ID: 1009461878

View in Genome Browser
Species Human (GRCh38)
Location 6:63922956-63922978
Sequence ATGAGGACATTGAGGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 1, 2: 13, 3: 97, 4: 570}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009461878_1009461882 7 Left 1009461878 6:63922956-63922978 CCCTCAGGCCTCAATGTCCTCAT 0: 1
1: 1
2: 13
3: 97
4: 570
Right 1009461882 6:63922986-63923008 ATAAAAGATTAGTACTCGAATGG 0: 1
1: 0
2: 1
3: 10
4: 128
1009461878_1009461883 14 Left 1009461878 6:63922956-63922978 CCCTCAGGCCTCAATGTCCTCAT 0: 1
1: 1
2: 13
3: 97
4: 570
Right 1009461883 6:63922993-63923015 ATTAGTACTCGAATGGTGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 32
1009461878_1009461884 15 Left 1009461878 6:63922956-63922978 CCCTCAGGCCTCAATGTCCTCAT 0: 1
1: 1
2: 13
3: 97
4: 570
Right 1009461884 6:63922994-63923016 TTAGTACTCGAATGGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1009461878_1009461885 16 Left 1009461878 6:63922956-63922978 CCCTCAGGCCTCAATGTCCTCAT 0: 1
1: 1
2: 13
3: 97
4: 570
Right 1009461885 6:63922995-63923017 TAGTACTCGAATGGTGTCTGGGG 0: 1
1: 0
2: 1
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009461878 Original CRISPR ATGAGGACATTGAGGCCTGA GGG (reversed) Intronic
900429486 1:2595087-2595109 ATGGGGAAACTGAGGCCTGGAGG - Intronic
901032176 1:6313601-6313623 ATGAGGACATTGTGGCCAAAAGG + Intronic
901038612 1:6350891-6350913 ATGAGCACATGGAGGATTGAGGG - Intronic
901067562 1:6501627-6501649 ATGAGGAAACTGAGGCGTGGAGG + Intronic
901206902 1:7502702-7502724 ATGAGGACACTGAGCACTGGAGG + Intronic
901678957 1:10902202-10902224 ATGAGCAAATTGAGGCCTGCAGG + Intergenic
902094618 1:13932636-13932658 ATGAGGAAATAGAGACCTGGAGG + Intergenic
902159506 1:14518725-14518747 ATGAGAAAATGGAGGCTTGATGG - Intergenic
902186402 1:14728796-14728818 ATGAGGACACTGTGGTCTGGAGG - Intronic
902226821 1:15001502-15001524 ATGAGGAAACTAAGGCCTGGAGG - Intronic
902288345 1:15421126-15421148 ATGAGGAAATTGAGGTCTGTGGG + Intronic
902627314 1:17684150-17684172 ATGAGGACAGTGAGGCCAAGGGG - Intronic
902715887 1:18272402-18272424 ATGAGGAAACTGAAGCCTGGAGG - Intronic
902745774 1:18473384-18473406 ATGAGGACACTGAGGCTTCCTGG - Intergenic
902776801 1:18680084-18680106 ATGAGGAAATTGAGGCCCAGAGG + Intronic
902944689 1:19826349-19826371 ATGAGGATATTGAGGGTTGAGGG - Intergenic
903007362 1:20307475-20307497 ATGAGGACAGTGAGGCCTCAAGG - Intronic
903133754 1:21295884-21295906 ATGAAGAAACTGAGACCTGAGGG - Intronic
903177507 1:21589834-21589856 ATGGGGAAACTGAGGTCTGAAGG + Intergenic
903271226 1:22189607-22189629 ACCAGGAGACTGAGGCCTGAGGG - Intergenic
903273842 1:22208560-22208582 TTGAGGAAACTGAGGCCAGAGGG + Intergenic
903295665 1:22341862-22341884 ATGAGGAAACTGAGGCCCGGCGG + Intergenic
903642047 1:24866929-24866951 ATGAGCACATTGAGGCTCGGAGG - Intergenic
904284584 1:29445726-29445748 ATGGGGAAGCTGAGGCCTGAAGG + Intergenic
904349505 1:29895785-29895807 GGGAGGACACTGAGGGCTGAGGG + Intergenic
904368992 1:30036567-30036589 ATGGGGAAACTGAGTCCTGAGGG + Intergenic
904646383 1:31970286-31970308 ATGAGGACACTGTCTCCTGATGG + Intergenic
904830197 1:33301341-33301363 ATGAGGACTGTGAGGACTCAGGG - Intergenic
904987688 1:34565435-34565457 ATGAAGAAACTGAGGCCTGGAGG + Intergenic
905609676 1:39339434-39339456 TTGAGTACAATGAGGACTGAAGG + Intronic
905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG + Intergenic
907330508 1:53667993-53668015 ATGAGGCCATAGAGGCCAGAGGG - Intronic
907340960 1:53736025-53736047 GTGAGGAAACTGAGGCCTGAAGG - Intergenic
907586721 1:55624633-55624655 TTGACGACATTCAGGCATGAAGG - Intergenic
907681987 1:56572901-56572923 ATGAGGAAACTGAAGCCTGGAGG + Intronic
908422342 1:63971248-63971270 ATGAGGAAAGTGAGGCCTAAGGG - Intronic
908423240 1:63980230-63980252 TGGAGGAATTTGAGGCCTGAGGG + Intronic
908874510 1:68655879-68655901 AAGAGGAAATTGAGTCATGAGGG - Intergenic
909528475 1:76654222-76654244 AGGAGCACTTTGAGGCCTTAAGG + Intergenic
911417904 1:97598808-97598830 ATGAGGAAATTGAGGCATATAGG + Intronic
916729899 1:167556614-167556636 ATGAGAAAATTGAGGCCCAAAGG - Intergenic
917037471 1:170764562-170764584 ATAATGACAATGAGGACTGATGG - Intergenic
917624360 1:176830744-176830766 ATGGGGACAGTGAGGTCTGATGG + Intronic
918323790 1:183390351-183390373 ATAAGGAAACTGAGGACTGAGGG - Intronic
919693099 1:200544961-200544983 ATGAGGAAAATGAGGCCTCTTGG - Intergenic
920209835 1:204320189-204320211 AGGTGGACATGGAGGCATGAAGG - Intronic
921097124 1:211896153-211896175 ATGAGGACAATAAGACCTCATGG + Intergenic
921422460 1:214964343-214964365 ATGAGGACACTGAGGCAAGGAGG - Intergenic
922457441 1:225786708-225786730 ATGAGGAAATTGAGACCAGAAGG - Intronic
924709122 1:246519541-246519563 ATGGGGACAGTGAGGGCTGTGGG - Intergenic
1063557459 10:7094274-7094296 ATGTGGAAACTGAGGCCTAAAGG - Intergenic
1065035940 10:21638717-21638739 ATGTGGCCATTGAGGCCTCTTGG + Intronic
1066790069 10:39052432-39052454 GTGAGCAAATTGAGGCCTAAAGG + Intergenic
1066792967 10:39086385-39086407 AGGGGGTCATTGAGGCCTAAGGG + Intergenic
1066795338 10:39113956-39113978 AAGAGCCCATTGAGGCCTAAAGG + Intergenic
1066795661 10:39117496-39117518 AAGAGCTCATTGAGGCCTAAGGG + Intergenic
1066929606 10:41740482-41740504 GGGAGGCCATTGAGGCCTGTGGG + Intergenic
1067826382 10:49576562-49576584 ATGAGAACAGTGGGCCCTGAAGG - Intergenic
1068768499 10:60793134-60793156 ATGAGGACATTGAGGCTCGAAGG - Intronic
1069763645 10:70834894-70834916 ATGAAGACATTGAGGCCTACAGG - Intronic
1069832931 10:71291930-71291952 ATGGGGAAAGGGAGGCCTGAAGG + Intronic
1069856203 10:71442596-71442618 TAGAGTACATTGAGGCCAGAGGG - Intronic
1070252479 10:74785004-74785026 ATGTGTACATTGAGGTGTGAGGG - Intergenic
1070417522 10:76204545-76204567 ATGAGGAAAGTGAGGCCACAAGG + Intronic
1070595459 10:77829758-77829780 ATGAAGACGCTGAGGCCTGGAGG - Intronic
1070652560 10:78248343-78248365 AGGAGGAAACTGAGGCCAGAGGG + Intergenic
1070724765 10:78780417-78780439 ATAAGGACACTGAGATCTGAGGG - Intergenic
1070749700 10:78956683-78956705 ATGTGGACACTGAGGCCTGGAGG - Intergenic
1070786932 10:79167398-79167420 GTGAAGAAACTGAGGCCTGAGGG + Intronic
1071110998 10:82156372-82156394 ATGAGGAAGTTGAGGCCTGGGGG - Intronic
