ID: 1009458235

View in Genome Browser
Species Human (GRCh38)
Location 6:63881721-63881743
Sequence TTTCCATTACTTATAGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009458230_1009458235 25 Left 1009458230 6:63881673-63881695 CCCTTGGCACAAATATGCAAAAT 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data
1009458232_1009458235 -3 Left 1009458232 6:63881701-63881723 CCTTTAGCCTGAAAATGTTATTT 0: 1
1: 0
2: 2
3: 40
4: 347
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data
1009458233_1009458235 -10 Left 1009458233 6:63881708-63881730 CCTGAAAATGTTATTTCCATTAC 0: 1
1: 0
2: 3
3: 36
4: 380
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data
1009458229_1009458235 26 Left 1009458229 6:63881672-63881694 CCCCTTGGCACAAATATGCAAAA 0: 1
1: 0
2: 0
3: 18
4: 201
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data
1009458231_1009458235 24 Left 1009458231 6:63881674-63881696 CCTTGGCACAAATATGCAAAATA 0: 1
1: 0
2: 1
3: 26
4: 333
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data
1009458228_1009458235 29 Left 1009458228 6:63881669-63881691 CCTCCCCTTGGCACAAATATGCA 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009458235 Original CRISPR TTTCCATTACTTATAGAATA GGG Intronic
No off target data available for this crispr