ID: 1009460487

View in Genome Browser
Species Human (GRCh38)
Location 6:63907027-63907049
Sequence GTGTACACACTATGCAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009460487_1009460489 1 Left 1009460487 6:63907027-63907049 CCAAGATTGCATAGTGTGTACAC 0: 1
1: 0
2: 2
3: 42
4: 570
Right 1009460489 6:63907051-63907073 GCAGATCCATGCCTGGACTCTGG 0: 1
1: 0
2: 2
3: 13
4: 186
1009460487_1009460488 -6 Left 1009460487 6:63907027-63907049 CCAAGATTGCATAGTGTGTACAC 0: 1
1: 0
2: 2
3: 42
4: 570
Right 1009460488 6:63907044-63907066 GTACACAGCAGATCCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009460487 Original CRISPR GTGTACACACTATGCAATCT TGG (reversed) Intronic
900122049 1:1052667-1052689 GTGTACACACTATACACACATGG - Intronic
910605558 1:89079996-89080018 GTTTAAACAATATGAAATCTGGG + Intergenic
911477775 1:98394817-98394839 CTGTACTCACTAGGCATTCTTGG + Intergenic
911525967 1:98985807-98985829 GTATACACATTATGCCATTTAGG + Intronic
911896131 1:103437120-103437142 GTTTAAACAATATGAAATCTGGG - Intergenic
913356038 1:117923166-117923188 GTTTAAACAATATGAAATCTGGG - Intronic
915676500 1:157537074-157537096 GTTTAAACAATATGAAATCTGGG + Intronic
915886196 1:159723606-159723628 GTTTAAACAATATGAAATCTGGG - Intergenic
915999389 1:160600278-160600300 GTTTAAACAATATGAAATCTGGG + Intergenic
916008979 1:160687284-160687306 GTTTAAACAATATGAAATCTGGG - Intronic
916290369 1:163159150-163159172 GTTTGAACACTATGAAATCTGGG - Intronic
916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG + Intergenic
917373392 1:174320845-174320867 GTTTAAACAATATGAAATCTGGG + Intronic
918744406 1:188182002-188182024 GTTTAAACAATATGAAATCTGGG + Intergenic
919000717 1:191827780-191827802 GTGTACACCCCTTGCAATATTGG + Intergenic
920062184 1:203234850-203234872 GTTTAAACAATATGAAATCTGGG + Intronic
920213721 1:204347424-204347446 GTTTAAACAATATGAAATCTGGG - Intronic
921086542 1:211799126-211799148 TTGTACACACTAGGAAATCATGG + Intronic
922361102 1:224822180-224822202 GTTTAAACAATATGAAATCTGGG - Intergenic
923419629 1:233799580-233799602 GTTTAAACAATATGAAATCTGGG - Intergenic
924358915 1:243215243-243215265 GTTTAAACAATATGAAATCTGGG + Intronic
924720788 1:246620874-246620896 GCGTACACACTATGGGCTCTGGG + Intronic
924860071 1:247911420-247911442 GTGTACACCCCCTGCAATATTGG - Intergenic
1063887554 10:10595061-10595083 GTCTACAAACTATTCTATCTGGG - Intergenic
1064399759 10:15011844-15011866 GTGTACACACCCTGCGATATTGG - Intergenic
1065512521 10:26493231-26493253 GTTTAAACAATATGAAATCTGGG - Intronic
1066626613 10:37413338-37413360 GTTTAAACAATATGAAATCTGGG - Intergenic
1066663942 10:37763981-37764003 GTTTAAACAATATGAAATCTGGG + Intergenic
1067920020 10:50445716-50445738 GTTTAAACAATATGAAATCTGGG + Intronic
1067995516 10:51268640-51268662 GTTTAAACAATATGAAATCTGGG - Intronic
1068290883 10:55000458-55000480 GTTTAAACAATATGAAATCTGGG - Intronic
1068515583 10:58021745-58021767 GTTTAAACAATATGAAATCTGGG + Intergenic
1069650198 10:70041701-70041723 GTTTAAACAATATGAAATCTGGG + Intergenic
1071183876 10:83018738-83018760 GTTTAAACAATATGAAATCTGGG + Intergenic
1071189317 10:83081635-83081657 GTTTAAACAATATGAAATCTGGG + Intergenic
1071380620 10:85055836-85055858 GTTTAAACAATATGAAATCTGGG + Intergenic
1072177063 10:92936930-92936952 GTGTACACCCTCTGCGATATTGG + Intronic
1072473197 10:95733344-95733366 GTTTAAACAATATGAAATCTGGG - Intronic
1072498285 10:95985615-95985637 GTTTAAACAATATGAAATCTGGG + Intronic
1073678540 10:105677505-105677527 GTTTAAACAATATGAAATCTGGG + Intergenic
1075459083 10:122603967-122603989 GTTTAAACAATATGAAATCTGGG - Intronic
1075459715 10:122608026-122608048 GTTTAAACAATATGAAATCTGGG - Intronic
1075460347 10:122612085-122612107 GTTTAAACAATATGAAATCTGGG - Intronic
1075460979 10:122616144-122616166 GTTTAAACAATATGAAATCTGGG - Intronic
1077851273 11:6076379-6076401 GTTTAAACAATATGAAATCTGGG + Intergenic
1078335437 11:10459485-10459507 GGGAACACACTAGGCCATCTTGG - Intronic
1078832529 11:14991391-14991413 GTGGACACACTTTGCGATATGGG - Intronic
1078832579 11:14991627-14991649 GAGTACACCCTCTGCAATTTCGG - Intronic
1078832884 11:14993224-14993246 GTGGACACCCTTTGCAATATGGG - Intronic
1078839340 11:15063674-15063696 GTTTAAACAATATGAAATCTGGG - Intronic
1078840085 11:15070192-15070214 GTTTAAACAATATGAAATCTGGG - Intronic
1079038652 11:17042374-17042396 GTGTACACCCTCTGCGATATTGG + Intergenic
1079038805 11:17043251-17043273 GTGTACACCTTCTGCAATATTGG + Intergenic
1079038833 11:17043401-17043423 GTGTACACACCCTGCGATATTGG + Intergenic
1079313019 11:19382814-19382836 ATGTACTAGCTATGCAATCTTGG - Intronic
1079585974 11:22127330-22127352 GTTTAAACAATATGAAATCTGGG + Intergenic
1081448889 11:43154309-43154331 GTGTACACCCCCTGCAATATTGG - Intergenic
1081449103 11:43155718-43155740 GTGTACACCCTTTGCGATATTGG - Intergenic
1081449402 11:43157567-43157589 GTGTACACAGCTTGCAATATTGG + Intergenic
1081450732 11:43168780-43168802 GTGTACACCCTCTGCAGTATTGG + Intergenic
1081450930 11:43170191-43170213 GTGTACACCCTCTGCCATATAGG + Intergenic
1082040318 11:47679500-47679522 TTGTAGACAGTATGCAGTCTGGG + Intronic
1082168376 11:48971660-48971682 GTGTAAACCCTCTGCAATATAGG + Intergenic
1082235066 11:49814289-49814311 GTGTAAACCCTCTGCAATATAGG - Intergenic
1082295613 11:50438416-50438438 GTTTAAACAATATGAAATCTGGG + Intergenic
1082296565 11:50447252-50447274 GTTTAAACAATATGAAATCTGGG + Intergenic
1082573016 11:54765447-54765469 GTTTAAACAATATGAAATCTGGG + Intergenic
1082608765 11:55275262-55275284 GTGTACACCCTCTGCAATATAGG - Intergenic
