ID: 1009450630

View in Genome Browser
Species Human (GRCh38)
Location 6:63795993-63796015
Sequence CTTGTCCAGGCCATCCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009450630_1009450635 25 Left 1009450630 6:63795993-63796015 CCTTGAAGGATGGCCTGGACAAG 0: 1
1: 0
2: 1
3: 16
4: 179
Right 1009450635 6:63796041-63796063 TTCATTAATGAAACCCTCAAAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1009450630_1009450633 1 Left 1009450630 6:63795993-63796015 CCTTGAAGGATGGCCTGGACAAG 0: 1
1: 0
2: 1
3: 16
4: 179
Right 1009450633 6:63796017-63796039 GTAGCTAGTGGTTCAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009450630 Original CRISPR CTTGTCCAGGCCATCCTTCA AGG (reversed) Intronic
901451910 1:9341033-9341055 CTAGTCCAGGCCAGCAATCAGGG - Intronic
902717093 1:18280288-18280310 CTTTTCCAGCCCCTCTTTCAGGG - Intronic
904385883 1:30141782-30141804 CATGTCCAGTCCATCTTGCATGG - Intergenic
908257950 1:62318302-62318324 CTTGCCCTGGGCATCCTTCGGGG - Intronic
913370729 1:118096158-118096180 CAAGTCCTGTCCATCCTTCAGGG + Intronic
914763449 1:150617646-150617668 CTTGTAAAGGCCTTACTTCAGGG - Intronic
916826446 1:168446278-168446300 CTTCTCCAGGCCATCTTCCAGGG + Intergenic
920324045 1:205147625-205147647 ATTGTCCAGCCCATGCTCCAGGG - Exonic
920852518 1:209638034-209638056 CTAATCCAGGGCTTCCTTCAGGG - Intronic
922923856 1:229331048-229331070 CTTTTCCAGGTCATCCTTAGTGG - Intronic
923343909 1:233032797-233032819 CAAGTCTAAGCCATCCTTCATGG - Intronic
1064602053 10:17004104-17004126 CTTGTCCTGATCATTCTTCAAGG + Intronic
1067481312 10:46600057-46600079 CTTGTATAGGCCATCCCTCAGGG + Intergenic
1067613439 10:47741670-47741692 CTTGTATAGGCCATCCCTCAGGG - Intergenic
1067820819 10:49528467-49528489 CATCTCCAGGCCATCCTTGGAGG - Exonic
1068542636 10:58312639-58312661 CTTATCCAATCCATCCTTGATGG + Intergenic
1070333335 10:75433116-75433138 CTTGTCCAGCCCCTCCCTCCAGG - Intronic
1071468910 10:85965393-85965415 CTTATCCAGGCTATCATTGATGG - Intronic
1071628845 10:87201764-87201786 CTCGTATAGGCCATCCCTCAGGG - Intergenic
1072690255 10:97568096-97568118 CTGGCCCAGGCCATCCTGGATGG + Exonic
1073413303 10:103360310-103360332 CTTCCCCACCCCATCCTTCACGG - Intergenic
1073623634 10:105074180-105074202 CTTGTCCAGACAAGCCTGCACGG + Intronic
1073794477 10:106972962-106972984 CTAGCACAAGCCATCCTTCAAGG - Intronic
1074285361 10:112092633-112092655 CTTGACCAGTCCATTCTTCAGGG - Intergenic
1075936941 10:126350938-126350960 CCTGTCCAGGCTCTCCTGCATGG + Intronic
1076875777 10:133214866-133214888 CTCGACCAGCTCATCCTTCACGG + Intronic
1081213370 11:40363163-40363185 TTTATCCAGTCCATCCTTGATGG - Intronic
1088432888 11:109777995-109778017 CTTGACTCTGCCATCCTTCAGGG + Intergenic
1089762626 11:120739430-120739452 CTCTTCCAGGCCTTGCTTCATGG + Intronic
1092949374 12:13487169-13487191 CTTTTACAGCCTATCCTTCATGG - Intergenic
1093695772 12:22158500-22158522 CATGACCAGGTCAGCCTTCAGGG - Intronic