1073184766 10:101609246-101609268 ACGAGAAAATTGAGGCCTGTAGG - Intronic
1073538045 10:104295622-104295644 ATGAGAACATGGAGGCTTGCAGG + Intronic
1074390522 10:113053847-113053869 ATGAGGAAACTGAGGCTTGAGGG + Intronic
1074673334 10:115820784-115820806 ATGAGGAAATTGAGGCACAAAGG - Intronic
1075529915 10:123220251-123220273 ATGAGGAAATTGAGGCCCAGAGG - Intergenic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1075951066 10:126478298-126478320 ATGAGGAACTTGAGACCAGATGG - Intronic
1076365284 10:129917827-129917849 ATGAGGAGCTTGAGGCTAGAGGG - Intronic
1076720957 10:132392905-132392927 ATGAGGACACTGAGGCACAAGGG + Intergenic
1077383869 11:2259960-2259982 GAGAGGACATGGAGGGCTGAGGG + Intergenic
1078417414 11:11177376-11177398 ATGAAGAGATTGAGGCCTGGGGG + Intergenic
1078544482 11:12236942-12236964 ATGATGACTTAGAGGCATGAGGG + Intronic
1078624424 11:12940966-12940988 ATGAGAAAGTTGAGGCCAGAGGG + Intronic
1079098362 11:17525800-17525822 ATGAGGAAATTGAGGCCCAGAGG - Intronic
1079102803 11:17552162-17552184 AAGGGGTCATGGAGGCCTGAGGG - Intronic
1079123091 11:17699094-17699116 ATGAGGACACTGAGGCCAGAGGG + Intergenic
1079129482 11:17738934-17738956 TTGAGGACACTGAGGCCCGTAGG + Intronic
1079548445 11:21664513-21664535 AGGAGGATACTGAGGCCTCAGGG - Intergenic
1080872928 11:36252573-36252595 ATGGGGAAACTGAGGCTTGAGGG - Intergenic
1081606955 11:44533103-44533125 ATGGGGACGCTGAGGCCAGAGGG - Intergenic
1081674574 11:44961162-44961184 ATGAAGAAACTGAGGCCTGAAGG + Intergenic
1081742957 11:45453766-45453788 ATGAGGGCACTAAGGCCTCAAGG + Intergenic
1081936502 11:46907802-46907824 ATGAGGAAACTGAGGCCTGGAGG - Intronic
1082632875 11:55561529-55561551 AGGAGGATATTGATGCCTGAAGG - Intergenic
1082822689 11:57554875-57554897 ATGAGGAAACTGAGGCCTAGAGG - Intronic
1083796511 11:65019990-65020012 AGGTGGACAGTGAGGCCTGTCGG + Intronic
1084079879 11:66815088-66815110 ATGAGAACATTGAAGCCTACTGG + Intronic
1084238677 11:67804788-67804810 ATGAGAACACTGAGGCACGAGGG + Intergenic
1084313350 11:68329594-68329616 ATGAAGACACTGAGGCCTGGAGG + Intronic
1084475714 11:69387554-69387576 ATGAGTAATTTGAGGCCTGGAGG - Intergenic
1084475995 11:69390170-69390192 ATGAGGAAACTGAGGCCAAAAGG + Intergenic
1084833740 11:71788040-71788062 ATGAGAACACTGAGGCACGAGGG - Intronic
1085173229 11:74466205-74466227 ATGAGGAAAATGAGGCCTAGAGG - Intronic
1085311973 11:75522261-75522283 AGGGGGAAATGGAGGCCTGATGG + Intronic
1085330926 11:75650221-75650243 ATGAGGACAATGAAGCAGGAAGG + Intronic
1086016673 11:82176214-82176236 ATGAGGAAATTAAGGCTTAAAGG - Intergenic
1088092251 11:106056693-106056715 ATAAGGAAACTGAGGCCTGAAGG + Intronic
1088884299 11:113994904-113994926 ATGAAGATATTGATGCCTGATGG + Intergenic
1089195092 11:116689640-116689662 ATGAGGACACTGAGGCCCAGGGG + Intergenic
1089287449 11:117416868-117416890 ATCAGGACTTTGAGGGCTGCTGG - Intergenic
1089323779 11:117643781-117643803 GTGAGGACACTGGAGCCTGATGG - Intronic
1089512954 11:119012100-119012122 ATGAGGTCCTTGAGCCATGAGGG - Intronic
1090990602 11:131813879-131813901 ATGAGGAGAATGAGGGCTGTGGG - Intronic
1091236827 11:134027683-134027705 ATGAGGAAATGGAGGCTTCAAGG + Intergenic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091879290 12:3963751-3963773 ATGAGGAAATTGAGGCATGAAGG - Intergenic
1092641206 12:10512571-10512593 ATGAGGGAATTTATGCCTGATGG - Intronic
1093744815 12:22728387-22728409 TTGAGGACTTTGATACCTGAGGG + Intergenic
1094124034 12:27003886-27003908 ATGAGGAAATTGAGGCTTAAGGG - Intronic
1094368258 12:29707053-29707075 ATGGGGACAGTCAGACCTGATGG + Intronic
1094524253 12:31221258-31221280 ATGAGGACATTGAGGCTTAGAGG + Intergenic
1095251944 12:39989312-39989334 TTGAGGATATTGAGGCAAGAGGG - Intronic
1095656472 12:44675265-44675287 ATGATGAAATTAAGGTCTGAAGG - Intronic
1096411701 12:51381666-51381688 ATGAGGAAATTGAGGCTTAGAGG - Intronic
1097055937 12:56249075-56249097 AGGAGGGCATTGAAGCCAGAGGG - Intronic
1097413004 12:59279129-59279151 ATGAGACCTTTGAGGCCAGAGGG - Intergenic
1097424258 12:59422947-59422969 ATGAGGACATTGGCACCTAATGG + Intergenic
1098148720 12:67524739-67524761 ATGAAGACATTGAGGCGGAAAGG - Intergenic
1099876216 12:88409254-88409276 ATGAGAACATGGAGGCATTAAGG + Intergenic
1099889140 12:88568527-88568549 ATGAGGATATTGGGGCCTAGAGG + Intronic
1100333564 12:93608518-93608540 ATGAGGAAACTGAGGCCCCAAGG - Intergenic
1101446709 12:104742165-104742187 ATGAGGAAACTAAGGCCTGAAGG + Intronic
1101813581 12:108129124-108129146 AAGAGGACACTGAGGCCGGAAGG + Intergenic
1101881995 12:108632012-108632034 ATGAGAAAACTGAGGCTTGAAGG - Exonic
1101906991 12:108834412-108834434 GTGAGGACACTGAGGCTTAAGGG + Intronic
1103249034 12:119484195-119484217 ATGAGGAAACTGAGGCATAAAGG - Intronic
1103393330 12:120589705-120589727 ATGATGAAATTGAGGCCTGAGGG - Intergenic
1103558786 12:121781284-121781306 ATGAGGAAATTGAGGCCCTAAGG - Exonic
1104421378 12:128638568-128638590 GTGAGGGCATTGAGGCCTGAAGG + Intronic
1104955990 12:132466075-132466097 ATGAGGACACAGAGGCCCCAGGG - Intergenic
1105638889 13:22242108-22242130 TTAAGGACATTGAGGCCTTAAGG + Intergenic
1105744023 13:23360067-23360089 ATGAGGAAATGGAGCCTTGATGG - Intronic
1106600032 13:31179694-31179716 ATGAGGAAATTGTGGCCTCCAGG - Intergenic
1106627116 13:31432054-31432076 ATGAAGAAACTGAGGCCTGTGGG + Intergenic
1106677554 13:31977129-31977151 CTGAGGAAACTGAGGCCTGGGGG - Intergenic
1109102796 13:58207601-58207623 ATGAAGCCAGTGAGGCCAGAGGG + Intergenic
1111973599 13:94942437-94942459 GTGAGGACACTGAGTCCTAAAGG + Intergenic
1113292067 13:108918466-108918488 ATGAGGACACTGAGTCCTAGAGG + Intronic
1114467630 14:22935359-22935381 ATGAGAAAACTGAGGCCAGAAGG - Intergenic
1114645416 14:24253328-24253350 GTGAGAACACTGAGGCTTGAAGG + Intronic
1115375441 14:32670370-32670392 ATGAGGGTCTTGAGACCTGAAGG + Intronic
1116141207 14:40996542-40996564 ATGAGTATATTGAAGCATGAGGG - Intergenic
1117587292 14:57223047-57223069 ATGAAGAAATTGAGGCATGGTGG - Intronic
1118318024 14:64737445-64737467 ATGAAGACAATGAGGGCTGAAGG - Intronic
1118378485 14:65198285-65198307 AGGAAGACTTTGAGGCCTGAGGG - Intergenic
1119430461 14:74564949-74564971 ATGAGGACATTGAGGCTTTGAGG + Intronic
1119894088 14:78205283-78205305 ATGAGGAAATGGAGGTCTGGGGG + Intergenic