1082780331 11:57282498-57282520 GTTTAAACAATATGAAATCTGGG - Intergenic
1082936556 11:58662372-58662394 GTGTACACCCTCTGCAATTTCGG + Intronic
1082936803 11:58664082-58664104 GTGTACACACCCTGCGATATTGG + Intronic
1083092719 11:60217864-60217886 GTTTAAACAATATGAAATCTGGG + Intronic
1083892210 11:65601215-65601237 GCGCACACACTATTCACTCTGGG + Intronic
1084260752 11:67977131-67977153 GTGTACACACCCTGCGATATTGG - Intergenic
1085212911 11:74798121-74798143 GTTTAAACAATATGAAATCTGGG + Intronic
1086178611 11:83922601-83922623 TTGTTCACACGATTCAATCTGGG - Intronic
1086444412 11:86858626-86858648 GTGTACACCCCCTGCAATATTGG - Intronic
1086444436 11:86858776-86858798 GTGTACACCCTCTGCGATATTGG - Intronic
1086444605 11:86859822-86859844 GTGTCCACCCCATGCAATATTGG - Intronic
1086701678 11:89906198-89906220 GTGTACACTCTCTGCGATATTGG + Intergenic
1086701837 11:89907251-89907273 GTGTACACCCTCTGCACTATAGG + Intergenic
1086701874 11:89907477-89907499 GTGTACACTTTCTGCAATATTGG + Intergenic
1086704294 11:89937048-89937070 GTGTACACTTTCTGCAATATTGG - Intergenic
1086704331 11:89937274-89937296 GTGTACACCCTCTGCACTATAGG - Intergenic
1086704490 11:89938327-89938349 GTGTACACTCTCTGCGATATTGG - Intergenic
1087410406 11:97784331-97784353 GTTTAAACAATATGAAATCTGGG + Intergenic
1088008663 11:104972881-104972903 GTTTAAACAATATGAAATCTGGG + Intergenic
1088027945 11:105209099-105209121 GTGTACTCAGTAAGCAGTCTAGG + Intergenic
1088458170 11:110054275-110054297 GTTTAAACAATATGAAATCTGGG - Intergenic
1091612951 12:2026869-2026891 GAGTACACAGTATACATTCTTGG + Intronic
1092589288 12:9935905-9935927 GTTTACACACTATTAAATCCCGG + Intergenic
1093347989 12:18063303-18063325 GTTTAAACAATATGAAATCTGGG - Intergenic
1094860594 12:34461808-34461830 GTTTAAACAGTATGAAATCTGGG - Intergenic
1094864932 12:34521428-34521450 GTTTAAACAATATGAAATCTGGG + Intergenic
1094865920 12:34530002-34530024 GTTTAAACAATATGAAATCTGGG + Intergenic
1095697204 12:45155994-45156016 GTGTACACCCCCTGCAATATTGG - Intergenic
1095697290 12:45156581-45156603 GTGTACACTCACTGCAATATAGG - Intergenic
1096431127 12:51543998-51544020 GTTTAAACAATATGAAATCTGGG + Intergenic
1096506836 12:52099048-52099070 GTGTACACCCCCTGCAATATTGG + Intergenic
1096507063 12:52100346-52100368 GTGTACACCCCCTGCAATATTGG + Intergenic
1096508693 12:52114794-52114816 GTGTACACCCCCTGCAATATTGG - Intergenic
1096948815 12:55441671-55441693 GTTTAAACAATATGAAATCTGGG - Intergenic
1097432663 12:59529002-59529024 GTGTACACCCTCTGTAATATTGG - Intergenic
1097432782 12:59529739-59529761 GTGTACACCCTCTGTAATATTGG - Intergenic
1097433149 12:59531661-59531683 GTGTACACCCTCTGCGATATGGG - Intergenic
1097434232 12:59540246-59540268 GTATACACACTCTGCAATATTGG - Intergenic
1097434580 12:59542377-59542399 GTGTACACTCCCTGCAATATTGG - Intergenic
1097434644 12:59542825-59542847 GTGTACACCCTCTGAAATATTGG - Intergenic
1097436252 12:59553799-59553821 GTGTACAGCCTCTGCAATATTGG - Intergenic
1098479483 12:70942505-70942527 GTGTACACCCTCTGCAATATTGG + Intergenic
1098479850 12:70944973-70944995 GTGTACACCCCCTGCAATATTGG + Intergenic
1099144011 12:79015911-79015933 GTGGACTCACTGTGCAACCTTGG - Intronic
1099180283 12:79468192-79468214 GTGTACACCCCCTGCAATTTTGG - Intergenic
1099181275 12:79474462-79474484 GTGTACACACCCTGCGATATTGG - Intergenic
1099181684 12:79476955-79476977 GTGTACACACCCTGCGATATTGG - Intergenic
1101502091 12:105313700-105313722 GTTTAAACAATATGAAATCTGGG + Intronic
1106341174 13:28828315-28828337 GTTTAAACAATATGAAATCTGGG - Intronic
1106610952 13:31280051-31280073 GTTTAAACAATATGAAATCTGGG - Intronic
1107520532 13:41176031-41176053 GTTTAAACAATATGAAATCTGGG - Intergenic
1107867336 13:44715569-44715591 ATGTACACACAATGTAATATCGG + Intergenic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1109353939 13:61217245-61217267 GTGTACACCCCATGCAATGTTGG - Intergenic
1109354194 13:61218916-61218938 GTGTACACCCGCTGCAATATTGG - Intergenic
1109354404 13:61220267-61220289 GTGTACACCCCATGCGATATTGG - Intergenic
1109354485 13:61220802-61220824 GTGTACACCCTCTGCTATATTGG - Intergenic
1109355505 13:61227540-61227562 GTGTACACCCCCTGCAATATTGG + Intergenic
1109409330 13:61943109-61943131 GTGTACACCCCTTGCAATATTGG + Intergenic
1109409375 13:61943404-61943426 GTGTACACCCTCCGCAATATAGG + Intergenic
1109409423 13:61943701-61943723 GTGTACACCCTTTGCGATATTGG + Intergenic
1109409487 13:61944153-61944175 GTGTACACTCCCTGCAATATTGG + Intergenic
1110752624 13:79132709-79132731 TTGTAAACACTATGAAATCAGGG - Intergenic
1111077820 13:83262222-83262244 GTGGAAACACTATGCACTGTTGG - Intergenic
1111429549 13:88133732-88133754 GTTTAAACAATATGAAATCTGGG - Intergenic
1111810327 13:93090662-93090684 GTGTACACCCTCTGCAATATAGG + Intergenic
1111810404 13:93091113-93091135 GTGTACACTTTCTGCAATATTGG + Intergenic
1114157324 14:20119241-20119263 GTTTAAACAATATGAAATCTGGG - Intergenic
1114183440 14:20383345-20383367 GTGTACACACTGTGATATTTGGG + Exonic
1114435871 14:22707539-22707561 GTGTACACCCCATGCGATATGGG + Intergenic
1114435913 14:22707763-22707785 ATGTACACACGCTGCAATGTGGG + Intergenic
1114435970 14:22708139-22708161 GTGTACACCCTTTGCGATATGGG + Intergenic
1114436112 14:22709135-22709157 GTGTACACCCTCTGCAATATGGG + Intergenic
1114436143 14:22709298-22709320 GTGTACACCCTTTGTAATATGGG + Intergenic
1114436618 14:22712228-22712250 GTGTACACCCCCTGCAATATTGG - Intergenic
1114436898 14:22714120-22714142 GTGTACACTCACTGCAATTTTGG - Intergenic
1114436949 14:22714422-22714444 GTGTACACTCCCTGCAATATTGG - Intergenic