1096574871 12:52546432-52546454 CTTGGCCCGGGCATCCTTCAGGG + Exonic
1096578276 12:52568315-52568337 CTTGGCCTGGGCATCCTTCAGGG + Exonic
1096581392 12:52587777-52587799 CTTGGCCCGGGCATCTTTCAGGG + Exonic
1096603402 12:52746733-52746755 CTTGGCCTGGGCATCCTTGAGGG + Intergenic
1102235370 12:111291239-111291261 CTTGTCCAGGCACTTGTTCAGGG - Intronic
1102477252 12:113196612-113196634 CTTGTCCTGGGCAACCATCAGGG - Intronic
1105061934 12:133160652-133160674 CTGGTCAAGGCGATTCTTCAGGG - Intronic
1107858304 13:44636630-44636652 CATGCCAAGGCCATCCTTCTCGG - Intergenic
1108861119 13:54860353-54860375 CTTCTCCAAGCAATTCTTCATGG - Intergenic
1111443361 13:88310850-88310872 CTTATCCAGTCCACCATTCATGG - Intergenic
1112829960 13:103437253-103437275 CTTGTCCAGGCCATCATTTAGGG - Intergenic
1113594812 13:111523690-111523712 CATGTCCAGTCCAGGCTTCAAGG - Intergenic
1113801840 13:113090712-113090734 CTTGTCCACGCTGGCCTTCAGGG - Intronic
1113913971 13:113860249-113860271 CTAATCCAGGCCAACCCTCAGGG + Intronic
1115294848 14:31813918-31813940 CTTATCCAGTCCATCATTGATGG + Intronic
1117077042 14:52115281-52115303 CCTTTCCAGGCCAACCTTCTTGG - Intergenic
1121557372 14:94848644-94848666 CTTGTCCAAGCCATCCTATCAGG + Intergenic
1121974434 14:98389872-98389894 CTTGGCAATGCCATCCTGCAAGG - Intergenic
1122552384 14:102556994-102557016 CTGGTCCAGCCCACCCCTCAGGG + Intergenic
1202905289 14_GL000194v1_random:68206-68228 CTTGTCCAGGACTCCCATCAGGG + Intergenic
1124560698 15:30770903-30770925 TCTGTCAAGGCCCTCCTTCACGG - Intronic
1124670509 15:31634540-31634562 TCTGTCAAGGCCTTCCTTCACGG + Intronic
1124701248 15:31914420-31914442 CTTGTCCAGGCTATCAGACACGG - Intergenic
1128439347 15:67689911-67689933 CTTGTCCAACCCATGCTCCACGG + Intronic
1129972813 15:79795282-79795304 CTCATCCTAGCCATCCTTCAGGG + Intergenic
1130547081 15:84864495-84864517 CTTGCCCAGGTCTTCCTCCAGGG - Exonic
1130931476 15:88431464-88431486 CTTGGATAGGCCATCCCTCAGGG + Intergenic
1132759249 16:1500908-1500930 CGTGTCCAGGCAATCCTTCTGGG - Intronic
1138585779 16:57969787-57969809 ACTGGCCAGGCCATCCTGCAGGG - Intronic
1138589425 16:57991647-57991669 CTGGTCCAGGCCATTGTTCCCGG + Intergenic
1139839675 16:69868270-69868292 CCTGCCCAGCCCATCATTCAGGG + Intronic
1140651593 16:77094323-77094345 GTTGTCCAGATCATCCTGCAAGG + Intergenic
1144250069 17:13407529-13407551 CTGGTTCAAGCCATGCTTCATGG + Intergenic
1144757669 17:17689843-17689865 CTGGTCCATGAGATCCTTCAGGG - Intronic
1146469540 17:33112796-33112818 CTTCTCCAGCCCATCCTCTAAGG + Intronic
1147381502 17:40058992-40059014 CTTTTCCAGGCTGTCTTTCAGGG - Intronic
1148862242 17:50610546-50610568 CTGGTCCAGCCCACCCTCCATGG + Intronic
1149598269 17:57876651-57876673 CTTGTCCAGTCCCTCCATCCAGG - Intronic
1151819409 17:76489644-76489666 CCTGCCCAGGCCATCCTTTGAGG + Intronic
1152532040 17:80924436-80924458 CTGCTCCAGGGCATCCTGCAAGG - Intronic
1155115704 18:22764550-22764572 CTTGTCCAGTCTATCATTGATGG - Intergenic