1120706543 14:87751735-87751757 ATGAGGAAACTGAGGCCATAGGG - Intergenic
1120973257 14:90227268-90227290 ATGAGGAAACTGAGGCATAAGGG + Intergenic
1121990888 14:98556165-98556187 ATGAAGAAACTGAGGCCTGGAGG + Intergenic
1122510080 14:102259533-102259555 ATGAGGAAATTGAGTCTTGAAGG - Intronic
1122741251 14:103872623-103872645 ATGAGCAGGTTGAGGCCTGTGGG + Intergenic
1122882856 14:104697816-104697838 ATGAAGACTCTGAGGTCTGAGGG - Intronic
1123042555 14:105496351-105496373 ATGAGGACAGGGAGGTCTGTGGG - Intronic
1124796102 15:32781754-32781776 ATGAGGAAATTGAGGTTTGGGGG - Intronic
1125390526 15:39187566-39187588 ATGAAGACAGTGAGGCTTGGAGG + Intergenic
1126086414 15:45014581-45014603 ATGAGGACATTCTTGCCTCAAGG + Intergenic
1126438039 15:48656077-48656099 ATGGGGAAATTAAGGTCTGAGGG - Intergenic
1126605331 15:50470544-50470566 ATGAGGACATTGAGGCTTGAGGG + Intronic
1126780478 15:52135156-52135178 ACCAGGACTTTGAGGCCTGTGGG - Intronic
1127658178 15:61075293-61075315 TTGAGGACATTGAAGTCTGATGG - Intronic
1128227363 15:66011376-66011398 ATGAAGACACTGAGGTCTGAAGG - Intronic
1128525528 15:68409855-68409877 AGGATGACTTTGAGGCCTCACGG + Intronic
1128706181 15:69838897-69838919 ATGAGAAAATTGAGGCTTAAAGG + Intergenic
1128803066 15:70509423-70509445 ATGAGGAAACTGAGGTTTGAGGG - Intergenic
1129139385 15:73583401-73583423 TTGAGAAAATTGAGGCTTGAGGG - Intronic
1129503965 15:76065621-76065643 ATGAGGACACTGAGGTACGAGGG - Intronic
1129771649 15:78206778-78206800 ATGAAGCCATTGAGGCCCGCAGG + Intronic
1129801353 15:78417214-78417236 ATGAAGCAAGTGAGGCCTGAAGG - Intergenic
1130033346 15:80335431-80335453 ATGAGGAGATGGAGGTCTGTGGG + Intergenic
1131602852 15:93867226-93867248 AAGAGGTCAGTGTGGCCTGAAGG - Intergenic
1131632795 15:94196882-94196904 ATGAAGACATGGAGTCCTCAAGG + Intergenic
1131648835 15:94376483-94376505 ATGAGGACATGGAGGCTTAGAGG - Intronic
1131962882 15:97807887-97807909 AGGAGGAAACTGAGGCCGGAGGG - Intergenic
1132225827 15:100140750-100140772 AAGAGGAAATTGGGGACTGATGG - Intronic
1133222669 16:4325492-4325514 ATGGGGAAACTGAGGGCTGAAGG - Intronic
1133730621 16:8575644-8575666 ATGAGAAAACTGAGGCTTGAAGG - Intronic
1134743847 16:16572269-16572291 ATGGGGACAGTGAGTCCAGAAGG + Intergenic
1134846873 16:17447779-17447801 ATGTGGACATTGAGGCTTAGAGG - Intronic
1135001635 16:18781482-18781504 ATGGGGACAGTGAGTCCAGAAGG - Exonic
1135148495 16:19984619-19984641 ATGTTGACATTGAGATCTGAAGG + Intergenic
1135657151 16:24260457-24260479 ATGAGGAAACTGAGCCCTGGGGG + Intronic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1136069064 16:27777379-27777401 ATGAGGAAATTGAGGCCCGAGGG - Intronic
1136146358 16:28318873-28318895 ATGAGGACAGTCATGCCTGCTGG + Intronic
1136738124 16:32482243-32482265 GAGAGCACATTGAGGCCTAAGGG + Intergenic
1136998694 16:35208897-35208919 ATGTGGACGTGGAGGCATGAGGG + Intergenic
1137037803 16:35580974-35580996 GTGAGGAAACTGAGGCCTGGAGG + Intergenic
1137058858 16:35765884-35765906 TGGAGCACATTGAGGCCTGTAGG - Intergenic
1137585071 16:49659482-49659504 CTGAGGCCCTTGAGGTCTGAGGG + Intronic
1137929652 16:52574933-52574955 ATGAGGACACTGAGGCAGTAAGG - Intergenic
1138210046 16:55155866-55155888 ATGGGAAGATTGAGGCCTGGAGG - Intergenic
1138579511 16:57931633-57931655 ATGAAGAGACTGAGGCCAGAGGG - Intronic
1139352192 16:66343750-66343772 ATGAGGACTTTGAGGCCCTCAGG + Intergenic
1139409821 16:66750736-66750758 TTGAGGAGAGTGAGGCCAGAGGG + Intronic
1139526154 16:67518134-67518156 GAGAGGGCATTGAGGCCTGAAGG + Intergenic
1140129617 16:72148921-72148943 ATGATGACATGGAGGCTTAAAGG + Intronic
1140252611 16:73307388-73307410 ATGAGGATAGTGAGCACTGAAGG + Intergenic
1140643196 16:77001609-77001631 ATGAGGTCACTGAAGCCTCATGG - Intergenic
1140719614 16:77759402-77759424 ATAAGGACATGGAGGCCTAGAGG - Intergenic
1140920597 16:79533995-79534017 ATGGGGACAGTGAGGCCTTCAGG - Intergenic
1141180932 16:81752930-81752952 ATGAGGAAACTGAGGCCCAAAGG - Intronic
1141894337 16:86948936-86948958 ATGGGGAAACTGAGGCATGAGGG + Intergenic
1142146225 16:88493992-88494014 ATGCGGAAACTGAGGCCTGGAGG - Intronic
1142154314 16:88526256-88526278 AGGAGGACACTGAGGCCCGAGGG + Intronic
1142247371 16:88976230-88976252 ATGAGGAAACTGAGGCCAGAGGG - Intronic
1142333744 16:89473198-89473220 TTGGGAACATGGAGGCCTGAAGG + Intronic
1203014949 16_KI270728v1_random:347334-347356 GAGAGCACATTGAGGCCTAAGGG - Intergenic
1203033284 16_KI270728v1_random:620492-620514 GAGAGCACATTGAGGCCTAAGGG - Intergenic
1144463782 17:15480175-15480197 ATGAAGACATTGAGCTCTTAGGG - Intronic
1144952012 17:18999502-18999524 ATGAGGAAACTGAGGCTTGGTGG - Intronic
1145001022 17:19304683-19304705 ATGAAGACAGTGGGGCCTGTGGG - Intronic
1146197411 17:30825013-30825035 ATGAGGAAATTGAGGGATAAAGG + Intergenic
1146501848 17:33371471-33371493 TTGAGCTCTTTGAGGCCTGATGG + Intronic
1146592959 17:34144650-34144672 ATGAGGATATTGAAGTCTGGAGG + Intronic
1146619763 17:34388261-34388283 ATGAGGACACTGAGGTTTGGAGG - Intergenic
1146935831 17:36812185-36812207 ATGAGGAAACTGAGGCTAGAAGG + Intergenic
1149319881 17:55471945-55471967 ATGAGGATATTAATGCTTGAAGG - Intergenic
1149444055 17:56699928-56699950 ATGAGGAAACTGAGGCATAAAGG - Intergenic
1149473000 17:56934426-56934448 ATGAGGAAATTGAGGCTTAGAGG + Intergenic
1149633808 17:58149722-58149744 ATGAAGGCACTGAGACCTGAGGG + Intergenic
1151321613 17:73356063-73356085 ATGAGGACACCAAGGCCTGGAGG + Intronic
1151399740 17:73848329-73848351 ATGAGGCCATTAGGGCATGAGGG - Intergenic
1151558426 17:74858860-74858882 ATGAGGACATTCCAGCCTGGGGG - Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151811822 17:76448168-76448190 ATCAGGGCACTGAGGCCCGAGGG + Intronic
1152960706 18:78945-78967 ATGAGGACAAGGAGGAATGAGGG + Intergenic
1153988575 18:10375001-10375023 ATGAGGAAATGGTGGCTTGAAGG - Intergenic
1154059717 18:11047828-11047850 ATGATGACATTGATGTTTGAGGG + Intronic
1154072281 18:11163442-11163464 ATGAGGAAATTGAGGCTTACAGG - Intergenic
1155024123 18:21925949-21925971 ATGAGGACACTGGGGCCAGAGGG + Intergenic
1155531987 18:26776754-26776776 ATGAGGAAACTGAGGCCCTAAGG + Intergenic
1156108330 18:33692497-33692519 AGGAGGACTTTGAGCCCTGGTGG - Intronic
1156196587 18:34780947-34780969 ATGAGGACATTAACTCCTGTAGG - Intronic