1114638416 14:24202294-24202316 GTTTAAACAATATGAAATCTGGG + Intronic
1114687081 14:24543488-24543510 GTTTAAACAATATGAAATCTGGG + Intergenic
1115958827 14:38811437-38811459 GTTTAAACAATATGAAATCTGGG - Intergenic
1116237507 14:42297717-42297739 GTTTAAACAATATGAAATCTGGG - Intergenic
1116516615 14:45813732-45813754 ATGTACACTCTCTGCAATATGGG - Intergenic
1116517063 14:45816422-45816444 GTGTACACCCCCTGCAATATCGG - Intergenic
1116517802 14:45820957-45820979 GTGTACACCCCCTGCAATGTAGG - Intergenic
1116518054 14:45822779-45822801 GGGTACACCCTCTGCAATATTGG - Intergenic
1116518331 14:45824457-45824479 GTGTACACCCTTTGCGATATTGG - Intergenic
1116518629 14:45826354-45826376 GTGTACTCACCCTGCAATATTGG - Intergenic
1116518957 14:45828405-45828427 GTGTACACACCATGCGATATTGG - Intergenic
1116519209 14:45830101-45830123 GTGTACACCCTCTGCAATATTGG - Intergenic
1116519279 14:45830634-45830656 GTGTACACCTTCTGCAATATTGG - Intergenic
1116519950 14:45835043-45835065 TTGTACACACCCTGCAATATTGG + Intergenic
1116520019 14:45835508-45835530 GTGTACACCCTCTGCGATATTGG + Intergenic
1118319766 14:64746390-64746412 GGGCACAGACCATGCAATCTGGG - Exonic
1118376216 14:65179369-65179391 GTTTAAACAATATGAAATCTGGG - Intergenic
1118966088 14:70586981-70587003 CTGTACAAACAATGCAATTTAGG + Intronic
1119573220 14:75694964-75694986 GTTTAAACAATATGAAATCTGGG + Intronic
1120807251 14:88766181-88766203 GTTTAAACAATATGAAATCTGGG + Intronic
1121099474 14:91240475-91240497 GTTTAAACAATATGAAATCTGGG - Intronic
1122760073 14:104017256-104017278 ATGTACACACTAGGTAATTTTGG - Intronic
1202828842 14_GL000009v2_random:4351-4373 GAGTACACCCTCTGCAATATTGG + Intergenic
1202900360 14_GL000194v1_random:32974-32996 TTGTACACACCCTGCAATATGGG - Intergenic
1123931619 15:25174587-25174609 GTTTAAACAATATGAAATCTGGG - Intergenic
1124248241 15:28089225-28089247 GTTTAAACAATATGAAATCTGGG - Intronic
1125488162 15:40126736-40126758 GTGTACACCCTCTGCGATATTGG - Intergenic
1126724089 15:51613107-51613129 GTTTAAACAATATGAAATCTGGG - Intronic
1127145985 15:56024581-56024603 GTTTAAACAATATGAAATCTGGG + Intergenic
1127759879 15:62128387-62128409 GTGTCCACACTATGCAGTGGGGG + Intergenic
1128598839 15:68977863-68977885 GTTTAAACAATATGAAATCTGGG - Intronic
1129662278 15:77559767-77559789 GTGTACACCCCCTGCAATATTGG - Intergenic
1129969213 15:79762473-79762495 GTTTAAACAATATGAAATCTGGG - Intergenic
1129981437 15:79874915-79874937 GTTTAAACAATATGAAATCTGGG - Intronic
1130188840 15:81712336-81712358 GTGTACACACCCTGCGATATTGG - Intergenic
1130387105 15:83421595-83421617 GTGTACATACAATGAAATATTGG - Intergenic
1132342946 15:101089560-101089582 GTGTCCACACTAGGGAATTTGGG + Intergenic
1133991543 16:10711202-10711224 GTGTATACACCCTGCAATATTGG + Intergenic
1133991642 16:10711813-10711835 GTGTACACCCCCTGCAATATTGG + Intergenic
1138637553 16:58353120-58353142 GTTTAAACAATATGAAATCTGGG - Intronic
1143940967 17:10541114-10541136 GTTTAAACAATATGAAATCTGGG + Intronic
1144241792 17:13319907-13319929 GTGAACACACCATTCAACCTAGG - Intergenic
1145387566 17:22427055-22427077 GTTTAAACAATATGAAATCTGGG - Intergenic
1145819689 17:27822539-27822561 GTTTAAACAATATGAAATCTGGG - Intronic
1146166808 17:30596062-30596084 GTTTAAACAATATGAAATCTGGG - Intergenic
1146731797 17:35199545-35199567 GTTTAAACAATATGAAATCTGGG + Intergenic
1147917558 17:43897813-43897835 GTGGATACACTATGCATTTTGGG - Intronic
1150760218 17:67954738-67954760 GTGTGCCCACTATACAATCTTGG + Intronic
1150807728 17:68332371-68332393 GTTTAAACAATATGAAATCTGGG - Intronic
1153377480 18:4396858-4396880 TTGTGCACATTATGCAATATGGG - Intronic
1155542786 18:26885209-26885231 GTGTACACCCCTTGCAATATTGG + Intergenic
1155543443 18:26889531-26889553 GTGTACACCCTCTGCAGTATTGG - Intergenic
1155726401 18:29089960-29089982 GTGTACACACTTTTAAATCTAGG - Intergenic
1155854472 18:30815808-30815830 GTGTGAACAATATGAAATCTGGG + Intergenic
1156282240 18:35650799-35650821 GTTTAAACAATATGAAATCTGGG - Intronic
1156366587 18:36433227-36433249 CTGTACCCACTATATAATCTGGG - Intronic
1156625195 18:38900151-38900173 GTATACAAACTGTGCAAACTTGG + Intergenic
1156761493 18:40596734-40596756 GTTTGAACAATATGCAATCTGGG - Intergenic
1159079063 18:63714745-63714767 GTTTAAACAATATGAAATCTGGG - Intronic
1160249275 18:77186766-77186788 GTTTAAACAATATGAAATCTAGG - Intergenic
1160315451 18:77840991-77841013 GTGTTCACACCCTGTAATCTTGG + Intergenic
1164013403 19:21229896-21229918 GTTTAAACAATATGAAATCTGGG + Intronic
1164332210 19:24270553-24270575 GTTTAAACAATATGAAATCTGGG + Intergenic
1164332475 19:24272791-24272813 GTTTAAACAATATGGAATCTGGG + Intergenic
1164332894 19:24277655-24277677 GTTTAAACAATATGAAATCTGGG + Intergenic
1164340247 19:24387395-24387417 GTTTGAACACTATGAAATCTGGG - Intergenic
1164388836 19:27799633-27799655 GTTTAAACAATATGAAATCTGGG + Intergenic
1166236260 19:41459280-41459302 GTGTACACGCTCTGCAATATTGG + Intergenic
1166236299 19:41459579-41459601 GTGTACACCCTCTGCGATATAGG + Intergenic
1166236450 19:41460517-41460539 GTGTACACGCCCTGCAATATTGG + Intergenic
1166236475 19:41460664-41460686 GTGTACACACTCTGCGATATCGG + Intergenic
1166236883 19:41463329-41463351 GTGTACACTCCCTGCAATATGGG + Intergenic
1166237420 19:41466596-41466618 GTGTACACCCCCTGCAATATTGG + Intergenic
1166238146 19:41471318-41471340 GTGTACACACTTTGCGATATTGG + Intergenic
1166238654 19:41474579-41474601 GTGTACACACCATTCGATATTGG + Intergenic
1166242230 19:41502243-41502265 GTGTACACCCTTTGCGATATTGG + Intergenic
1166243761 19:41511324-41511346 GTGTACACCCTCTGCGATATTGG + Intergenic
