG + Intronic
1171322144 20:24255729-24255751 ATGCCAATGTTGCTGGCCCATGG - Intergenic
1171377675 20:24704491-24704513 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1171964557 20:31519555-31519577 ATGCTGACACTGCTGGCCCAGGG - Intronic
1172042299 20:32053876-32053898 ATGCTGCTGCTGCTGATCCAAGG + Intronic
1172976818 20:38912329-38912351 ATGCTGATGTTGCTGGTACAGGG - Intronic
1173170429 20:40718943-40718965 ATGTTCATATAGATGACCCATGG - Intergenic
1173343548 20:42177225-42177247 ATGCTGATGATGCTGGTCCATGG + Intronic
1173451842 20:43171773-43171795 ATGCTGACACTGCTGGTCCAGGG + Intronic
1173475620 20:43357085-43357107 ATGCTAATGTTGCTGGTCCAGGG + Intergenic
1173648000 20:44645650-44645672 ATGATGATGATGCTGACCAATGG + Intronic
1174132678 20:48357152-48357174 ATGCTGATGTTGCTGGTCCATGG + Intergenic
1174990433 20:55503388-55503410 GTGCTGATACTGCTAATCCAGGG + Intergenic
1175308159 20:57992203-57992225 GTGCTGATACTGCTGACCTGGGG - Intergenic
1176446661 21:6827657-6827679 ATGCTCCTGGTGCTGACCCAGGG - Intergenic
1176824832 21:13692687-13692709 ATGCTCCTGGTGCTGACCCAGGG - Intergenic
1178454518 21:32735739-32735761 ATGCTGATACTGCTGGTCCAGGG + Intronic
1179370381 21:40801267-40801289 ATGCTGATATTTGGGACCAAAGG + Intronic
1179377467 21:40863455-40863477 ATGCTGACACTGCTGCTCCATGG + Intergenic
1179565146 21:42242944-42242966 ATGCTGCTGTTGCTGGTCCAGGG + Intronic
1181751478 22:24991989-24992011 ATGCTGATGTGGCTGTGCCAAGG - Intronic
1181856787 22:25787408-25787430 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1181913165 22:26256682-26256704 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1183026577 22:35070001-35070023 ATTCTGATGTTGGTGGCCCAAGG + Intronic
1183093110 22:35536838-35536860 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949326104 3:2866406-2866428 ATGCTCAAATTACAGACCCAGGG - Intronic
949371295 3:3337410-3337432 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
949830002 3:8204117-8204139 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949896934 3:8774785-8774807 ATGCTGACAATCCTGACCCCAGG + Intronic
949961712 3:9317773-9317795 ATGCTGATGCTGCTGGTCCAGGG + Intronic
950010096 3:9716879-9716901 ATGCTGATGCTGCTGGCTCATGG - Intronic
950831837 3:15882431-15882453 ATGGTGATGCTGCTGATCCAGGG - Intergenic
950992790 3:17458665-17458687 GTGCTGAAATTTCAGACCCATGG - Intronic
951192900 3:19790883-19790905 ATGCTGATGATGCTGGTCCAGGG + Intergenic
951663373 3:25095340-25095362 GTGCTGATGTTGCTGGTCCAGGG - Intergenic
951689572 3:25381704-25381726 ATGCTGATGCTGCTGGTCCAAGG - Intronic
952038820 3:29236567-29236589 ATGGTGATATAACTGATCCATGG + Intergenic
952112873 3:30144845-30144867 ATACTGATATTGCTGGACTATGG - Intergenic
952184718 3:30956162-30956184 AGGCTGATGTTGCTGGTCCATGG - Intergenic
952329635 3:32352376-32352398 ATGCTGATGCTGCTGGCTCAGGG - Intronic
952740409 3:36728911-36728933 ATGCTGATGGTGCTGGTCCAGGG - Intronic
953070763 3:39517102-39517124 AAGATGATACTGTTGACCCAAGG + Intronic
953199999 3:40770064-40770086 ATGCTGATGCTGCTGGCCCTGGG - Intergenic
953370147 3:42380644-42380666 ATGATGATGGTGCTGGCCCAGGG + Intergenic
953704880 3:45223697-45223719 ATGCTGATGTTGCTGGTCCAGGG + Intergenic
953843819 3:46410917-46410939 ATGCAGATACTGCTGACCCAAGG + Intronic