1156788666 18:40946491-40946513 ATGAGGAAACTGAGGACTGAAGG + Intergenic
1157135263 18:45048035-45048057 ATGAGAAAATTGAGACCAGAAGG + Intronic
1157189547 18:45569139-45569161 ATAAGGACAGTGGGGCATGAGGG - Intronic
1157684382 18:49630842-49630864 CTGAGGACTCTGAGTCCTGAGGG - Intergenic
1157941290 18:51931620-51931642 GTGAAGACACTGAGGCATGATGG + Intergenic
1158319460 18:56247394-56247416 ATGAGGAAATTAAGGCCTGGAGG - Intergenic
1158403658 18:57142598-57142620 AGGGGGACATTCAGGGCTGATGG + Intergenic
1158911397 18:62066340-62066362 ATGAGGACACTGTGGCCCTAAGG - Intronic
1159890085 18:73944877-73944899 ATGAGGACAGTGAGGTGTGGAGG - Intergenic
1159913837 18:74171657-74171679 TTGGGGACACTGAGGCTTGATGG - Intergenic
1159980163 18:74768690-74768712 ATGAGAAAATTGAGGCCTACTGG - Intronic
1160617416 18:80142185-80142207 CTGAGGAAATTGAGGCATGGAGG + Intronic
1160746448 19:713381-713403 ATGAGAACAGTGAGGCCCGGAGG - Intronic
1160965182 19:1744312-1744334 GTGAGCAAACTGAGGCCTGAGGG - Intergenic
1161263087 19:3348321-3348343 ATGAGGAAATTGAGGCCCACAGG - Intergenic
1161268895 19:3378594-3378616 ATGAGGAAACTGAGGCCTTGAGG - Intronic
1161280462 19:3442812-3442834 ATGTGGAGGCTGAGGCCTGATGG - Intronic
1161363341 19:3863862-3863884 ATGAGGAAAGTGAGGCTTGGGGG - Intronic
1161856584 19:6769238-6769260 ATGAGGAAATTGAGGCCTAGAGG + Intergenic
1162296577 19:9818359-9818381 ATGAGGAAATTGAGGCCCTGAGG + Intronic
1162509735 19:11110834-11110856 ATGGGGAAACTGAGGCATGAGGG - Intronic
1163536440 19:17879516-17879538 ATGAGGAAATTGAGGCTCGGGGG + Intronic
1163567413 19:18059787-18059809 ATCAGGGCCTGGAGGCCTGAGGG - Intronic
1163568355 19:18065264-18065286 ATGAGGAAACTAAGGCCTGGAGG - Intronic
1163584729 19:18157441-18157463 ATGAGGAAACTGAGGCCTCGAGG - Intronic
1164355352 19:27420082-27420104 TTGAGCCCATTGAGGCCTAAGGG - Intergenic
1164679838 19:30126760-30126782 ATGAAGACATTGAGGCCCAGCGG - Intergenic
1164923231 19:32105304-32105326 ATGAGTAAACTGAGGCCTGTGGG - Intergenic
1166537238 19:43581945-43581967 AAGAGGACATTGGTGCCTGTGGG - Exonic
1166647758 19:44544775-44544797 ATGAGGACATTGATCCATGGGGG + Intergenic
1166769964 19:45275728-45275750 ACGAGGAGGTTGAGGCCTGGAGG - Intronic
1167122537 19:47527205-47527227 AGGAGGAGATTCAGGGCTGAGGG + Intronic
1167248088 19:48385874-48385896 ATGAGGAAACTGAGGCCCAAAGG + Intronic
1167490756 19:49791752-49791774 ATGAAGACACTGAGTCCTGGTGG + Intronic
1167505888 19:49870918-49870940 ATAAGGACACTGAGGCTTGAGGG + Intronic
1167528510 19:50000514-50000536 ATGAGGAAACTGAGCTCTGAGGG + Intronic
925288370 2:2730431-2730453 AGGAGGACAGCGGGGCCTGATGG - Intergenic
925326775 2:3028656-3028678 ATGAGGAGACTGAGGCTTGGTGG - Intergenic
925425598 2:3746787-3746809 AGGAGGACCTTGAGCCCTGGGGG + Intronic
925675899 2:6360689-6360711 AGGAGGAGATCGGGGCCTGAGGG + Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
926086618 2:10024021-10024043 ATGAGGAAACTGAGGCCCAAGGG - Intergenic
926387198 2:12347780-12347802 ATGAAGAAATTTAGGCCTGTAGG - Intergenic
926916733 2:17899592-17899614 ACGAGGATACTGAGGCCTCAGGG - Intronic
927083064 2:19649385-19649407 ATGAGGACATCTAGGCTGGATGG - Intergenic
927107986 2:19844211-19844233 ATGAGGACAGGAAGGCCTGGGGG + Intergenic
927112451 2:19873456-19873478 ATGGGCATATTGAGGCCTAAAGG - Intergenic
927468694 2:23356241-23356263 ATGAGGATGATGAGGGCTGAGGG - Intergenic
927747008 2:25632493-25632515 AAGAGGTCATTGAGTCATGAGGG + Intronic
928430837 2:31217214-31217236 ATGAGGAGATTGGGGCCAAAGGG + Intronic
929028914 2:37632777-37632799 ATGTGTAGATTGAGGCCAGAAGG + Intergenic
929940105 2:46327107-46327129 ATGAGGAAACTGAGACCTGGAGG - Intronic
929946076 2:46373116-46373138 ATGAGGAAACTAAGGCCAGAGGG - Intronic
930410138 2:51015119-51015141 ATGAGGACATTGAGAACTGTTGG - Intronic
930486904 2:52022256-52022278 ATGGGGACTTTGAAGGCTGAAGG - Intergenic
932442981 2:71749594-71749616 GTGAGGACTGTGAGGCTTGAAGG + Intergenic
932493901 2:72137332-72137354 ATGAGGAAACTGAGGCTTGGGGG - Intronic
932594001 2:73083104-73083126 ATGTAGACAGTGAGTCCTGAAGG + Intronic
932615477 2:73228621-73228643 ATGGGGACAGTGGGGCATGATGG - Intronic
932739402 2:74280268-74280290 ATGTTCACATTGAGACCTGAAGG - Intronic
932824212 2:74925165-74925187 GTGAGGTCACTGAGGCCTCAGGG + Intergenic
933156505 2:78981334-78981356 ATGAGGAAATGGAGGCTTAAAGG - Intergenic
933554502 2:83815194-83815216 ATGAGGAAACTGAGGCATGGGGG + Intergenic
933599762 2:84317466-84317488 ATGTGGAAACTGAGGCCAGAAGG - Intergenic
934618511 2:95790048-95790070 ACGAGGAAGCTGAGGCCTGAGGG + Intergenic
934642382 2:96034511-96034533 ACGAGGAAGCTGAGGCCTGAGGG - Intronic
934686799 2:96327215-96327237 ATGATCTCATTGAGGCCTGTCGG + Exonic
936042214 2:109158613-109158635 CTCAGGACTTTGAGGCTTGAGGG + Intronic
936754648 2:115692701-115692723 ATGAGAAAATTGAGGCTTGCAGG - Intronic
937228470 2:120383342-120383364 ATGAGGACAATGAGCCCAGCAGG - Intergenic
937368296 2:121280928-121280950 ATGAAGACACTGAGGCTGGAGGG + Intronic
938981620 2:136532507-136532529 ATGAGGAAATTGAGGCTTAGAGG + Intergenic
939026187 2:137016160-137016182 ATGAGGAAATTGAGGCTTGGGGG + Intronic
939171519 2:138701601-138701623 ATGAGGAGATTGCGGCTTGGAGG + Intronic
939590915 2:144062365-144062387 ATGAGGAAACTGAGGCATAAAGG + Intronic
940971048 2:159897150-159897172 ATGAAGACACTGGGGACTGAGGG + Intronic
941393726 2:164948448-164948470 ATGAGAAAAGTGAGGCATGAAGG + Intronic
942389391 2:175476407-175476429 AGGAGGACATTGAGGCTTAGAGG + Intergenic
942654952 2:178205396-178205418 ATGATGACAGTGAGGAGTGATGG + Intronic
942843794 2:180398412-180398434 ATGAAGAAATTGAGGCATAAGGG + Intergenic
943727215 2:191264917-191264939 GTGAGGAAACTGAGGCTTGAAGG + Intronic
944299483 2:198106838-198106860 ATGAGGAAATTGAGGCTTGTGGG + Intronic
944354743 2:198773885-198773907 ATGAGGTCAATGAAGCCTGCTGG + Intergenic
944478857 2:200134706-200134728 ATGAGGAGATAAAGGCCTGTGGG - Intergenic
944891812 2:204125414-204125436 AGGAGGGCATTTAGGTCTGAAGG - Intergenic
945040174 2:205737415-205737437 AGGAGGAAATTGGGGCCCGAGGG + Intronic
945365750 2:208951456-208951478 ATGAGGAAACTGAGGCCAGGTGG - Intergenic
945827231 2:214737263-214737285 CTGAGGACTCTGAGGGCTGAAGG - Intronic
946192546 2:218015195-218015217 ATGAGGACACTGAGGCCCAGAGG + Intergenic