1166243908 19:41512282-41512304 GTGTACACCCCATGCGATATTGG + Intergenic
1166244943 19:41518680-41518702 GTGTACACCCTCTGCGATATTGG + Intergenic
1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG + Intergenic
1166619215 19:44280616-44280638 CTGTATAAATTATGCAATCTGGG + Intronic
1167809817 19:51819455-51819477 ATGTACACACAATCCACTCTTGG - Intronic
926712472 2:15892375-15892397 TTCTACCAACTATGCAATCTTGG - Intergenic
928708331 2:33976537-33976559 GTTTAAACAATATGAAATCTGGG + Intergenic
928727930 2:34196715-34196737 GTGAACACATTAGGCAATCTGGG - Intergenic
930595941 2:53387940-53387962 GTTTAAACAATATGAAATCTGGG - Intergenic
930606294 2:53496805-53496827 GTGTACATACTATCCACTCAAGG + Intergenic
930643455 2:53878400-53878422 GTTTAAACAATATGAAATCTGGG + Intronic
933456589 2:82526492-82526514 GTGTACACCCTCTGCGATATTGG + Intergenic
933459935 2:82569747-82569769 GTTTAAACAATATGAAATCTGGG + Intergenic
934107973 2:88713636-88713658 GTATTCACACTCTGCAATTTTGG + Intronic
934507087 2:94903187-94903209 GTGTACACCCCCTGCAATATTGG - Intergenic
935389253 2:102533131-102533153 GTGAACTCACCATGCAACCTTGG - Exonic
936694468 2:114929659-114929681 GTGTGAACAATATGAAATCTGGG - Intronic
938881849 2:135598210-135598232 GAGTACCAACTATGCAAACTTGG - Intronic
939246145 2:139625805-139625827 GTTTAAACAATATGAAATCTGGG - Intergenic
940837024 2:158533574-158533596 ATGCACACACTCTGCAATGTGGG - Intronic
940874835 2:158888104-158888126 GTTTACACACTCTGCGATATTGG + Intergenic
941533331 2:166694775-166694797 GTGTACACAGTCTGCGATATTGG + Intergenic
941533466 2:166695999-166696021 GTGTACACACCCTGCGATGTTGG - Intergenic
941533550 2:166696505-166696527 GTGTACACCCTCTGCGATATTGG - Intergenic
941571182 2:167172754-167172776 GTTTAAACAATATGAAATCTGGG - Intronic
942312836 2:174671435-174671457 GTTTAAACAATATGAAATCTGGG + Intronic
942317105 2:174706706-174706728 GTGTACACTCCCTGCAATATTGG + Intergenic
942317259 2:174707684-174707706 GTGTACACACCCTTCAATATTGG + Intergenic
943502644 2:188711363-188711385 GTTTAAACAATATGAAATCTGGG + Intergenic
945371056 2:209018526-209018548 GTTTAAACAATATGAAATCTGGG + Intergenic
945536578 2:211025537-211025559 GTTTAAACAATATGAAATCTGGG - Intergenic
946775636 2:223137667-223137689 GTGTACACACTACCAAATTTAGG - Intronic
947270469 2:228328402-228328424 GTTTAAACAATATGAAATCTGGG - Intergenic
948053619 2:234995785-234995807 GTGTACACACCACCCAACCTGGG - Intronic
948193013 2:236074401-236074423 CTGTGCACACTCTGCACTCTGGG + Intronic
1169731811 20:8794124-8794146 GTTTAAACAATATGAAATCTGGG - Intronic
1169805581 20:9556240-9556262 GTATACACAATTTGCAAACTTGG - Intronic
1171893818 20:30742399-30742421 GAGTACACCCTCTGCAATATTGG - Intergenic
1171894473 20:30747365-30747387 GTGTGCACCCTCTGCAATATGGG + Intergenic
1171894642 20:30748441-30748463 GTGTACACCCCCTGCAATATTGG - Intergenic
1174884452 20:54316813-54316835 GTGTATAGTCTATGCCATCTAGG - Intergenic
1176607187 21:8843132-8843154 GTGTACACCCCCTGCAATATTGG + Intergenic
1176608024 21:8849179-8849201 GAGTACACCCTCTGCAATATTGG + Intergenic
1176619734 21:9047752-9047774 TTGTACACACCCTGCAATATGGG - Intergenic
1177588881 21:23135736-23135758 GTTTAAACAATATGAAATCTGGG - Intergenic
1177707392 21:24724860-24724882 GTGGACACATTATGAAAACTGGG - Intergenic
1178443047 21:32613823-32613845 GTGTACACACCCTGCGATATTGG + Intergenic
1179184647 21:39075726-39075748 GTTTAAACAATATGAAATCTGGG - Intergenic
1179425335 21:41273617-41273639 GTTTAAACAATATGAAATCTGGG - Intronic
1179671722 21:42954127-42954149 GTGTACACACCCTGCGATATTGG - Intergenic
1180357270 22:11852920-11852942 GTGTACACCCCCTGCAATATTGG + Intergenic
1180380995 22:12139411-12139433 GTGTACACCCCCTGCAATATTGG - Intergenic
1183116064 22:35693636-35693658 GTGTGCACCCTCTGCAATATAGG - Intergenic
1183117319 22:35702017-35702039 GTGTACACCCCTTGCAATATTGG + Intergenic
949787854 3:7761469-7761491 GTTTAAACAATATGAAATCTGGG + Intergenic
950198645 3:11027468-11027490 GTTTAAACAATATGAAATCTGGG - Intronic
950615169 3:14152389-14152411 GTGTGCACACTCTGCATTCCAGG - Exonic
951301964 3:21009401-21009423 GTTTAAACAGTATGAAATCTGGG + Intergenic
952505666 3:34004834-34004856 GTGAACACATAATACAATCTGGG - Intergenic
953519559 3:43628485-43628507 GTTTAAACAATATGAAATCTGGG + Intronic
958684172 3:97371593-97371615 GTTTAAACAATATGAAATCTGGG + Intronic
958722113 3:97856313-97856335 GTTTAAACAATATGAAATCTGGG - Intronic
960889818 3:122435876-122435898 GTTTAAACAATATGAAATCTGGG + Intronic
961275451 3:125722426-125722448 GTGTACACCCCCTGCAATATTGG + Intergenic
961278336 3:125744898-125744920 GTGTACACTCTCTGCGATATTGG + Intergenic
962912122 3:139862699-139862721 GTTTGAACACTATGAAATCTGGG + Intergenic
963476436 3:145811157-145811179 GTGTTCACACCATGAACTCTTGG - Intergenic
963494837 3:146045678-146045700 CTGTACATCCTATGAAATCTAGG + Intergenic
963499956 3:146113755-146113777 GTTTAAACAATATGAAATCTGGG + Intronic
964888708 3:161514353-161514375 GTGTACACACCCTGCAATAATGG + Intergenic
964888884 3:161515404-161515426 GTGTACACACCCTGCGATATTGG + Intergenic
964889008 3:161516202-161516224 GTGTACACCCTGTGCGATATTGG + Intergenic
964889499 3:161518924-161518946 GTGTACACCCCATGCGATATTGG + Intergenic
964889536 3:161519150-161519172 GTGTACACCCCCTGCAATATTGG + Intergenic
964889566 3:161519301-161519323 GTGTACACCCCATGCGATATTGG + Intergenic
965399376 3:168199003-168199025 GTGTACACCCTGTGCAGTATTGG + Intergenic
965399875 3:168202118-168202140 GTGTACACCCTCTGCGATATGGG + Intergenic
966142539 3:176772266-176772288 GTTTAAACAATATGAAATCTGGG + Intergenic