954642943 3:52112907-52112929 ATGCTGATGCTGCTGATCCAGGG - Intronic
955065694 3:55531995-55532017 ATGCTGATATTCCAGATTCAAGG + Intronic
955531157 3:59874511-59874533 ATGCTGATGCTGCTGGTCCAGGG + Intronic
955783160 3:62507613-62507635 ATGCTGAAGCTGCTGATCCAGGG - Intronic
955823119 3:62917536-62917558 AGGCTCTTATTGCTGACCCGTGG - Intergenic
955837061 3:63067662-63067684 ATGCTGATGTTGCTGGCCCATGG - Intergenic
956165363 3:66394466-66394488 ATGCTGGGGCTGCTGACCCAAGG + Intronic
956230354 3:67008261-67008283 ATGATGACATTGCTGACCAGTGG + Exonic
956319754 3:67983839-67983861 ATACTGATCTTGCAGATCCAGGG - Intergenic
956773572 3:72547191-72547213 AGGCTGGCATTGCTCACCCAGGG + Intergenic
957914577 3:86671681-86671703 ATGCCGATGCTGCTGATCCAGGG + Intergenic
958060615 3:88475054-88475076 ATACTGATACTCCTAACCCATGG - Intergenic
958590213 3:96148237-96148259 ATGTTGATATTGCAAACTCAAGG - Intergenic
958882737 3:99691471-99691493 ATGCTGATGCTGCTGGTCCATGG - Intronic
960171095 3:114461701-114461723 ATGCTGATGCTGCTGGCCCAAGG - Intronic
960534995 3:118805723-118805745 ATGCTGATGTTACTGACCTGGGG - Intergenic
960639412 3:119811925-119811947 ATGCTGATGCTGCTGACCCAGGG - Intronic
960741205 3:120835713-120835735 AAGCTGATGCTGCTGATCCATGG + Intergenic
961925671 3:130477602-130477624 ATGCTGATGTGGCTGGTCCAGGG - Intronic
962364067 3:134765778-134765800 ATGCTGATGCTGCTGGCCAAAGG - Intronic
962953579 3:140243710-140243732 ATGCTGACACTGCTAGCCCATGG - Intronic
963346686 3:144103385-144103407 ATGCTGACACTGCTGGTCCAGGG + Intergenic
964812993 3:160685768-160685790 ATGCTGGTGATGCTGATCCATGG - Intergenic
965507466 3:169532272-169532294 ATGCTGATGCTGCTGGCCCAGGG + Intronic
965513437 3:169594404-169594426 ATGCTGATACTGCTAGTCCAGGG - Intronic
965641006 3:170829018-170829040 ATGCTGATGCTGCTGGTCCAGGG - Intronic
966350538 3:179029263-179029285 AGGCTGAAACTGCTGACCTATGG + Intronic
966402850 3:179564052-179564074 ATGCTGACACTGCTGGTCCATGG - Intronic
966927527 3:184655099-184655121 ATGCTGATGTTGCTGGTCCAGGG + Intronic
967113196 3:186313571-186313593 ATGCTGATGCTGCTGGTCCAGGG - Intronic
967319567 3:188182234-188182256 ATACTGATGCTGCTGGCCCAAGG - Intronic
967738551 3:192980314-192980336 ATGCTGATGCTGCTGATCCAGGG + Intergenic
967874640 3:194259272-194259294 ATGCTGATGCTGCTGGCCCATGG + Intergenic
969954726 4:10877168-10877190 ATGCTGATGCTGCTGGCCCAAGG - Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
971464476 4:26940945-26940967 GTGCTGATACTGCTGGTCCAGGG + Intronic
972447800 4:39162836-39162858 ATGCTGATTTTGCTGGTCCAGGG - Intergenic
976164713 4:82242014-82242036 ATGCTGATGCTGATGGCCCAAGG - Intergenic
976774425 4:88691934-88691956 TTGCTGGCATTGCTGCCCCAGGG + Intronic
978503003 4:109428958-109428980 ATGCTGATGCTGCTGATCCATGG - Intergenic
979534583 4:121805308-121805330 ATACTGATGTTGCTGGTCCAGGG + Intronic
980343885 4:131586480-131586502 ATGCTGACTTTGCAGACTCATGG + Intergenic
981450407 4:144890528-144890550 ATGCTAATATTGTTGGTCCAGGG + Intergenic
981718887 4:147779156-147779178 ATGCTGATGTTGCTGGTTCAGGG + Intronic
981961169 4:150540775-150540797 AAGTTGATTTTGCTGACACAGGG - Intronic
982092701 4:151894300-151894322 ATGATGATAATGCTGGTCCAGGG - Intergenic
983029659 4:162783924-162783946 TTTCTGATTTTGCTTACCCATGG + Intergenic
