ID: 1009463167

View in Genome Browser
Species Human (GRCh38)
Location 6:63938250-63938272
Sequence CCTGATAATTAGACTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009463167_1009463171 13 Left 1009463167 6:63938250-63938272 CCAACCACAGTCTAATTATCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1009463171 6:63938286-63938308 CTGCTGCTGCCCATGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009463167 Original CRISPR CCTGATAATTAGACTGTGGT TGG (reversed) Intronic
902188756 1:14745477-14745499 ACTGTTAATTAGAGTGTTGTAGG - Intronic
906763632 1:48405715-48405737 TCTGATGAATAGAATGTGGTAGG - Intronic
907929572 1:58986828-58986850 CCTGATAATGTGACTGTATTTGG + Intergenic
909590539 1:77343681-77343703 CCTCATAATCACACTGAGGTAGG - Intronic
915033366 1:152902857-152902879 CCTGCTAATTAGAGACTGGTGGG - Intergenic
916519018 1:165546559-165546581 CCTGTAAATTAGCCTGTGGAAGG + Intronic
922881658 1:228985745-228985767 CCTCATAATTGGACTGTACTTGG - Intergenic
924620443 1:245655612-245655634 CCTGAGAATGAGCCTGGGGTGGG + Intronic
1064074774 10:12259958-12259980 CCTGAGAATCTGACTGTGTTTGG + Intergenic
1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG + Intergenic
1081290214 11:41315567-41315589 CCTGATCATTTGACTGGGGTTGG - Intronic
1086916582 11:92536780-92536802 CCTGATAAGTGGACTGTGATGGG + Intronic
1089971021 11:122693347-122693369 CCTGACAATAAGTGTGTGGTGGG + Intronic
1096204568 12:49710022-49710044 CCTGATAGTTTGAATGTGGAGGG + Intronic
1097324701 12:58263058-58263080 CCTGCTCATGAGTCTGTGGTTGG - Intergenic
1100180025 12:92074926-92074948 CCTGATACTTAGAATTAGGTTGG + Intronic
1108284586 13:48893926-48893948 TCTGAAAATTAGACTGGGGTTGG + Intergenic
1108434384 13:50387311-50387333 GCTGATATTTAGATTGTGGTGGG + Intronic
1109670621 13:65601999-65602021 ATTGATAATTAAAGTGTGGTTGG + Intergenic
1109974972 13:69819468-69819490 CCTAATAATAAGAATGTGGTGGG - Intronic
1112941539 13:104868045-104868067 CCAGATAATTATACTGTAGAAGG - Intergenic
1113465899 13:110512754-110512776 ACTGATAATCACACTGCGGTAGG + Exonic
1116669681 14:47824681-47824703 CTGGAAAATTAGTCTGTGGTGGG + Intergenic
1118872674 14:69756522-69756544 CCTGATTATAAGCCTTTGGTCGG + Intronic
1121765372 14:96481183-96481205 ACTGCTGATTAGACTGGGGTGGG - Intronic
1122006010 14:98704356-98704378 CCTGATAATTATTCTGTGAATGG + Intergenic
1130565799 15:84993774-84993796 CCAGCTACTTAGACTGAGGTGGG + Intronic
1150704067 17:67472032-67472054 TCTGATCATTAGACTGCAGTTGG + Intronic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1156576645 18:38324634-38324656 ACTGATCCTAAGACTGTGGTTGG + Intergenic
1158317548 18:56228285-56228307 GCTGATAATAAGATTGGGGTAGG + Intergenic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1164928053 19:32145932-32145954 TCTGAAAATTAGACTGTCATTGG + Intergenic
925368819 2:3328872-3328894 CGAGATCATTAGAGTGTGGTGGG - Intronic
925368938 2:3329386-3329408 CGAGATCATTAGAGTGTGGTAGG - Intronic
931206422 2:60149848-60149870 CCTGAAAGTCAGACTGTGCTGGG - Intergenic
931921001 2:67015705-67015727 AATGATAATTAGACTTGGGTAGG - Intergenic
933154787 2:78961360-78961382 CCTGAAAAGTTGACTGGGGTTGG + Intergenic
937965677 2:127507079-127507101 CTTGAAAATTGGTCTGTGGTAGG - Intronic
938035630 2:128032629-128032651 CCAGGTAATTACACTTTGGTGGG + Intergenic
938309490 2:130278815-130278837 GCTGATAATTAGGCTGTGAGTGG - Intergenic
938445433 2:131373549-131373571 GCTGATAATTAGGCTGTGAGTGG + Intergenic
939362874 2:141196456-141196478 ACTGAAAATTAGATTGTGGGAGG - Intronic
940102607 2:150059015-150059037 TTTGTTAAGTAGACTGTGGTAGG + Intergenic
940318398 2:152348588-152348610 CCTTATCACTTGACTGTGGTAGG + Intronic
941487614 2:166101637-166101659 CCTGTTAAATAAACTGTGCTGGG + Intronic