967435724 3:189443689-189443711 GTGTACACATTATGCAATAAAGG - Intergenic
968396946 4:247655-247677 GTTTAAACAATATGAAATCTGGG - Intergenic
969733323 4:8970581-8970603 GTGTACACTTTCTGCAATATTGG - Intergenic
969734530 4:8978138-8978160 GTGTACACCCTCTGCGATATTGG + Intergenic
969789252 4:9480737-9480759 GTGTACACACTCTGGGATGTTGG + Intergenic
969789264 4:9480810-9480832 GTGTACACACACTTCAATATTGG + Intergenic
969789409 4:9481646-9481668 GTGTACACACCCTGCGATATTGG + Intergenic
971899819 4:32645609-32645631 GTTTAAACAATATGAAATCTGGG + Intergenic
971983677 4:33790982-33791004 AAGTACACACTATGCCAGCTGGG - Intergenic
972038260 4:34554452-34554474 GTTTAAACAATATGAAATCTGGG - Intergenic
973370932 4:49248082-49248104 GTGTACACTCCCTGCAATATTGG - Intergenic
973798167 4:54449939-54449961 GTTTAAACAATATGAAATCTGGG + Intergenic
973943671 4:55935840-55935862 GTTTAAACAATATGAAATCTGGG + Intergenic
974208897 4:58743682-58743704 GTTTAAACAATATGAAATCTGGG - Intergenic
974399691 4:61387718-61387740 GTTTAAACAATATGAAATCTGGG - Intronic
976693086 4:87889597-87889619 GTTTAAACAATATGAAATCTGGG - Intergenic
976803063 4:89014816-89014838 GTTTAAACAATATGAAATCTGGG + Intronic
977667436 4:99657004-99657026 GTGTACACATTATGTACTCAGGG + Intergenic
978211936 4:106147746-106147768 GTTTAAACAATATGAAATCTGGG + Intronic
978505671 4:109453633-109453655 GTTTAAACAATATGAAATCTGGG - Intronic
979137089 4:117123756-117123778 GTTTAAACAATATGAAATCTGGG + Intergenic
979147647 4:117265168-117265190 GTTTAAACAATATGAAATCTGGG - Intergenic
980231942 4:130056887-130056909 GTTTAAACAATATGAAATCTGGG + Intergenic
980770332 4:137363683-137363705 GAGTACAAATTGTGCAATCTTGG - Intergenic
982497855 4:156113568-156113590 GTATACAGACTATGCAAACATGG + Intergenic
982587228 4:157258124-157258146 GTTTAAACAGTATGAAATCTGGG + Intronic
983550504 4:169012380-169012402 TACTATACACTATGCAATCTTGG + Intergenic
983623302 4:169782377-169782399 GTGTACAGCCTCTGCAATATTGG - Intergenic
983623333 4:169782601-169782623 GTGTACACACAATGCGATATGGG - Intergenic
983623370 4:169782823-169782845 GTGTACACATTCTGCGATATGGG - Intergenic
983623747 4:169784911-169784933 GTGTACACTTTCTGCAATATTGG - Intergenic
983623795 4:169785256-169785278 GTGTACACCCTCTGCGATATTGG - Intergenic
983623926 4:169786099-169786121 GTGTACACACCCTGCGATATTGG + Intergenic
983624293 4:169788195-169788217 GTGTACACCCCCTGCAATATTGG + Intergenic
987571969 5:19675647-19675669 GTTTAAACAATATGAAATCTGGG - Intronic
987689707 5:21251364-21251386 GTTTAAACAATATGAAATCTGGG + Intergenic
988240254 5:28599283-28599305 GTTTAAACAATATGAAATCTGGG + Intergenic
989572323 5:42955997-42956019 GTTTAAACAGTATGAAATCTGGG - Intergenic
989763129 5:45045076-45045098 GTCTAGACAGTATGCAATGTAGG - Intergenic
990234545 5:53752708-53752730 GTTTAAACAATATGAAATCTGGG - Intergenic
990300440 5:54444571-54444593 GTTTAAACAATATGAAATCTGGG + Intergenic
991625982 5:68601585-68601607 GTTTAAACAATATGAAATCTGGG + Intergenic
992683033 5:79171946-79171968 GTGTAGTAACTAAGCAATCTTGG - Intronic
993369719 5:87077523-87077545 GTGTATAGACTATGCCATCTAGG + Intergenic
994391326 5:99196391-99196413 GTGTACACACCCTGCGATATTGG + Intergenic
994391687 5:99198632-99198654 GTGTACACGCTCTGCGATATTGG + Intergenic
994391807 5:99199518-99199540 GTGTACACCCCCTGCAATATTGG + Intergenic
994393100 5:99208007-99208029 GTGTACACCCCCTGCAATATTGG + Intergenic
994393811 5:99212479-99212501 GTGTACACCCCCTGCAATATTGG + Intergenic
994394224 5:99215220-99215242 GTGTACACCCCCTGCAATATAGG + Intergenic
994394257 5:99215445-99215467 GTGTACACCTTCTGCAATATTGG + Intergenic
994394797 5:99218889-99218911 GTGTACACCCCTTGCAATATTGG + Intergenic
994394921 5:99219668-99219690 GTGTACACCCTGTGCAATATTGG + Intergenic
994395348 5:99222167-99222189 GTGTACACCCTCTGCGATTTTGG + Intergenic
994395944 5:99225886-99225908 GTGTACACACTCTGAGATATTGG + Intergenic
994396079 5:99226721-99226743 TTGTACACACCCTGCAATATTGG + Intergenic
994396140 5:99227101-99227123 GTGTACACCCATTGCAATATTGG + Intergenic
994396293 5:99228148-99228170 GTGTACACACTTTGCGATATTGG + Intergenic
994396347 5:99228541-99228563 GTGTACACCCACTGCAATATTGG + Intergenic
994396359 5:99228617-99228639 GTGTACACACCCTGCGATATTGG + Intergenic
994396374 5:99228697-99228719 GTGTGCACACTCTGCGATATAGG + Intergenic
994396427 5:99229000-99229022 GTGTACACTTCATGCAATATTGG + Intergenic
994397196 5:99234763-99234785 GTGTACACTTTCTGCAATATTGG - Intergenic
995674161 5:114643619-114643641 GTTTAAACATTATGAAATCTGGG + Intergenic
996396186 5:123016463-123016485 GTGGGCAAACTATGCAATTTAGG + Intronic
996662757 5:126023949-126023971 GTGTATAGGCTATACAATCTAGG + Intergenic
997682158 5:135764376-135764398 CTGTACACCCTTTGCAATATGGG - Intergenic
997682212 5:135764657-135764679 GTGTACACCCTCTGCGATATGGG - Intergenic
997682324 5:135765239-135765261 GTGTACACACCCTGCGATGTGGG - Intergenic
997682783 5:135767833-135767855 GTGTACAAACTCTGCGATATTGG - Intergenic
997683073 5:135769882-135769904 GTGTACACCCCCTGCAATATTGG - Intergenic
997683537 5:135772941-135772963 GTGTACACCTTCTGCAATATTGG - Intergenic
997683829 5:135774876-135774898 GTGTACACCTTCTGCAATATTGG - Intergenic
997683861 5:135775100-135775122 GTGTACACCCCATGCAATTTTGG - Intergenic
997684492 5:135779200-135779222 GTGCACACCCCATGCAATATTGG - Intergenic
997684977 5:135782252-135782274 GTGTATACCCTCTGCAATATTGG - Intergenic
997685238 5:135783909-135783931 GTGTACACTCCTTGCAATATTGG - Intergenic
997685325 5:135784544-135784566 GTGTACACTTTCTGCAATATTGG - Intergenic