1156500560 18:37554749-37554771 CTTCCCCAGGACATCCTTCCAGG + Intronic
1156545800 18:37962607-37962629 CTTGTCCCTGCCCTCCTACACGG + Intergenic
1160048383 18:75408489-75408511 CTTGGCCAGCCCAGTCTTCAAGG - Intronic
1162604144 19:11694299-11694321 CTTGTTCAGGCCATCATGGAAGG - Intergenic
1163311436 19:16517261-16517283 CTCCTCCAGGGCATCCTCCATGG - Exonic
1165723990 19:38100038-38100060 ATACTCCAGGGCATCCTTCAAGG - Exonic
1165912287 19:39236852-39236874 CTGGTCCAGGACATCCCCCAGGG + Intergenic
925539834 2:4954665-4954687 CTTGTCCATTCCATCATTCAGGG - Intergenic
926061320 2:9806899-9806921 CTTGTCCATGCCAGGCTTCTGGG - Intergenic
926400036 2:12487753-12487775 CCTCTCCTGGCCATCCTGCAGGG + Intergenic
927630611 2:24770852-24770874 CTGGTCCAGGCAGTACTTCATGG + Intergenic
927881982 2:26695402-26695424 CTTGTCCATGCTAACCTTCCAGG + Intronic
929269766 2:39960380-39960402 CCTTTCTAGGACATCCTTCAAGG - Intergenic
929484563 2:42342226-42342248 CTGGTCCAGGGCCCCCTTCAGGG - Intronic
929823226 2:45289985-45290007 CTTGTTCAGGCCTTCCACCATGG - Intergenic
931498997 2:62842613-62842635 CTTGACCATTCCATCCTTTATGG + Intronic
931717776 2:65042862-65042884 CTACTTCAGGCCATCCTTCAAGG + Intergenic
932740798 2:74289846-74289868 CTTTTTCATGCCATCCTCCAAGG - Intronic
933443286 2:82342691-82342713 CTTGGCAATGCCATGCTTCAAGG + Intergenic
933748629 2:85588830-85588852 CTGCTCCATGTCATCCTTCAAGG + Intronic
936005527 2:108883732-108883754 CTTCTCCAGGGCATCCCCCAGGG + Intronic
937948460 2:127364406-127364428 CTTGTCCAAACCATCTTTTAAGG + Intronic
938121369 2:128636575-128636597 CATGTCCAGGCCATTCCTCCTGG + Intergenic
938768091 2:134476832-134476854 CTTCTGCAGGCCATACTACAGGG - Intronic
939023099 2:136981576-136981598 CTTCTGCAGGCCATGCTACAAGG - Intronic
943999416 2:194813703-194813725 CTTGTCCTGTCCATCTTCCAAGG - Intergenic
944359016 2:198829678-198829700 TTTGTCCAGTCTATCCTTGATGG - Intergenic
945678811 2:212888209-212888231 TTTATCCAGGCTATCATTCATGG - Intergenic
946032856 2:216718623-216718645 CTTGGCCGGGCCAACCTGCAGGG - Intergenic
947413907 2:229872895-229872917 CTTCTCCAAGCCAGCCTTTAAGG + Intronic
947726348 2:232403269-232403291 CTTCTCCAGGGCCTCCTTCAAGG + Intergenic
949067434 2:242001688-242001710 TGTGTCCAGGCCACCCTCCAAGG + Intergenic
1172589056 20:36104931-36104953 CTTGTCATGTACATCCTTCATGG - Intronic
1173634515 20:44543585-44543607 CTTGTCCTGGACAGACTTCAAGG + Intronic
1173784068 20:45779852-45779874 CTTTTCCAGGCCAGGCTTCCTGG + Intronic
1174882507 20:54295884-54295906 CTTGTCCAGCTCATACATCAAGG - Intergenic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
1176624657 21:9082964-9082986 CTTGTCCAGGACTCCCATCAGGG + Intergenic
1178159000 21:29888880-29888902 GTTGTCCTGGCCTTCCATCATGG + Intronic
1178908757 21:36657441-36657463 CTTGTCCAGTCTATCATTGATGG - Intergenic
1179995372 21:44971612-44971634 CGGGTCCAGGACATCCTTCCTGG - Intronic
1181019184 22:20089772-20089794 CTGGTCCAGGCCATACTTCTTGG + Exonic