946711860 2:222515135-222515157 ATGAGGACATCAAGACTTGAAGG - Intronic
947171111 2:227312373-227312395 CTGAGGACCGTAAGGCCTGATGG + Exonic
947356156 2:229297942-229297964 ATAGGGAAATTGAGGCCTGAGGG - Intergenic
947623182 2:231604058-231604080 AAGAGGGCATTGGGGCCAGAAGG - Intergenic
948396868 2:237650939-237650961 AGGAGGATGTGGAGGCCTGAGGG - Intronic
948689765 2:239694557-239694579 ATGAGGAAACCAAGGCCTGATGG + Intergenic
1168850497 20:973345-973367 CTGGGGACACTGAGGCCAGAAGG + Intronic
1169426139 20:5498756-5498778 AGGAGAAAATTGAGGCCTGAGGG - Intergenic
1170196706 20:13696323-13696345 ATGAGGAAACTGAGCCCAGATGG + Intergenic
1170411184 20:16093875-16093897 ATGGGGACACTGAAGTCTGAAGG - Intergenic
1171427164 20:25056645-25056667 ATGAGGAGACTGAGGGCTGGGGG + Intronic
1171743141 20:28928647-28928669 GTGAGCCCATTGAGGCCTGTGGG - Intergenic
1171809713 20:29735634-29735656 ATGAGCACTTTGAGGCCTATGGG - Intergenic
1172178083 20:32984705-32984727 GTGGGGAAACTGAGGCCTGAAGG - Intronic
1172479287 20:35261436-35261458 GTGAGGACATTGAGGCTTAGGGG + Intronic
1172846419 20:37932088-37932110 GTGAGGAAACTGAGGCCAGAGGG + Intronic
1172872531 20:38144646-38144668 ATGAGGAAATTGAGGCTTGGAGG + Intronic
1173172071 20:40735149-40735171 ATGATGACATTGAGGCATAGAGG + Intergenic
1173372038 20:42445224-42445246 ATGAGGAAATTGAGTGCAGAGGG - Intronic
1173596749 20:44263507-44263529 ATGAGGAAACTGAGGCCCGAGGG - Intronic
1173620601 20:44433055-44433077 ATGAGGAGACTGAGGCTTGGGGG + Intergenic
1173648047 20:44645940-44645962 CTGAGAACATTAAGGGCTGAGGG + Intronic
1173716573 20:45212154-45212176 ATGAAGACATTAAGACCTGATGG - Intergenic
1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG + Intergenic
1173991837 20:47309628-47309650 ATGAGAAAACTGAGGCCAGAAGG + Intronic
1174039218 20:47687217-47687239 AGAAGGACACTGAGGCCAGAAGG + Intronic
1174339587 20:49887488-49887510 CTGAGGAGATGGAGGCCTAAGGG + Intronic
1174404191 20:50292996-50293018 ATGGGGACAGTGAGGCCTGCAGG + Intergenic
1174799110 20:53548161-53548183 ATTAGGAAACTGAGGCCTGAGGG - Intergenic
1174869253 20:54168191-54168213 CTGAGGACATTCAGGGCTGTGGG - Intronic
1178338361 21:31764180-31764202 ATGAGGAAACTGAGGGCTGTAGG - Intergenic
1178580859 21:33837009-33837031 TTGAGGACTTTCAAGCCTGAGGG - Intronic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179612814 21:42563439-42563461 ATGAGGACACAGAGGCCTCCCGG - Intronic
1180051467 21:45333427-45333449 ATGTGGACAGTGATGACTGATGG - Intergenic
1180106322 21:45620534-45620556 ATGAGGAAAATGAGGCATGGAGG - Intergenic
1181113136 22:20613438-20613460 ATGTGGACACTGAGGCCTGGAGG - Intergenic
1181539244 22:23564574-23564596 GTGAGGACAGTGAGGCCGGCAGG - Intergenic
1181671939 22:24429698-24429720 ATGAGGAAACTGAGGCCCAAAGG - Intronic
1181808222 22:25387935-25387957 GTGAGGACACTGAGGCCTGGAGG - Intronic
1181897240 22:26121333-26121355 AAAAGGACATTGAGGCCAGAGGG - Intergenic
1181910222 22:26232827-26232849 ATGAGGAGACTGAGGCTCGAGGG - Intronic
1182036100 22:27199426-27199448 ATGAGGAAACTGAGGCCAGAGGG - Intergenic
1182075721 22:27494233-27494255 ATGAGGAGAGTGATGCCTGAGGG + Intergenic
1182171950 22:28239784-28239806 ATGAGGACCTTGAGCCCCCAAGG + Intronic
1182578176 22:31287838-31287860 ATGAGGAAACTGAGGCAAGAGGG - Intronic
1182662678 22:31936135-31936157 ATGAAGTCATTGAGCCCTGAAGG - Intronic
1183059527 22:35327594-35327616 ATGAGGAAACTGAGGCCAGGGGG - Intronic
1183405648 22:37629455-37629477 GTGGGGTCACTGAGGCCTGAGGG - Exonic
1183512364 22:38243652-38243674 ATGAGAATACTGAGGCCAGATGG - Intronic
1183545201 22:38451736-38451758 AAGTGGAAACTGAGGCCTGAGGG - Intronic
1183545221 22:38451832-38451854 AAGTGGAAACTGAGGCCTGAGGG - Intronic
1183856832 22:40640285-40640307 ATGAAGTCACTGAGGCCTGATGG - Intergenic
1183981702 22:41544279-41544301 ATGAGGAAACTGAGGCCAGAGGG + Exonic
1183988075 22:41580212-41580234 ATGAGGACACTGAGGCCAGAGGG - Intronic
1184058856 22:42069973-42069995 ATAAGGAAACTGAGGCCCGAGGG - Intronic
1184250679 22:43258423-43258445 ATGGGGAAACTGAGGCCTAAGGG + Intronic
1184292797 22:43507091-43507113 ATGAGACGATTGAGGCCAGAGGG + Exonic
1184556441 22:45235801-45235823 ATGAGGACACTGAGGCCCGAGGG + Intronic
1184808767 22:46814330-46814352 ATGAGGAAACTGAGGCTTGAAGG + Intronic
1184851436 22:47123527-47123549 ATGGGCAGGTTGAGGCCTGACGG - Intronic
1184859965 22:47167991-47168013 ATGAGGAAACTGAGGCATGGAGG + Intronic
1184908784 22:47511584-47511606 ATGAGAAAATGGAGACCTGATGG + Intergenic
1184976963 22:48069179-48069201 ATGAGGACACTGACGCCGGGTGG - Intergenic
949284327 3:2383476-2383498 TTGAGAAAATTGAGGCCTGGAGG + Intronic
949299302 3:2565050-2565072 AAGAGGACCTTGAGGAATGATGG - Intronic
949473998 3:4425254-4425276 ATGAGTAAGCTGAGGCCTGAAGG - Intronic
949528294 3:4928134-4928156 ATGAGGAAATTTAGGCCCCAAGG - Intergenic
949826535 3:8171330-8171352 ATTAGTACACAGAGGCCTGATGG + Intergenic
950172268 3:10847130-10847152 ATGAGGAAACTGAGGCATGGAGG + Intronic
950651456 3:14409835-14409857 ATGAGGACGCTGAGGCCCAAAGG + Intronic
950668005 3:14509018-14509040 ATGAAGACATTGGGGTCAGAAGG + Intronic
950834381 3:15905267-15905289 ATGAGAACACTGAGGCCTAGAGG + Intergenic
950841998 3:15976662-15976684 ATAGGGGCTTTGAGGCCTGAGGG - Intergenic
951158724 3:19388898-19388920 ATGAGGAAATTGAGGCATAAAGG - Intronic
951982780 3:28583911-28583933 ATGAGGACAGTGGGGTGTGATGG - Intergenic
951992115 3:28687072-28687094 ATGGGCACATTAAGCCCTGAGGG + Intergenic
952338061 3:32421952-32421974 ATGAGGAAACTGAGGCCCAACGG + Intronic
952653249 3:35751693-35751715 ATGAGGAAAGTGAGGCTAGAAGG + Intronic
952841560 3:37650937-37650959 ATGAGGAAACTGAGTCCTGGAGG + Intronic
953393622 3:42548989-42549011 ATGAGGAAACTGAGGCCTGATGG + Intronic
953467107 3:43131717-43131739 ATGAGGAAACTGAGGCCGGAAGG + Intergenic
953928245 3:46993222-46993244 ATGAGGACACTGAGGCCTGGAGG + Intronic
954094483 3:48314185-48314207 ATGAAGACACTGAGACCTGAGGG - Intronic
954923542 3:54212832-54212854 TTGAGGAAACTGAAGCCTGAAGG - Intronic
955942075 3:64156117-64156139 ATGTGGAAACTGAGGCATGAAGG + Intronic
956126456 3:66015350-66015372 ATGAGGAAATGGATGCCTGCAGG - Intronic
956173326 3:66450366-66450388 ATGAGGAAAGTGAGGCCCGGGGG - Intronic
956504046 3:69918653-69918675 ATGAGGAAACTGAGGGCAGAGGG - Intronic