997687373 5:135798001-135798023 GTGTACACCCTCTGTAATATTGG - Intergenic
997687568 5:135799363-135799385 GTGTACACTTTCTGCAATATTGG - Intergenic
997687830 5:135800991-135801013 GTGTACACACCCTGCGATATTGG - Intergenic
997687973 5:135801949-135801971 GTGTACACCCACTGCAATATTGG - Intergenic
997901304 5:137767873-137767895 GTTTAAACAATATGAAATCTGGG + Intergenic
998935331 5:147227444-147227466 GTGTACACCCTCTGCAGTATTGG + Intergenic
998935539 5:147228849-147228871 GTGTACACCCTCTGCAATATAGG + Intergenic
999308655 5:150537207-150537229 GTTTAAACAATATGAAATCTGGG + Intronic
999629887 5:153560059-153560081 ATTTACAAACTATGCAAACTTGG - Intronic
1003802071 6:9681191-9681213 GTTTAAACAATATGAAATCTGGG - Intronic
1005501588 6:26433614-26433636 GTTTAAACAATATGAAATCTGGG + Intergenic
1006238422 6:32656474-32656496 GTTTAAACAATATGAAATCTGGG - Intergenic
1006813091 6:36833197-36833219 GTGTACTCACTGTGTAACCTTGG + Intronic
1007841984 6:44723896-44723918 ATGTTCACAATATGGAATCTCGG - Intergenic
1009046232 6:58240393-58240415 GTGTACACCCCCTGCAATATTGG - Intergenic
1009046261 6:58240623-58240645 GTGTATACACCCTGCAATATTGG - Intergenic
1009046498 6:58242053-58242075 GTTTACACTCTCTGCGATCTTGG - Intergenic
1009046620 6:58242811-58242833 GTGTACAACCTCTGCAATATGGG - Intergenic
1009047168 6:58246413-58246435 GTGTACACACTTTGCGATATTGG - Intergenic
1009048021 6:58251010-58251032 GTGTACACACCCTGCGATATAGG - Intergenic
1009048525 6:58254398-58254420 TTGTACACACCCTGCAATATTGG - Intergenic
1009048612 6:58254980-58255002 GTGTACACCTTTTGCAATATTGG + Intergenic
1009048775 6:58256122-58256144 GTGTACACCCCCTGCAATCCTGG + Intergenic
1009049416 6:58260040-58260062 GTGTACACCCCCTGCAATATTGG + Intergenic
1009049804 6:58262729-58262751 GTGTACACCCCCTGCAATATTGG + Intergenic
1009222044 6:60994704-60994726 GTGTACACCCCCTGCAATATTGG - Intergenic
1009222312 6:60996369-60996391 GTTTACACTCTCTGCGATCTTGG - Intergenic
1009222382 6:60996824-60996846 GTGTACACCCCCTGCAATATTGG - Intergenic
1009222430 6:60997123-60997145 GTGTACAACCTCTGCAATATGGG - Intergenic
1009222977 6:61000710-61000732 GTGTACACGCTTTGCGATATTGG - Intergenic
1009223361 6:61002880-61002902 GTGTACACTCCTTGCAATATGGG - Intergenic
1009224393 6:61009156-61009178 TTGTACACACCCTGCAATATTGG - Intergenic
1009224472 6:61009741-61009763 GTGTACACCTTTTGCAATATTGG + Intergenic
1009224973 6:61013274-61013296 GTGTACACCCCCTGCAATATCGG + Intergenic
1009225349 6:61015975-61015997 GTGTACACCCCCTGCAATATTGG + Intergenic
1009225710 6:61018621-61018643 GTGTACACCCCCTGCAATATTGG + Intergenic
1009225807 6:61019289-61019311 GTGTACACCCTCTGCGATATTGG + Intergenic
1009226053 6:61020951-61020973 GTGTACACCCCCTGCAATATTGG + Intergenic
1009226387 6:61023958-61023980 GTGTACACTCTCTGCAATATTGG - Intergenic
1009228283 6:61036883-61036905 GTGTACACCCCCTGCAATATTGG + Intergenic
1009228535 6:61038476-61038498 GTGTACACCCCCTGCAATGTAGG + Intergenic
1009228898 6:61040917-61040939 GTGTACACCCTTTGCAATATTGG + Intergenic
1009228989 6:61041663-61041685 GTGTACACCCCCTGCAATATGGG + Intergenic
1009229015 6:61041810-61041832 GTGTACACCCCGTGCAATATGGG + Intergenic
1009362991 6:62837238-62837260 GTGTACACACCCTGCGATATTGG - Intergenic
1009363057 6:62837687-62837709 GTGTACACTCTCTGCAATATTGG - Intergenic
1009363281 6:62839126-62839148 GTGTACACCCCCTGCAATATTGG - Intergenic
1009363478 6:62840414-62840436 GTGTACACCCCTTGCTATCTTGG - Intergenic
1009363600 6:62841148-62841170 GTGTACACTCTCTGCAATATTGG - Intergenic
1009363916 6:62843620-62843642 GTGTACAGTCTGTGCAATATTGG - Intergenic
1009364451 6:62847221-62847243 GTGTACACACCCTGCGATATTGG + Intergenic
1009364550 6:62847896-62847918 GTGTACACACCCTGAAATATTGG + Intergenic
1009364735 6:62849207-62849229 GTGTACACCCACTGCAATATTGG - Intergenic
1009365591 6:62855509-62855531 GTGTAAACACCCTGCAATATTGG - Intergenic
1009367420 6:62866365-62866387 GTGTACACCCTTTGGAATATTGG + Intergenic
1009367530 6:62867323-62867345 GTGTACACTCTTTGCGATATTGG + Intergenic
1009367614 6:62868071-62868093 GTGTACACGCTCTGCGATATTGG + Intergenic
1009367881 6:62869748-62869770 GTGTACACGCCCTGCAATATTGG - Intergenic
1009368236 6:62872504-62872526 GTGTACACCCTTTGCAATATTGG - Intergenic
1009369049 6:62878778-62878800 GTGTACACCCTTTGCCATATTGG - Intergenic
1009369159 6:62879582-62879604 GTGTACACACTCTGCGATATTGG - Intergenic
1009369266 6:62880409-62880431 GTGTACACGCCCTGCAATATTGG - Intergenic
1009369731 6:62883522-62883544 GTGTACACGCTGTGCGATATTGG - Intergenic
1009460487 6:63907027-63907049 GTGTACACACTATGCAATCTTGG - Intronic
1009536178 6:64889816-64889838 GTTTAAACAATATGAAATCTGGG + Intronic
1010152647 6:72752663-72752685 CTGTACACACTTTGGAATTTAGG - Intronic
1011668686 6:89661089-89661111 GTGTAAACGCTGTGCAGTCTGGG - Intronic
1011959770 6:93073243-93073265 GTTTAAACAATATGAAATCTGGG + Intergenic
1012682353 6:102197640-102197662 GTGTGAACAATATGAAATCTGGG - Intergenic
1012773859 6:103479081-103479103 GTGTACACGCCTTGCAATATTGG - Intergenic
1012774078 6:103480514-103480536 GTGTACACCCCATGCGATATTGG - Intergenic
1012774245 6:103481590-103481612 GTGTACACACTATGCGATATTGG + Intergenic
1012774684 6:103484455-103484477 GTGTACATCCTCTGCAATATTGG + Intergenic
1012774704 6:103484582-103484604 GTGTACACTCCATGCGATATGGG + Intergenic
1012774716 6:103484657-103484679 GTGTACACCCTTTGCGATATGGG + Intergenic
1012774823 6:103485395-103485417 GTGTACACCTTCTGCAATATTGG + Intergenic
1012774923 6:103486136-103486158 GTGTACACTCTTTGCAATATTGG + Intergenic
1012774992 6:103486622-103486644 GTGTACACACCCTGCGATATTGG - Intergenic