1182295204 22:29308188-29308210 CTCGGCCAGGTCCTCCTTCATGG - Exonic
1185254207 22:49823232-49823254 CATGTACAGGCCAGCCTTCTGGG + Exonic
949495253 3:4625490-4625512 CTTGTCCAGACCTACTTTCAGGG + Intronic
951743314 3:25948180-25948202 CTTTTCCCAGCCATCCTCCACGG + Intergenic
952681069 3:36093825-36093847 CCTGTCTAGGTCATCCATCAAGG - Intergenic
952903248 3:38123188-38123210 CTTGTCCATGACGTCCTTCTGGG - Exonic
953147606 3:40293149-40293171 CTGGTTCAGGCCATGATTCAGGG + Intergenic
953324013 3:41997262-41997284 CTTGTCCAAAGCATCCTTCAAGG - Intergenic
954457529 3:50607930-50607952 CTTGTCCAGGCCACGCATCCTGG - Exonic
956888759 3:73588317-73588339 TTTGTCCAGGCTATCGTTGATGG + Intronic
961177567 3:124848452-124848474 ATTGTCCAAGTCATCCTTCATGG + Exonic
962899650 3:139748756-139748778 CTTGTCCAACCCATGGTTCATGG - Intergenic
963600310 3:147372765-147372787 CTTCTCCAGTCCATCTTTAAAGG - Intergenic
966236361 3:177706009-177706031 CATGTCCAGGCCAATTTTCAAGG + Intergenic
966942514 3:184755928-184755950 CTCCTCCAGCCCAGCCTTCAGGG - Intergenic
968767752 4:2482770-2482792 CTTGTCCCTGCAAACCTTCAGGG + Intronic
968875876 4:3267713-3267735 CTTGCCCAGCCCCTCCTTCCAGG + Intronic
970566772 4:17339189-17339211 TTCCTCCATGCCATCCTTCAAGG - Intergenic
971881506 4:32380635-32380657 CTTGTGCCAGCTATCCTTCAGGG - Intergenic
977466059 4:97383794-97383816 CTTGTCTAGGACATCCATGAAGG + Intronic
978243362 4:106542759-106542781 CTTATCCAGTCTATCATTCATGG - Intergenic
979546714 4:121948736-121948758 CTTGTCCTATCTATCCTTCAAGG + Intronic
980385728 4:132086612-132086634 CTTTTCCAGGACATCCCTGAAGG - Intergenic
981290198 4:143066024-143066046 CTTATCCAGTCCATCATTGATGG + Intergenic
984854479 4:184182614-184182636 CTTATCCAGTCTATCATTCATGG - Intronic
984933439 4:184868573-184868595 CTGGTCCAGGCCATCCTGCCTGG - Intergenic
989112580 5:37920978-37921000 ATTTTCCAGGCATTCCTTCATGG + Intergenic
989140330 5:38195287-38195309 CTTGTCCAGGACATCATGCCAGG - Intergenic
991489449 5:67167746-67167768 CTTGTCCTGGCCATTCCTAATGG - Exonic
996496880 5:124168378-124168400 TTTGTCCAGTCTATCCTTGATGG + Intergenic
997621630 5:135302521-135302543 CTTTCCCAGGCCAACCATCATGG + Intronic
998386838 5:141762138-141762160 CTTGTCCCACCCATCCTACATGG + Intergenic
998729052 5:145053625-145053647 CTTGCTCAAGTCATCCTTCAGGG - Intergenic
999370940 5:151054916-151054938 CTTGTCCTGGCCTTCCCTTAGGG - Intronic
999531447 5:152467397-152467419 CTTGTCATGTCCTTCCTTCACGG - Intergenic
1001080058 5:168660982-168661004 CTTGCCCAGGCCATCCTCTCTGG + Intergenic
1001797924 5:174517763-174517785 CTTCTCAATGCCATGCTTCAGGG - Intergenic
1002115333 5:176957851-176957873 CTTGTCCAGGCCAGCTATCTTGG - Intronic
1002649747 5:180682500-180682522 CTCCTCCAGGCCACCCTTCCTGG + Intergenic
1003123926 6:3340125-3340147 CTTCTCCAGGCCATCCCTCCTGG - Intronic
1008560265 6:52717222-52717244 CTTATTCAGGCCATCTTTCTGGG - Intergenic
1009450630 6:63795993-63796015 CTTGTCCAGGCCATCCTTCAAGG - Intronic