983100654 4:163622095-163622117 CAGCTGAGATTGCTTACCCAGGG + Intronic
983701480 4:170600713-170600735 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
983905507 4:173177229-173177251 ATGCTGATGCTGCTGGTCCAGGG + Intronic
986513017 5:8528786-8528808 AGGCTGATATGGCTTACACAGGG - Intergenic
988801242 5:34698341-34698363 CTGCTGATATTGGTTACCCCTGG + Intronic
990687756 5:58326225-58326247 ATGTTGATATTTCTGAAACATGG - Intergenic
991534915 5:67658759-67658781 TTGCTGATATTGATGGCCCAAGG + Intergenic
992714627 5:79497863-79497885 ATGCTGATGCTGCTGGTCCAGGG - Intronic
992890037 5:81195636-81195658 ATGCTGATGCTGCTGGCCCGGGG - Intronic
993493818 5:88585709-88585731 ATGCTGATGCTGCTGATCTAAGG - Intergenic
994069214 5:95579582-95579604 CTGCTGATGTTGCTGGTCCATGG + Intronic
995412768 5:111877416-111877438 ATTCTGATGTTGGTGATCCATGG - Intronic
995549077 5:113262845-113262867 ATGCTGATACTGCTGGTTCACGG + Intronic
995733653 5:115273797-115273819 ATGCTGATTTTGCTGGTCTAGGG + Intronic
995856390 5:116597342-116597364 ATGGTGATATTGCTGACCCAGGG + Intergenic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
996577247 5:124988975-124988997 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
996703858 5:126477131-126477153 ATGCTGATATTGATGGTCAAAGG - Intronic
997614285 5:135235935-135235957 ATGCTGATGTTGCTGGTCCAGGG + Intronic
997881489 5:137595508-137595530 ATGCTGTCAGTGCTGACCCCAGG - Intronic
998257773 5:140601693-140601715 ATGCTGAGACTGCTGGCACAGGG - Intergenic
999416215 5:151398227-151398249 ATGATGATAGTCCTTACCCATGG - Intergenic
999626678 5:153528582-153528604 ATGCTGATGCTGCTGGTCCAGGG + Intronic
999823865 5:155255726-155255748 ATGCTGATGTTGCTGATCTGAGG - Intergenic
999893189 5:156000899-156000921 TTGCTGATGCTGCTGATCCAGGG + Intronic
1000568884 5:162885544-162885566 TTGCTGATACTGCTGGTCCAGGG - Intergenic
1000836407 5:166160211-166160233 ATGCTGATGCTGCTGATACAGGG + Intergenic
1000836785 5:166164961-166164983 ATGCTAAAATAACTGACCCAAGG + Intergenic
1001279603 5:170377349-170377371 ATCCTGATGCTGCTGGCCCAGGG + Exonic
1001780475 5:174364625-174364647 ATGCTGATGCTGCTGGCCCAGGG - Intergenic
1002089687 5:176797257-176797279 ATGCTGATATGACTTGCCCAAGG + Intergenic
1003120590 6:3316123-3316145 ATGCTGATGCTGCTGGCCCAGGG + Intronic
1003328538 6:5110880-5110902 ATGCTGATGCTGCTGGTCCACGG + Intronic
1003492539 6:6636137-6636159 AGGCTGATGATGCTGGCCCAGGG + Intronic
1003633172 6:7807238-7807260 ATGCTGATGCTGCTGGTCCATGG - Intronic
1003695432 6:8402040-8402062 ATGCTAATGTTGCTGGTCCATGG - Intergenic
1003830150 6:10000544-10000566 ACGCTGATATTGCTGGCCCAGGG - Intronic
1004534775 6:16489957-16489979 ATGCTGATACTGCTGGTCCAGGG + Intronic
1004582594 6:16968617-16968639 ATGCTGATGTTGCTGGTTCAAGG + Intergenic
1004966984 6:20863172-20863194 ATGCTGATACTGCTGGTGCATGG + Intronic
1006728099 6:36214485-36214507 ATGCTACTATTGCTGTCCAATGG - Intronic
1006974862 6:38090234-38090256 ATGCTGATACTGCAGACCTGAGG - Intronic
1008194389 6:48500176-48500198 CAGCTGAAATTCCTGACCCACGG + Intergenic
1008312606 6:49994917-49994939 ATGCTGATGTTGCTGGTCAATGG + Intergenic
1008391223 6:50954304-50954326 ATGCTGATGTTGCTGGTCCAAGG + Intergenic
1008639651 6:53448884-53448906 ATGCTGCTACTGCTGGTCCAGGG - Intergenic