1012775029 6:103486849-103486871 GTGTACACTCCCTGCAATATTGG - Intergenic
1012775172 6:103487824-103487846 GTGTACACTCCCTGCAATATTGG - Intergenic
1012775569 6:103490371-103490393 GAGTACACACCCTGCAATATTGG - Intergenic
1014119934 6:117712971-117712993 GTTTAAACAATATGAAATCTGGG - Intergenic
1014465639 6:121753394-121753416 GGGTACAGTCTATGAAATCTAGG + Intergenic
1015206482 6:130645206-130645228 GTTTAAACAATATGAAATCTGGG - Intergenic
1015642721 6:135353387-135353409 GTTTACATACTATGAATTCTTGG + Intronic
1016632040 6:146244088-146244110 GTTTAAACAATATGAAATCTGGG - Intronic
1018985138 6:168630550-168630572 GTTTAAACAATATGAAATCTGGG + Intronic
1020306639 7:6840924-6840946 GTGTACACACCCTGCGATATTGG - Intergenic
1020335083 7:7056909-7056931 GTGTACACCCCCTGCAATATTGG - Intergenic
1020335609 7:7060063-7060085 GTGTACACCCTCTGCAATATAGG + Intergenic
1020335658 7:7060362-7060384 GTGTACACCCTTTGCGATATTGG + Intergenic
1020336256 7:7064479-7064501 GTGTACACCCCTTGCAATATTGG - Intergenic
1020336791 7:7068316-7068338 GTGTACACCCTCTGCAACATTGG - Intergenic
1020877948 7:13721725-13721747 GAGAAAACACTATGGAATCTTGG + Intergenic
1024213041 7:47223370-47223392 GTTTAAACAATATGAAATCTGGG + Intergenic
1024408860 7:49015313-49015335 GTTTAAACAATATGAAATCTGGG - Intergenic
1024586380 7:50845451-50845473 GTTTAAACAATATGAAATCTGGG + Intergenic
1024892002 7:54213644-54213666 GTTTAAACAATATGAAATCTGGG - Intergenic
1025749533 7:64281317-64281339 GTCTAAACAATATGAAATCTGGG - Intergenic
1026730648 7:72908874-72908896 GTTTAAACAATATGAAATCTGGG - Intronic
1028435163 7:90794675-90794697 GTTTAAACAATATGAAATCTGGG - Intronic
1029301180 7:99583330-99583352 GTGTACACCCTCTGCGATATTGG + Intronic
1029301283 7:99583928-99583950 GTGTACACCCTCTGCGATATTGG + Intronic
1029301537 7:99585584-99585606 GTGTACACGCTTTGCCATATTGG + Intronic
1029342601 7:99957115-99957137 GTGTACACCCCCTGCAATATTGG - Intergenic
1029342866 7:99958879-99958901 GTGTACACCCTCTGCCATATGGG - Intergenic
1029342920 7:99959177-99959199 GTGTACACTCCTTGCAATATGGG - Intergenic
1029342938 7:99959302-99959324 GTGTACACCCTCTGCGATATTGG - Intergenic
1029343443 7:99962323-99962345 GTGTACACCCTCTGCAATATTGG - Intergenic
1029343481 7:99962551-99962573 GTGTACACCCCCTGCAATATTGG - Intergenic
1029343671 7:99963692-99963714 GTGTACATACTCTGCAATATTGG - Intergenic
1030056003 7:105584058-105584080 GTTTAAACAATATGAAATCTGGG + Intronic
1031636115 7:124103211-124103233 GTTTAAACAATATGAAATCTGGG + Intergenic
1032937137 7:136745878-136745900 GTTTAAACAATATGAAATCTGGG - Intergenic
1033677129 7:143553655-143553677 GTTTGAACAATATGCAATCTGGG - Intergenic
1033694706 7:143775782-143775804 GTTTGAACAATATGCAATCTGGG + Intergenic
1033904997 7:146191845-146191867 GTTTAAACAATATGAAATCTGGG - Intronic
1035357432 7:158284914-158284936 CTGCTCACCCTATGCAATCTAGG - Intronic
1036239168 8:7068108-7068130 GTGTACACCCTCTGCGATATTGG + Intergenic
1036240337 8:7075407-7075429 GTGTACACACCCTGCGATATTGG + Intergenic
1036819837 8:11931721-11931743 GTGTACACCCTCTGCGATATTGG - Intergenic
1038637365 8:29298805-29298827 GTGTACACACTTTGCAATATTGG - Intergenic
1038637466 8:29299469-29299491 GTGTGCACCCTTTGCAATATTGG - Intergenic
1038637829 8:29301701-29301723 GTGTACACACCCTGCGATATTGG + Intergenic
1038637841 8:29301777-29301799 CTGTACACCCTCTGCAATATTGG + Intergenic
1038638037 8:29303060-29303082 GTGTACACCCCCTGCAATATTGG + Intergenic
1038639593 8:29312692-29312714 GTGTACACTTAATGCAATATTGG + Intergenic
1038991859 8:32877084-32877106 GTTTAAACAATATGAAATCTGGG + Intergenic
1040393137 8:46966959-46966981 GTTTAAACAATATGAAATCTGGG - Intergenic
1040679101 8:49787493-49787515 GTTTAAACAATATGAAATCTGGG - Intergenic
1041584200 8:59496605-59496627 GTTTAAACAATATGTAATCTGGG - Intergenic
1041886066 8:62809196-62809218 GTTTAAACAATATGAAATCTGGG - Intronic
1042417717 8:68543612-68543634 GAGTACCAACTATGTAATCTGGG - Intronic
1043324381 8:79032914-79032936 GTTTAAACAATATGAAATCTGGG + Intergenic
1043634086 8:82368707-82368729 GTGTACACTTTCTGCAATATTGG + Intergenic
1043634816 8:82373462-82373484 GTGTACACCCTTAGCAATATTGG - Intergenic
1043634856 8:82373685-82373707 GAGTACACCCTTTGCAATATTGG - Intergenic
1043635026 8:82374890-82374912 ATGTACACCCTCTGCAATATTGG - Intergenic
1043635067 8:82375117-82375139 GTGTACACCCCTTGCAATATTGG - Intergenic
1043635296 8:82376434-82376456 GTGTACACGCTCTGCGATATGGG - Intergenic
1043635471 8:82377495-82377517 GTGTACACTCTCTGCGATATTGG - Intergenic
1043635739 8:82379045-82379067 GTGTACACACCCTGCGATATTGG - Intergenic
1043966940 8:86489477-86489499 GTGTATACACATTGGAATCTTGG - Intronic
1044064061 8:87677019-87677041 GTTTAAACAATATGAAATCTGGG - Intergenic
1044590386 8:93908552-93908574 GTTTAAACAATATGAAATCTGGG - Intronic
1045798684 8:106077120-106077142 GTTTAAACAATATGAAATCTGGG + Intergenic
1045923764 8:107564504-107564526 GTGTACACTCCCTGCAATATGGG - Intergenic
1045923937 8:107565807-107565829 GTGTACACCCTTTGCAAAATGGG - Intergenic
1045924168 8:107567271-107567293 GTGTACACACCCTGCAATATGGG - Intergenic
1045924524 8:107569673-107569695 GTGTACACCCTCTGTAATATTGG - Intergenic
1045924737 8:107571032-107571054 GTGTACACGCTATGCGATATTGG - Intergenic
1045924903 8:107572064-107572086 GTGTTCACCCTTTGCAATATTGG - Intergenic
1045924931 8:107572294-107572316 GTGTACACACCCTGCGATATTGG - Intergenic
1045925803 8:107577952-107577974 GTGTACACATTCTGCGATATTGG - Intergenic
1045925893 8:107578561-107578583 GTGTACACCCTCTGCGATATTGG - Intergenic