1010918325 6:81648868-81648890 CTTGTCCAGCTGATCCTTCTAGG - Intronic
1012004351 6:93693967-93693989 CTTGTCGAACCCTTCCTTCATGG + Intergenic
1012531527 6:100243821-100243843 TTTGTCCAGGCTATTCTCCATGG - Intergenic
1012953724 6:105546168-105546190 CTTTCCCAGGCCAGCCTTTAAGG - Intergenic
1014640170 6:123899716-123899738 CTAGACCAGGACATCCTTGAGGG - Intronic
1015855338 6:137618280-137618302 GTGCTCCATGCCATCCTTCAAGG - Intergenic
1016422589 6:143900593-143900615 CTATTCCAGGCCCTCATTCAAGG - Intronic
1019885445 7:3900495-3900517 CTCGTCCTGCCCATCCTTCTTGG + Intronic
1021370503 7:19839305-19839327 TTTATCCAGTCCATCGTTCATGG + Intergenic
1023805772 7:43871984-43872006 CATGTCCAGGCAGTCCTTGAGGG - Intronic
1024370660 7:48580280-48580302 CTCGTCCAGGGCATCCTGCTGGG - Exonic
1026341813 7:69440820-69440842 CTTGGCCAGACCTTCCTACATGG + Intergenic
1030423428 7:109339199-109339221 CTTGCCCAGGCCCTCTTTAAAGG + Intergenic
1032850587 7:135791725-135791747 CTTCTCTAGGCCATGCTGCAGGG - Intergenic
1032882634 7:136105410-136105432 TTTATCCAGGCCATCTTTGATGG + Intergenic
1032975974 7:137222793-137222815 CAAATCCAGTCCATCCTTCAAGG + Intergenic
1033207325 7:139434197-139434219 CTTGTCAAGTACATCCTTTAGGG + Intergenic
1034345404 7:150382484-150382506 CTTCTCAAGGCCACCCTTCCTGG - Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035660699 8:1345643-1345665 CCTGTCCTGCCCATCCCTCAGGG - Intergenic
1036727470 8:11232356-11232378 CTTATCCAGGCCCTCACTCAGGG + Intergenic
1039894160 8:41704576-41704598 CTTGTCAATGTCAGCCTTCAAGG - Intronic
1043221435 8:77670857-77670879 CTTGTCCAGTCTATCATTAATGG - Intergenic
1048574441 8:135679835-135679857 ATTGTCCAGCCCATCCCTGATGG + Intergenic
1048867827 8:138773675-138773697 CTGGTGCAGGCCCTCCATCAAGG - Intronic
1049360990 8:142212572-142212594 CCTGCCCAGTCCATCCTTCCTGG + Intronic
1049606330 8:143530918-143530940 CTCGCCCAGGCCACCCTTCTGGG + Intronic
1051126994 9:13815777-13815799 CCTGTCCAGGCCCTGCTTCAAGG - Intergenic
1056622858 9:88228822-88228844 GGTGTCCAGGCCATCCCTGAAGG + Intergenic
1057715091 9:97486842-97486864 TTTGTCCTGGTCATCCTCCATGG + Intronic
1058566745 9:106293878-106293900 CAAATCCAGTCCATCCTTCAAGG + Intergenic
1203747827 Un_GL000218v1:53392-53414 CTTGTCCAGGACTCCCATCAGGG + Intergenic
1185752001 X:2619037-2619059 CCTGGCCAGGTCAGCCTTCACGG + Intergenic
1189120897 X:38393871-38393893 CTTGTCCATTCCAGCTTTCAAGG + Intronic
1192259225 X:69494268-69494290 CTTCTCCAGGACATTCCTCAGGG - Intergenic
1195343812 X:103928688-103928710 CTCTGCCAGGCCATCCTGCATGG - Intronic
1196606764 X:117665923-117665945 TTTATCCAGTCCATCCTTGATGG + Intergenic
1198785700 X:140285108-140285130 TTTGTCCAGTCTATCATTCATGG + Intergenic
1201161166 Y:11168386-11168408 CTTGTCCAGGACTCCCATCAGGG + Intergenic
1201372206 Y:13278088-13278110 CCTTTCCAGGCCATACTTCCTGG + Intronic
1201963829 Y:19709795-19709817 CTGTTCCAGGACATCCTGCAAGG + Exonic