ID: 1009449978

View in Genome Browser
Species Human (GRCh38)
Location 6:63789436-63789458
Sequence ATGAGGGTTCTGGTCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009449967_1009449978 22 Left 1009449967 6:63789391-63789413 CCCAGCCCCAGAAACAGAGCACC 0: 1
1: 0
2: 1
3: 22
4: 329
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data
1009449971_1009449978 15 Left 1009449971 6:63789398-63789420 CCAGAAACAGAGCACCAAGAGTT 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data
1009449969_1009449978 17 Left 1009449969 6:63789396-63789418 CCCCAGAAACAGAGCACCAAGAG 0: 1
1: 0
2: 2
3: 33
4: 322
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data
1009449972_1009449978 1 Left 1009449972 6:63789412-63789434 CCAAGAGTTTATGTCTTTGAAGC 0: 1
1: 0
2: 1
3: 24
4: 318
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data
1009449968_1009449978 21 Left 1009449968 6:63789392-63789414 CCAGCCCCAGAAACAGAGCACCA 0: 1
1: 0
2: 5
3: 53
4: 817
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data
1009449970_1009449978 16 Left 1009449970 6:63789397-63789419 CCCAGAAACAGAGCACCAAGAGT 0: 1
1: 0
2: 0
3: 18
4: 233
Right 1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009449978 Original CRISPR ATGAGGGTTCTGGTCAACCT GGG Intronic
No off target data available for this crispr