956814733 3:72897702-72897724 ATGAGGAAACTGAGGGCTAAAGG + Intronic
957054625 3:75434585-75434607 ATGAGAACACTGAGGCACGAGGG + Intergenic
957408872 3:79810342-79810364 TTGAGGACTCTGAGGCCTAATGG - Intergenic
957651231 3:83007798-83007820 ATGAGGAAATGGAGGCTTGAGGG + Intergenic
959146797 3:102556647-102556669 AGGAGGACATTGAGCATTGAGGG + Intergenic
959809664 3:110601651-110601673 ATGAGGTCATTTGGGCCTAAAGG - Intergenic
960459513 3:117916205-117916227 ATGAGGAGACTGAGGCTTGGAGG + Intergenic
961073464 3:123960474-123960496 ATGAGGAAATCGAGGGCTGGAGG - Intronic
961267539 3:125656514-125656536 CTGAGCCCATTGAGGCCTTATGG - Intergenic
961300220 3:125917128-125917150 ATGAGAACACTGAGGCACGAGGG - Intergenic
961301589 3:125925375-125925397 ATGAGGAAACTGAGGCCCAAGGG - Intergenic
961310108 3:125991342-125991364 ATGAGGAAATTGAGGGCTGGAGG + Intergenic
961771026 3:129249980-129250002 ATGGGTAAATTGAGGCCTGGGGG - Intronic
961830301 3:129619780-129619802 ATGGGGAAATTGAGGCCTGGCGG - Intergenic
961888282 3:130110947-130110969 ATGAGAACACTGAGGCCCGAGGG + Intronic
962509936 3:136088228-136088250 GTGAGCACAGTGAGGGCTGAGGG - Intronic
963951009 3:151200876-151200898 ATGAGGAAATTGAGGCATAATGG + Intronic
965405522 3:168263637-168263659 ATGAGAACACTGAGTCCAGAAGG - Intergenic
966946147 3:184778416-184778438 AGGAGGACACTGAGGCTTGGAGG + Intergenic
967069942 3:185953741-185953763 ATGAGGACATTGAAGCTGGGAGG + Intergenic
968074711 3:195810051-195810073 GTGAGGACGTGGAGGCCGGAAGG - Intronic
968091040 3:195898350-195898372 ATGAGGAAATTGAGGCTTAGAGG - Intronic
968712838 4:2132123-2132145 ATGAGGACATGAAGGCCTTGGGG + Intronic
968943156 4:3649849-3649871 ATGAGGAAACTGCAGCCTGATGG - Intergenic
968997440 4:3954894-3954916 ATGAGAACACTGAGGCACGAGGG + Intergenic
969171151 4:5364785-5364807 GTGAACACATGGAGGCCTGAAGG - Intronic
969225357 4:5793767-5793789 ATGAGGACACTGAGGCTGGAGGG - Intronic
969944133 4:10765402-10765424 ATTGGGACAGTGAGGCATGATGG + Intergenic
969984228 4:11190535-11190557 ATGAGGAAACTGACGACTGAGGG + Intergenic
970253974 4:14147671-14147693 ATGAGGAAACTGAGGCCTAGAGG - Intergenic
970489071 4:16553836-16553858 CTGAGCACACTGAGGCCTGTGGG + Intronic
970860631 4:20698933-20698955 AAGAGGAAATTGAGGCTTGTAGG + Intronic
971060106 4:22958435-22958457 ATGAGGAAATTGAGGCCCATGGG + Intergenic
971265421 4:25092499-25092521 ATGAGGACTTAGAGGCATGGAGG - Intergenic
971646949 4:29218810-29218832 ATGAGGAAATTGGGGTCAGATGG + Intergenic
972688373 4:41372839-41372861 ATGAGGAAACTGAGACTTGAGGG + Intronic
972818639 4:42673777-42673799 ATGAGGAAATTGAGGCACAAGGG - Intergenic
973930981 4:55793203-55793225 GTGGGGACATTGTTGCCTGAGGG - Intergenic
974419127 4:61648834-61648856 ATGAAGAAATTGAGGCCTAATGG + Intronic
975586045 4:75950326-75950348 GTGAGGTCACTGAGGCCTTATGG - Exonic
977391662 4:96417326-96417348 ATGGGGAAATTAAGGCTTGAAGG + Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978582435 4:110245661-110245683 ATGAGGAAACTGAGGCTTGGAGG - Intergenic
978637453 4:110826776-110826798 ATGAGGACATTGAGAAGTAAAGG + Intergenic
979412781 4:120399384-120399406 ATGAGAAAATTGAGGCCTAGAGG + Intergenic
979447182 4:120827859-120827881 ATGAGGACATTGAGGCCCATAGG - Intronic
981903965 4:149898126-149898148 ATGAGGAAACTGAGGCCCAAAGG + Intergenic
982928659 4:161373052-161373074 ATGAGGAAATTCAAGCCTAATGG - Intergenic
983420886 4:167515540-167515562 ATGAAGCCATTGTGGCTTGAGGG - Intergenic
985027921 4:185757661-185757683 AAGAAGACATGGAGGCATGATGG + Intronic
985620043 5:949369-949391 ATGAGGACCCTGAGGCCCAAGGG + Intergenic
986850781 5:11811141-11811163 CTGAGGAAACTGAGGCCTGATGG + Intronic
988992675 5:36686856-36686878 ATGAGGACACTGAGGCCTAGAGG - Exonic
988997865 5:36731517-36731539 ATGAGGAAACTGAGGCTTGGGGG + Intergenic
989831049 5:45919543-45919565 GGGAGCACATTGAGGCCTGCAGG - Intergenic
989856671 5:46303936-46303958 GGGAGCACATTGAGGCCTAATGG - Intergenic
990337290 5:54787226-54787248 ATGAGGACATGGAAGTATGAAGG - Intergenic
990528894 5:56654674-56654696 ATGAGGACATTGAGGACCGGAGG - Intergenic
990902520 5:60768356-60768378 ATGAGTACATTGAGGCATTTTGG - Intronic
991291994 5:65042187-65042209 ATGAGGCCCTTGAGTCCTGAAGG - Intergenic
992796650 5:80259619-80259641 ATGAGGAAACTGAGGCTTGGAGG - Intergenic
992889006 5:81186911-81186933 ATGAAGAAATGGAGGCCTGGAGG - Intronic
992952017 5:81868360-81868382 GTGAGGAAATTGAGACCCGAAGG + Intergenic
993106409 5:83605695-83605717 ATGAGGACATAGAGGCCCCTAGG + Intergenic
993884302 5:93398081-93398103 ATGCTGACAGGGAGGCCTGATGG + Intergenic
994519753 5:100818055-100818077 CTGAGGACACTGAGGCTTGGTGG + Intronic
995379019 5:111512076-111512098 CTGAGGACACTGAGGTCTAATGG + Intronic
996375985 5:122807386-122807408 ATGAGGACATTAGGGGATGATGG - Intronic
997460214 5:134046855-134046877 ATGAGAAGATCGAGGCCTGGAGG - Intergenic
997841658 5:137246644-137246666 GTAAGGACAGTGTGGCCTGAGGG + Intronic
998099567 5:139421133-139421155 ATCAGGCCAGTGTGGCCTGATGG + Intronic
998169305 5:139863137-139863159 ATGATGACATTTATGCCTGTGGG - Intronic
998362882 5:141605674-141605696 AGGAGGACACTGAGGCCTAGTGG - Intronic
998615110 5:143731619-143731641 CTGAGGACTATGAGACCTGAAGG + Intergenic
998682757 5:144488445-144488467 ATGAAGAAATTGAGGCTTCAAGG - Intergenic
999093454 5:148957621-148957643 GTCTGGACACTGAGGCCTGAGGG - Intronic
999173841 5:149617933-149617955 ATGAGGAAACTGAGGCCCCAAGG + Intronic
999690774 5:154144128-154144150 ATGAGGAAACTGAGGCCCCAAGG - Intronic
999973272 5:156886155-156886177 ATGAGAACACAGAGTCCTGAAGG - Intergenic
1000006794 5:157192857-157192879 ATGAGGACAATGAGGTTTCAAGG - Intronic
1000589823 5:163144850-163144872 ATGATGACATTAAGGCTTGCGGG + Intergenic
1000705883 5:164511184-164511206 ATGAGGTTAGTGAGGCCTAAAGG + Intergenic
1000763248 5:165252707-165252729 ATGAGGAAAATGAGGCCCAAGGG + Intergenic
1001242662 5:170081985-170082007 GTGAGGACATTGAGGGTGGAAGG + Intronic
1001384152 5:171324550-171324572 ATGAGGCACTTGAGGGCTGATGG + Intergenic
1001580334 5:172793872-172793894 ATGAGGAAATTGAGGTCGAATGG + Intergenic
1003355350 6:5364272-5364294 ATGAGAACCTTGAGGCCAGAAGG + Intronic
1004312226 6:14555647-14555669 AGGAGGACTTGGAGGGCTGAGGG - Intergenic