1045925983 8:107579155-107579177 GTGTACACCCTCTGCAATATTGG - Intergenic
1045926320 8:107581623-107581645 GTGTACACACCCTGCGATATTGG - Intergenic
1045926907 8:107585540-107585562 GTTTACACACTCTGCGATATTGG + Intergenic
1045926965 8:107585854-107585876 GTGTACACCCTCTGCGATATTGG + Intergenic
1045927482 8:107589337-107589359 GTGTACACCCCTTGCAATATTGG - Intergenic
1045927530 8:107589701-107589723 GTGTATACACTCTGCGATATGGG - Intergenic
1045927714 8:107590935-107590957 GTGTACACACCCTGCAATATGGG - Intergenic
1046187811 8:110746246-110746268 GTTTAAACAATATGAAATCTGGG + Intergenic
1046868913 8:119182238-119182260 GTTTAAACAATATGAAATCTGGG - Intronic
1047750059 8:127873669-127873691 GTGTACACAGTATGCAATGGAGG + Intergenic
1048479021 8:134770582-134770604 GTTTAAACAATATGAAATCTGGG + Intergenic
1049956930 9:702144-702166 GTTTGCACACTCTGCAATTTGGG - Intronic
1050401354 9:5259212-5259234 GTTTAAACAATATGAAATCTGGG + Intergenic
1050606674 9:7309018-7309040 GTTTAAACAATATGAAATCTGGG + Intergenic
1050902439 9:10964681-10964703 GTGTACACCCTCTGCAATATAGG + Intergenic
1050902796 9:10967099-10967121 GTGTACACCCCTTGCAATATTGG - Intergenic
1051232048 9:14964620-14964642 GTGTACACCCTCTGCGATATTGG + Intergenic
1051232105 9:14964996-14965018 GTGTACACTTTCTGCAATATTGG + Intergenic
1051232230 9:14965739-14965761 GTGTACACCCTGTGCCATATTGG + Intergenic
1051232306 9:14966192-14966214 GTGTACACCCTCTGCGATATTGG + Intergenic
1051232394 9:14966798-14966820 GTGTACACCCTCTGCGATATTGG + Intergenic
1052602114 9:30647071-30647093 GTTTAAACAATATGAAATCTGGG - Intergenic
1052908233 9:33856108-33856130 GTGTACACACTTGGCAAGCAAGG + Intronic
1054353997 9:64044324-64044346 GTGTACACCCCCTGCAATATTGG + Intergenic
1054744228 9:68838400-68838422 GTGTACAAAGAATGCACTCTTGG - Intronic
1054744376 9:68839867-68839889 GAGTACACACTTGGCCATCTGGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1055080569 9:72264531-72264553 GTATACACACTCTCTAATCTCGG - Intergenic
1055340221 9:75273472-75273494 GTTTAAACAATATGAAATCTGGG - Intergenic
1057538848 9:95945374-95945396 GTTTAAACAATATGAAATCTGGG - Intronic
1058517815 9:105794061-105794083 GTGTACACCCAATGCAATATTGG + Intergenic
1058518352 9:105797109-105797131 GTGTACAAACTCTGCGATATTGG + Intergenic
1058518532 9:105798302-105798324 GTGCACACCCTCTGCAATATTGG + Intergenic
1058518696 9:105799275-105799297 GTGTACACACCCTGCGATATTGG + Intergenic
1058518787 9:105799822-105799844 GTGTACAACCTCTGCAATATTGG + Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058519109 9:105801890-105801912 TTGTACACCCTCTGCAATATTGG + Intergenic
1058519234 9:105802652-105802674 GTGTACACACTCTGAGATATTGG + Intergenic
1058519485 9:105804315-105804337 GTGTCCACCCTCTGCAATATTGG + Intergenic
1058519498 9:105804391-105804413 GTGTACACCCTCTGCAATATTGG + Intergenic
1058520054 9:105807908-105807930 GTGTACACCCCCTGCAATATTGG + Intergenic
1058520205 9:105808881-105808903 GTGTACACACCCTGCGATATGGG - Intergenic
1058521582 9:105818195-105818217 GTGTACACCCCCTGCAATATTGG - Intergenic
1058521683 9:105818803-105818825 GTGTACACCCCTTGCAATATTGG - Intergenic
1058521979 9:105820746-105820768 GTGTACACCCTCGGCAATATAGG + Intergenic
1061788446 9:133045108-133045130 GTTTTCACAGTATTCAATCTTGG - Intronic
1203695338 Un_GL000214v1:92881-92903 GTGTACACCCCCTGCAATATTGG - Intergenic
1203742331 Un_GL000218v1:13434-13456 GTGTACACCCCCTGCAATATTGG + Intergenic
1203702522 Un_KI270742v1:8023-8045 GTGTACACCCCCTGCAATATTGG + Intergenic
1203554503 Un_KI270743v1:194079-194101 GTGTACACTCCCTGCAATATTGG + Intergenic
1203640935 Un_KI270751v1:11182-11204 GTGTACACCCCCTGCAATATTGG + Intergenic
1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1186329110 X:8513552-8513574 GTTTAAACAATATGAAATCTGGG + Intergenic
1186598158 X:11006995-11007017 GTTTAAACAATATGAAATCTGGG + Intergenic
1186803650 X:13117990-13118012 GTTTAAACAATATGAAATCTGGG - Intergenic
1187644698 X:21334592-21334614 GTTTAAACAATATGAAATCTGGG + Intergenic
1188822792 X:34796331-34796353 GTTTAAACAATATGAAATCTGGG + Intergenic
1188823530 X:34802697-34802719 GTTTAAACAATATGAAATCTGGG + Intergenic
1189557639 X:42162066-42162088 GTTTAAACAATATGAAATCTGGG - Intergenic
1190185877 X:48233789-48233811 GTTTAAACAATATGAAATCTGGG + Intronic
1190616256 X:52236250-52236272 GTTTAAACAATATGAAATCTGGG + Intergenic
1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG + Intergenic
1191126009 X:56954569-56954591 GTTTAAACAATATGAAATCTGGG + Intergenic
1191596189 X:62946483-62946505 GTTTAAACAATATGAAATCTGGG - Intergenic
1191803147 X:65103410-65103432 GTTTAAACAATATGAAATCTGGG - Intergenic
1191972147 X:66828289-66828311 GTTTAAACATTATGAAATCTGGG - Intergenic
1192752263 X:74005476-74005498 GTTTAAACAATATGAAATCTAGG - Intergenic
1193994274 X:88345334-88345356 GTTTAAACAGTATGAAATCTGGG - Intergenic
1197071629 X:122305946-122305968 GTTTAAACATTATGAAATCTGGG + Intergenic
1197982755 X:132235149-132235171 GTGTACAGACAATTCAATGTAGG - Intergenic
1199337688 X:146639854-146639876 GTTTAAACAATATGAAATCTGGG + Intergenic
1199374941 X:147097336-147097358 GTTTAAACAATATGAAATCTGGG + Intergenic
1201155862 Y:11130909-11130931 GTGTACACCCCCTGCAATATTGG + Intergenic
1201517431 Y:14833243-14833265 GTTTAAACAATATGAAATCTGGG - Intronic
1201777987 Y:17687426-17687448 GTTTAAACAATATGAAATCTGGG + Intergenic
1201823571 Y:18218566-18218588 GTTTAAACAATATGAAATCTGGG - Intergenic
1202340346 Y:23857961-23857983 GTTTAAACAATATGAAATCTAGG + Intergenic
1202530420 Y:25812121-25812143 GTTTAAACAATATGAAATCTAGG - Intergenic