1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG + Intronic
1012445043 6:99298479-99298501 ATGCTGATACTGCTGCTCCAGGG + Intronic
1013309919 6:108884263-108884285 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1013765430 6:113568802-113568824 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1014610526 6:123539331-123539353 ATGCTAACATTGCTGGTCCATGG + Intronic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1015226678 6:130865024-130865046 AAGCTGATGCTGCTGATCCAGGG + Intronic
1015423001 6:133032797-133032819 ATGCTGATGGTGCTGGTCCAAGG - Intergenic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1016534443 6:145094754-145094776 ATGCAGTCATTGCTAACCCATGG + Intergenic
1016578098 6:145594075-145594097 ATGTTGTTATTACTGATCCATGG + Intronic
1016817511 6:148317167-148317189 TTGCTTATATTACTGACCAAAGG + Intronic
1016948062 6:149552190-149552212 ATGCTGACATTGCTGCCACTGGG - Intergenic
1017264839 6:152431345-152431367 ATGCTGAGGCTGCTGATCCAGGG + Intronic
1018417456 6:163613382-163613404 ATGCTGGTGTTGCTGACTCAGGG + Intergenic
1018969906 6:168520101-168520123 ATGCTGCTTTTGCTGGCCAAGGG + Intronic
1019878799 7:3840487-3840509 ATGCTGATAGTACTAGCCCAAGG - Intronic
1020275016 7:6618729-6618751 AAACTGAAATTGCTGCCCCAGGG + Intronic
1021294440 7:18887318-18887340 ATGCTGATACTCCTGATCTAGGG + Intronic
1021622143 7:22559570-22559592 ATGCTGTTGCTGCTGCCCCAGGG + Intronic
1022128499 7:27380468-27380490 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1022480477 7:30740231-30740253 ACGCTGACATTGCTGGTCCAGGG - Intronic
1022799402 7:33761400-33761422 ATGCTGATGCTGCTGGACCAGGG + Intergenic
1023044841 7:36201962-36201984 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1023185682 7:37530583-37530605 ATGCTGATGCTGCAGGCCCAAGG + Intergenic
1023760655 7:43462438-43462460 ATCCTGATGCTGCTGGCCCAGGG - Intronic
1024305946 7:47929683-47929705 ATGCTGATGCTGCTGGCCCTGGG - Intronic
1024598675 7:50961331-50961353 ATGCTGATGCTGCTCATCCAGGG + Intergenic
1024912423 7:54460156-54460178 GTGGCGATGTTGCTGACCCATGG - Intergenic
1026059253 7:67011457-67011479 ATGCTGATGCTGCTGGCTCAGGG - Intronic
1026718842 7:72813590-72813612 ATGCTGATGCTGCTGGCTCAGGG + Intronic
1027364925 7:77447545-77447567 TTGCTAATGCTGCTGACCCAGGG + Intergenic
1027645175 7:80788529-80788551 ATACTGATATTACTGGTCCAGGG + Intronic
1028255367 7:88589465-88589487 ATGCTGATGTTGTTGATCCAGGG - Intergenic
1028838493 7:95400335-95400357 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1030554753 7:111009502-111009524 ATGCCAATAATGATGACCCATGG + Intronic
1031133821 7:117863582-117863604 CTGCTGATGTTGCTGGTCCACGG + Intronic
1032989437 7:137375675-137375697 ATGCTGATACTGCTGGTCCCAGG + Intergenic
1033157635 7:138970670-138970692 ATGCTGATGCTGCTGATCCGGGG + Intronic
1033477652 7:141706144-141706166 TTGCTGATCTGGATGACCCAAGG - Intergenic
1034378416 7:150666866-150666888 ATACTGATGCTGCTGATCCATGG - Intergenic
1034687851 7:152989347-152989369 ATGCTGATGATGCTGGCCTATGG + Intergenic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1036738720 8:11342280-11342302 ATGCTCATGTTGCTGACCCAGGG - Intergenic
1037934231 8:22903863-22903885 AGGCAGATATTGCTCTCCCATGG + Intronic
1039072926 8:33662488-33662510 ATGCTGATGTTGCTGGCCCAGGG + Intergenic