1005052896 6:21701708-21701730 ATGAGGACATAGAAACCAGAAGG - Intergenic
1005410423 6:25539453-25539475 ATGAAGACATTAAGACATGAAGG + Intronic
1005828045 6:29647764-29647786 TTGATGAAATTGAGGCCAGACGG - Intergenic
1006447695 6:34089046-34089068 ATGGGGAAATGGAGGCCAGAGGG - Intronic
1007108966 6:39302043-39302065 ATGGAGACACTGAGGCCTGGAGG - Intronic
1007130424 6:39467112-39467134 ATGAGGAAGTTCAAGCCTGAAGG + Intronic
1007248562 6:40480169-40480191 ATGAGGAAATGGAGGCCAGATGG + Intronic
1007341786 6:41195233-41195255 ATGAGGACAAGGAGGCATCAAGG + Intronic
1007364146 6:41378693-41378715 ATGAGGAGCTTGCAGCCTGAGGG - Intergenic
1007749357 6:44062682-44062704 ATAAGGAAACTGAGACCTGAGGG + Intergenic
1007809645 6:44476836-44476858 TTGAGGGCATGGAGGTCTGAGGG + Intergenic
1008789387 6:55211767-55211789 ATGTTTAAATTGAGGCCTGAAGG - Intronic
1008807487 6:55449360-55449382 CAGATGACATTGAGGCCTTAGGG + Intronic
1008981386 6:57488020-57488042 ATGAGGAAATTGAGGCACTAAGG + Intronic
1009169479 6:60381050-60381072 ATGAGGAAATTGAGGCACTAAGG + Intergenic
1009461878 6:63922956-63922978 ATGAGGACATTGAGGCCTGAGGG - Intronic
1010489591 6:76459497-76459519 ATGATGAGAAGGAGGCCTGAGGG - Intergenic
1011342537 6:86332967-86332989 ATGAGAAACTTGAGGCCTGGAGG + Intergenic
1011888761 6:92130130-92130152 AAGAGAACATTGAAGCATGAAGG + Intergenic
1013127010 6:107193713-107193735 ATGATCACATTGAGAGCTGAAGG - Intronic
1013137725 6:107298735-107298757 ATGAGAACATTTAGGTCTTATGG - Intronic
1014410997 6:121120666-121120688 ATGAGGAAATTGAGGCATAGAGG - Intronic
1016376816 6:143429941-143429963 ATGAGGCCACTGAGGAGTGAAGG - Intronic
1017261946 6:152397665-152397687 ATGAGGATTTTGTGGCCTAATGG - Intronic
1017514485 6:155143722-155143744 ATGAGGGCTTTGGGGCCAGAGGG + Intronic
1017975650 6:159354763-159354785 ATGAGGACAATGAGGCATTCAGG - Intergenic
1020080722 7:5284415-5284437 GTGGGGAAACTGAGGCCTGAGGG + Intronic
1020128769 7:5547889-5547911 ATGCTGACACTGAGCCCTGAAGG - Intronic
1021920471 7:25480105-25480127 ATGAGAAGAGTGTGGCCTGAAGG - Intergenic
1022563476 7:31373664-31373686 ATGAGGACACTGAGGCCCAGGGG - Intergenic
1022586230 7:31615329-31615351 ATGGGAACATTGAGGTATGAGGG - Intronic
1022807233 7:33834558-33834580 ATGAGGAAACTGAGGCTTGCAGG + Intergenic
1023132973 7:37021642-37021664 ATGGGGATATAGAGGCCTGGAGG - Intronic
1023146950 7:37160800-37160822 ATGAAGACCATCAGGCCTGAAGG - Intronic
1023827399 7:44018856-44018878 ATGAGGACACTGAGGCTTGGAGG - Intergenic
1023846730 7:44125129-44125151 ATGAGGAAATTGAGGCAGGGAGG + Intergenic
1024096453 7:45986602-45986624 AAGAGGAAATGGAGGCCCGAAGG + Intergenic
1024125969 7:46294974-46294996 ATGAGGACACAGAGGCTTCATGG - Intergenic
1024199471 7:47091106-47091128 ATGGGAAAACTGAGGCCTGAAGG - Intergenic
1024244341 7:47457846-47457868 ATGAGGACACTGAGGCGACAGGG - Intronic
1024433387 7:49318610-49318632 ACGAGGTGATTGAGTCCTGAGGG + Intergenic
1024530535 7:50388557-50388579 GTGAGAAGATTGAGGCCTGGAGG - Intronic
1025198204 7:56947762-56947784 GTGGGGAAACTGAGGCCTGAGGG - Intergenic
1025526373 7:61817404-61817426 GAGAGTACATTGAGGCCTAAGGG + Intergenic
1025535133 7:61938174-61938196 TGGAGCACATTGAGGCCTAAGGG + Intergenic
1025536837 7:61958737-61958759 GGGAGCACATTGAGGCCTGTGGG + Intergenic
1025549762 7:62230135-62230157 GAGAGCACATTGAGGCCTAAGGG + Intergenic
1025673744 7:63629174-63629196 GTGGGGAAACTGAGGCCTGAGGG + Intergenic
1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG + Intergenic
1029738555 7:102478603-102478625 ATGAGGACACTGAGGCTTGGAGG - Intronic
1029755685 7:102572267-102572289 ATGAGGACACTGAGGCTTGGAGG - Intronic
1029773634 7:102671347-102671369 ATGAGGACACTGAGGCTTGGAGG - Intronic
1030730915 7:112987667-112987689 ATGAGGGACTTGAAGCCTGATGG + Intergenic
1031130601 7:117829117-117829139 CTGAGGCCACTGAGGCCTGCAGG - Intronic
1031994696 7:128222231-128222253 ATGAGGACGCTGAGGCATAAAGG - Intergenic
1032216231 7:129959471-129959493 ATGAGGAAACTGAGGCATAAAGG - Intergenic
1032389068 7:131544062-131544084 ATGAGGAAACTGAGGCCTGCAGG + Intronic
1032432987 7:131878158-131878180 ATGAAGGAATTGAGGCCTTAGGG + Intergenic
1032657092 7:133942573-133942595 ATGAGGAAATTAAGGTCTCAGGG + Intronic
1032757532 7:134905404-134905426 ATGAGGAAAATGAGGCCAGAGGG + Intronic
1033359164 7:140626030-140626052 ATGTGGACATTAAGGCCTGGAGG + Intronic
1034334424 7:150311450-150311472 AGGAGGACATTAACGCTTGAAGG - Intronic
1034955890 7:155334455-155334477 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034955927 7:155334743-155334765 CTGAGGACAATGAGGACTGAGGG - Intergenic
1034955936 7:155334807-155334829 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034955952 7:155334935-155334957 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956002 7:155335207-155335229 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956008 7:155335239-155335261 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956019 7:155335319-155335341 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956026 7:155335351-155335373 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956041 7:155335511-155335533 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956057 7:155335607-155335629 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956064 7:155335639-155335661 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956086 7:155335846-155335868 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956111 7:155336086-155336108 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1034956119 7:155336150-155336172 CTGAGGGCAATGAGGACTGAGGG - Intergenic
1035013559 7:155742809-155742831 ATGAGGAGACTGAGGCTTGTGGG - Intronic
1035041007 7:155927107-155927129 ATGAGGACATTCAGGCCACCAGG + Intergenic
1035053303 7:156017016-156017038 ATGAGACCACTGAGGCCAGAGGG - Intergenic
1035605497 8:927551-927573 ATGAGGACACTGAGGCTCGGAGG - Intergenic
1035779903 8:2219972-2219994 ATGAGGACATCAAGGCCTCGAGG + Intergenic
1036244295 8:7103338-7103360 TTGAGGAAACTGAGGCCTGAAGG - Intergenic
1036379817 8:8229107-8229129 ATGAGAACACTGAGGCCCTAGGG - Intergenic
1036704872 8:11039512-11039534 ATGAGGACATTGGGCCTTGACGG + Intronic
1036849748 8:12193545-12193567 ATGAGAACACTGAGGCACGAGGG + Intronic