1039335148 8:36581030-36581052 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1039593759 8:38771938-38771960 ATGCTGATGTTGCTGGCCCAGGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041682538 8:60607714-60607736 ATGTAGATACTGCTGATCCAGGG + Intronic
1042175541 8:66034336-66034358 ATGCTGGCACTGCAGACCCAGGG - Intronic
1042404547 8:68388859-68388881 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1043095702 8:75968688-75968710 GTGCTTATGTTGCTGATCCAAGG + Intergenic
1043310244 8:78849965-78849987 CTGGTAATATTGCTGACACATGG + Intergenic
1043425732 8:80146917-80146939 ATGCTGATACTGCTGGTTCAGGG - Intronic
1043832856 8:85010900-85010922 AAGCTGATGCTGCAGACCCATGG - Intergenic
1045565355 8:103309208-103309230 ATGCTGATGCTGCTCACTCAGGG + Intronic
1045946877 8:107806224-107806246 ATGCTCAGATCCCTGACCCACGG - Intergenic
1046019167 8:108643301-108643323 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1047166840 8:122448855-122448877 ATCCTCATATAGCTGACCAATGG - Intergenic
1047692657 8:127372116-127372138 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
1048056133 8:130867465-130867487 GTGTTGATTTTGCGGACCCAAGG + Intronic
1050002668 9:1095095-1095117 ATGCTGATGTTGCCAGCCCAAGG + Intergenic
1050250535 9:3739392-3739414 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1051045857 9:12872751-12872773 ATGCTGATATTGATGTGCCTTGG + Intergenic
1051125578 9:13800864-13800886 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1055296317 9:74837350-74837372 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1055318115 9:75054423-75054445 ATGCTGATATTCATTACCCACGG - Intergenic
1055715531 9:79113588-79113610 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1056081608 9:83100740-83100762 ATGCTGCTACTTCTGACACAGGG + Intergenic
1056105998 9:83346855-83346877 ATGCTGACATTGCTGGCCCAGGG + Intronic
1056281093 9:85041838-85041860 CATCTGTTATTGCTGACCCAGGG + Intergenic
1056817919 9:89815153-89815175 ATGCTGATATTCCTGATCCAGGG - Intergenic
1056847368 9:90052387-90052409 ATGTTGATCTTCCTGTCCCAAGG + Intergenic
1056870817 9:90276288-90276310 ATGATGGTATTGCTAACACAGGG + Intergenic
1057323115 9:94032335-94032357 ATTCCCATATTGGTGACCCAGGG + Intronic
1057396154 9:94682357-94682379 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1057902007 9:98956748-98956770 ATGCTGATGCTGCTGGTCCATGG - Intronic
1058001646 9:99872013-99872035 ATGCTGATACTGCTGATCCTAGG - Intergenic
1058350418 9:104014887-104014909 ATGCTGATGCTGCTGATCCAGGG + Intergenic
1058424272 9:104862808-104862830 ATGCTGATGCTGCTGACCTGGGG + Intronic
1058623658 9:106911572-106911594 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1058752914 9:108056553-108056575 AAGCTGAAATGACTGACCCAAGG + Intergenic
1058784996 9:108378260-108378282 ATGCTGATGCTGCTGATCCATGG - Intergenic
1058921167 9:109616387-109616409 AAGCTGATATTGGTCACTCAGGG - Intergenic
1059290095 9:113215324-113215346 ATGCCAATATTGCTGAGTCATGG + Intronic
1059393358 9:114014832-114014854 ATACTGATGTTGCTGGTCCAGGG + Intronic
1060019818 9:120119544-120119566 ATACTAATCTTGCTGACCCATGG + Intergenic
1060149276 9:121277405-121277427 ATGCTGATGTAGCTGGTCCAGGG + Intronic
1060908545 9:127330021-127330043 ATGCTGATACTGCTGGCCTAGGG - Intronic
1203522530 Un_GL000213v1:56874-56896 ATGCTCCTGGTGCTGACCCAGGG + Intergenic
1185744110 X:2557855-2557877 ATGGTGATACTGCTCATCCATGG + Intergenic
1185757848 X:2666242-2666264 ATGTTGATGCTGCTGATCCAGGG + Intergenic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1186710679 X:12192822-12192844 ATGCTGATGCTGCTGATCCAGGG + Intronic
1186763523 X:12747684-12747706 AGGCTGATGCTGCTGGCCCAGGG + Intergenic
1186996404 X:15128225-15128247 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1187021572 X:15387930-15387952 ATGCTGATACTGCTGGTCCATGG + Intronic
1187202984 X:17153976-17153998 ATGCTGATATTGCTGATCTGGGG - Intergenic
1187420685 X:19131074-19131096 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1187424886 X:19168170-19168192 ATCCTGATATAGGTGGCCCAAGG + Intergenic
1187475425 X:19606766-19606788 ATGCTGCTATTGCCGGTCCATGG + Intronic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1187590485 X:20712175-20712197 ATACTGATATTGCTGGTCCAAGG + Intergenic
1187990923 X:24871357-24871379 ATGCTGATGTTGCTGATCTCAGG + Intronic
1188350678 X:29127376-29127398 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188538722 X:31225753-31225775 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189005170 X:36986601-36986623 ATGCTGATGCTTCTAACCCAAGG - Intergenic
1189043859 X:37571341-37571363 ATGCTGATGCTTCTAACCCAAGG + Intronic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1189124036 X:38426443-38426465 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189166562 X:38866675-38866697 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189319880 X:40081466-40081488 AAACTGATGTTGCTGACCCTTGG + Intronic
1189553774 X:42120514-42120536 ATACTGATAATGCTGGTCCAGGG - Intergenic
1189855989 X:45225517-45225539 ATGCTGATGCTGCTGAACCAGGG - Intergenic
1189862892 X:45291592-45291614 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1189871109 X:45383792-45383814 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189912273 X:45822510-45822532 ATGCTGATGTTGCTAGTCCAAGG + Intergenic
1190021952 X:46886624-46886646 ATACTGATGCTGCTGGCCCATGG - Intergenic
1190423904 X:50313389-50313411 AAACTGATACTGCTGAACCAAGG - Intronic
1190459701 X:50660323-50660345 ATGCAGATGCTGCTGATCCAAGG + Intronic
1190827605 X:54031957-54031979 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1191011119 X:55760435-55760457 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
1193328584 X:80210415-80210437 ATGGTGATATTGGTGACCTAAGG - Intergenic
1194702763 X:97134634-97134656 ATACTGATATTGCTGGTCCAGGG + Intronic
1195244057 X:102980196-102980218 ATCCTGGGATGGCTGACCCATGG - Intergenic
1195965595 X:110427349-110427371 ATGCTGGTGTTGCTGGCCCCAGG - Intronic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1197644316 X:129001613-129001635 ATGCTGATGCTGCTGATCCATGG - Intergenic
1197717402 X:129719387-129719409 ATGCTGATGTTGCTGGTCCAGGG + Intergenic
1197787207 X:130210855-130210877 ATGCTGATGATGCTGGTCCATGG - Intronic
1199311974 X:146330979-146331001 ATGCTGATGTTTCTGGTCCATGG - Intergenic
1199421331 X:147648234-147648256 GTGCTGATGCTGCTGATCCATGG + Intergenic
1200839535 Y:7766574-7766596 ATGCTGATGATGCTGGTCCATGG + Intergenic