1036871112 8:12435818-12435840 ATGAGAACACTGAGGCACGAGGG + Intronic
1036897537 8:12648071-12648093 TTGAGGAAACTGAGGCCTGAAGG + Intergenic
1037163519 8:15799666-15799688 ATGAGGACTTTATGGGCTGATGG - Intergenic
1037340245 8:17836933-17836955 GTGAGGAAATTGAGGCCTAGAGG - Intergenic
1037723060 8:21460853-21460875 ATGAGGAAATTGAGTCCTAGAGG - Intergenic
1037802213 8:22042068-22042090 ATGAGGACAGTAATGCCTCAGGG - Intergenic
1038303621 8:26378971-26378993 ATGCAGACACTGAGGCCTTATGG - Intergenic
1038589635 8:28824826-28824848 ATGAGGAAACTGAGGCTTGGAGG - Intronic
1038795376 8:30704834-30704856 ATGAAGTCATTAAGACCTGAGGG - Intronic
1038902681 8:31861678-31861700 ATGAGGACTTTGAGACCCTAGGG + Intronic
1038931860 8:32202582-32202604 ATGAGGTCATACAGACCTGAAGG + Intronic
1039324130 8:36466246-36466268 ATGAGGCCATTGATACCTGATGG + Intergenic
1039344047 8:36684415-36684437 ATGAGGAAACTGAGTCCTGGAGG - Intergenic
1039489441 8:37936484-37936506 TTGAGGAAACAGAGGCCTGAGGG + Intronic
1040135961 8:43854100-43854122 CAGAGCCCATTGAGGCCTGAGGG + Intergenic
1040277000 8:46018915-46018937 AAGAGGACATTGAGGCAACATGG - Intergenic
1040324970 8:46337085-46337107 AGGAGGACATTGAGGCAGGCAGG + Intergenic
1040768869 8:50949588-50949610 CCGAGGACATTGAGGCCAGTGGG + Intergenic
1041217058 8:55611258-55611280 ATGAGAAAACTGAGGACTGAAGG - Intergenic
1041433754 8:57815508-57815530 ATGAGGAAATGGAGGTATGAAGG + Intergenic
1043859403 8:85298463-85298485 ATGAAATCTTTGAGGCCTGAAGG - Intergenic
1044388958 8:91626105-91626127 AGGAGGAAATTGAGGCCTAGAGG + Intergenic
1044594426 8:93944021-93944043 GTGAGGAAGTTGATGCCTGAGGG + Intergenic
1047753013 8:127896793-127896815 TTGAGCACATTGGGGCCTGTGGG - Intergenic
1047898504 8:129393857-129393879 AAGAGAAAATTGAGGCTTGAAGG - Intergenic
1048142006 8:131803930-131803952 ATGAGGAAATTGAGCCTTGGAGG - Intergenic
1048197526 8:132344555-132344577 ATGAGGAAACTGAGGCCTGGAGG + Intronic
1048361571 8:133701535-133701557 ATGAGGAAATTGGGGCCTGATGG - Intergenic
1048577539 8:135705028-135705050 ATGAAGAAAATGAGGCCTCAAGG - Intergenic
1049047051 8:140161021-140161043 ATGAGGAAGTTGAGGCTTGGAGG + Intronic
1049216092 8:141409102-141409124 ATGAAGGCAGTGTGGCCTGAGGG + Intronic
1049348957 8:142153907-142153929 ATGAGGAAACTGAGGCCGGGTGG - Intergenic
1049641156 8:143716594-143716616 ATGAGGAAACTGAGGCACGAAGG - Intronic
1050325590 9:4494258-4494280 ATGAGGAAATTGAGGCTTGTAGG - Intronic
1050623700 9:7481323-7481345 ATGAGGAAACTGAGGCATAATGG - Intergenic
1051226516 9:14904983-14905005 TTTGGGAGATTGAGGCCTGAAGG - Intronic
1052046195 9:23797067-23797089 ATTAGGACATTGAAGCATAAAGG - Intronic
1052960176 9:34288966-34288988 ATGAGGGCATTGGAGCTTGATGG + Intronic
1053506575 9:38648588-38648610 AAGAGTACAGTGAGCCCTGATGG + Intergenic
1054943484 9:70769923-70769945 ATGAGGACAAAGAGGCATGGGGG - Intronic
1055033357 9:71792720-71792742 AGGAGGACAGTGAAGGCTGAGGG + Intronic
1055553339 9:77451217-77451239 ATGAGGAAACTGAGGGCTTAGGG - Intronic
1055840787 9:80500585-80500607 ATGAAGACACTGAGGGCTGAAGG + Intergenic
1056037438 9:82621825-82621847 ATGAGGACATTGAGACAGTAAGG - Intergenic
1056506200 9:87260340-87260362 ATGTGGCCTTGGAGGCCTGATGG - Intergenic
1056694064 9:88831495-88831517 ATGAGGAGACTGAAGCCTCAAGG + Intergenic
1057113195 9:92493985-92494007 ACGAGCACACTGGGGCCTGAGGG - Intronic
1057598338 9:96435809-96435831 GTGAGGTCACTGAGGCCTGAAGG + Intergenic
1058205205 9:102097103-102097125 ATGTGTACATTAAGGCCTGTGGG + Intergenic
1058537874 9:105980740-105980762 ATGACAACATTGAGGCACGAAGG - Intergenic
1059504164 9:114782750-114782772 ATGAGGGAAATGAGGTCTGAGGG - Intergenic
1059591203 9:115664492-115664514 ATGAGGAAATTGAGGCTTAGAGG - Intergenic
1059685119 9:116627626-116627648 ATTAGGAAACTGAGGTCTGAAGG + Intronic
1059884595 9:118731716-118731738 TTGAGGCCATTGAGGCTTTAGGG - Intergenic
1060345933 9:122815860-122815882 ATGAGGAAACTGAGGCATGGAGG + Intronic
1061049342 9:128185421-128185443 ATGAGGAAACTGAGGCATAAAGG + Intronic
1061673934 9:132204753-132204775 ATGAGGAAACTGAGGCCAGGAGG + Intronic
1061737898 9:132675169-132675191 ATGAGGAAATTAAGGTCAGAAGG + Intronic
1061908827 9:133712305-133712327 ATGGGGAGACTGAGGCCTGGGGG - Intronic
1062000421 9:134213143-134213165 ATGGGAATATTGAGGCATGAAGG - Intergenic
1062459431 9:136656712-136656734 ATGAGGAAACTGAGGCCCCATGG - Intergenic
1062737390 9:138144802-138144824 ATGAGGACAAGGAGGAATGAGGG - Intergenic
1203381944 Un_KI270435v1:59487-59509 GTGAGCCCATTGAGGCCTGTGGG + Intergenic
1203401396 Un_KI270519v1:103942-103964 GTGAGCCCATTGAGGCCTGTGGG + Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187584362 X:20643546-20643568 ATGAATACATTGAGGTATGAAGG + Intergenic
1187666392 X:21615486-21615508 ATGAAGACATTGAGGTCTAGAGG - Intronic
1188259223 X:28002709-28002731 ATGAGGCCATTTAGGCCTAGAGG + Intergenic
1189003878 X:36974786-36974808 ATGAAGACATTAAAGCATGATGG - Intergenic
1189031150 X:37452350-37452372 GTGAGGAAACTGAGGCCTAAAGG + Intronic
1189045781 X:37589228-37589250 ATGAAGACATTAAAGCATGATGG + Intronic
1189351511 X:40279214-40279236 ATGAAGCCACTGAGGCCTCAAGG + Intergenic
1190641875 X:52488021-52488043 ATGTGAACGTTGAGGCATGAGGG - Intergenic
1190645797 X:52524845-52524867 ATGTGAACGTTGAGGCATGAGGG + Intergenic
1191575748 X:62703294-62703316 AGGAGACCATTGAGGCCTGTGGG - Intergenic
1192203006 X:69078724-69078746 ATGAGGAGACTGAGGCCAGAGGG + Intergenic
1194985195 X:100482502-100482524 ATGCTGACATTGAGGCTTAAGGG - Intergenic
1195652779 X:107302625-107302647 ATGAGTACACTGAGGCTAGAGGG + Intergenic
1196032789 X:111109124-111109146 ATAAGGACACTGAGGCTTAAGGG - Intronic
1196753963 X:119141788-119141810 ATCAGGAAACTGAGGCATGAAGG - Intronic
1197540233 X:127750441-127750463 ATGAGGAAATTGAGGCCTACAGG - Intergenic
1197723155 X:129758655-129758677 ATGAGGCCATTGAGGCCATGCGG - Intronic
1197865636 X:131013914-131013936 CTGAGGAAACTGAGGCCTAAAGG - Intergenic
1198006349 X:132498459-132498481 TTGAGGACATTAAGGCATGATGG - Intergenic
1198632286 X:138654110-138654132 ATGAGGAAACTGAGGCATGGAGG - Intronic
1199966021 X:152821738-152821760 ATGAGCAAACTGAGGCTTGAGGG + Intergenic
1200032434 X:153307240-153307262 ATGAGGAAACTGAGGCCGGGAGG + Intergenic