942713386 2:178863965-178863987 CCTCATGATGAGACTGTGTTTGG - Intronic
943489273 2:188530240-188530262 CCTCAGAATGAGACTGTGGTTGG - Intronic
945505190 2:210631218-210631240 CCTGATAATTAGAATGCTGCAGG + Intronic
947759810 2:232595745-232595767 TCTCATGATTAGACTGGGGTTGG - Intergenic
948269921 2:236666393-236666415 CCTGGGAATATGACTGTGGTGGG + Intergenic
1170530765 20:17288557-17288579 CCTCAGAATTAGACTGTAATTGG + Intronic
1176922123 21:14700315-14700337 CCTGATAAGTAAACTGAAGTTGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184192629 22:42904934-42904956 AGTGCTCATTAGACTGTGGTGGG - Intronic
1184636079 22:45832734-45832756 CTTGATATTTAGACTGGCGTTGG - Intronic
949313863 3:2729987-2730009 CCTGATAATTAGAATCCAGTAGG + Intronic
952207751 3:31197661-31197683 ACTGATAATGAGCCTGTGCTTGG + Intergenic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
957025342 3:75175062-75175084 GCTTATAATTATACTGTGGCTGG + Intergenic
960240668 3:115338277-115338299 ACAGAAATTTAGACTGTGGTAGG + Intergenic
960408252 3:117288475-117288497 GCTGATAAATAGGATGTGGTAGG - Intergenic
963654875 3:148034251-148034273 CCTGATAACTATCCTATGGTAGG + Intergenic
964433945 3:156633000-156633022 CCTGATTAGTAGATTGTGGTGGG - Intergenic
965591549 3:170364619-170364641 ACTAATAATTAGACTGGGGCGGG - Intronic
967388927 3:188936590-188936612 CCTTATATTGAGACTGTTGTAGG + Intergenic
973896118 4:55414834-55414856 CCTGATGGTTAGATTGAGGTAGG + Intronic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
977874523 4:102132594-102132616 CTTGATAAGTAAACTGTTGTTGG - Intergenic
983576544 4:169267305-169267327 CCTGTTAATTAGACTAGGGAAGG - Intronic
984538412 4:181005444-181005466 GCTGATAATTAGACTCATGTGGG - Intergenic
986065549 5:4230620-4230642 CCCCATAATAAGACTGTTGTGGG - Intergenic
986702521 5:10424843-10424865 CCAGATAATTTGATTGTTGTGGG + Intronic
990862457 5:60341870-60341892 CATGTTGATTAGACAGTGGTGGG - Intronic
993526072 5:88967438-88967460 CCTAATATTTCAACTGTGGTAGG - Intergenic
994459015 5:100050258-100050280 GCTGATAATTAGGCTGTGGGTGG + Intergenic
996866461 5:128129284-128129306 GCTGATAATTATACTATTGTAGG + Intronic
997026531 5:130069185-130069207 CATCATACTTAGCCTGTGGTCGG + Intronic
1003479943 6:6521544-6521566 CCTGCTAATTAGTCTGAGGGAGG + Intergenic
1004022656 6:11788991-11789013 CCTGAAAGTTTGGCTGTGGTGGG - Intronic
1004419263 6:15453508-15453530 GCTGATCATTCGACTGTGGTGGG + Intronic
1006809790 6:36812482-36812504 CCTGCTTAGTGGACTGTGGTAGG - Intronic
1008893582 6:56525122-56525144 CTTGAGAAGTTGACTGTGGTTGG - Intronic
1009463167 6:63938250-63938272 CCTGATAATTAGACTGTGGTTGG - Intronic
1010105972 6:72168465-72168487 CCTGATTATTAGTTTGGGGTGGG + Intronic
1011768708 6:90652421-90652443 CTTAGTAATAAGACTGTGGTTGG + Intergenic
1011834850 6:91419506-91419528 CCTGAATATTAGACCTTGGTTGG - Intergenic
1012292221 6:97470945-97470967 CCTTCTAATAACACTGTGGTGGG - Intergenic
1013703337 6:112800442-112800464 GCTGATAATCCGACTGGGGTTGG - Intergenic
1021474064 7:21040894-21040916 CTGGGTAATTAGACTGTAGTAGG - Intergenic
1024334629 7:48194962-48194984 CCAGACTATTAGACTGTAGTGGG + Intronic
1038888390 8:31691027-31691049 CTTGAGAATGAGACTGAGGTTGG + Intronic
1041345305 8:56890757-56890779 CCTCAAGATTAGACTGGGGTTGG - Intergenic
1041726855 8:61026082-61026104 CCTCAGAATGAGACTGTGTTTGG + Intergenic
1044105370 8:88198429-88198451 TGTGATAAATAGACTGAGGTAGG - Intronic
1044470949 8:92566756-92566778 CCTGAAAATTAGTCTGTCCTGGG + Intergenic
1044844108 8:96363437-96363459 CTGGATATTTGGACTGTGGTGGG - Intergenic
1046538460 8:115547835-115547857 CCTGAGAACTAAACTGTGCTGGG + Intronic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1052251603 9:26404974-26404996 CCAGATAATCAGAAGGTGGTAGG - Intergenic
1057347084 9:94260347-94260369 CCTAATAACTGGACTGAGGTTGG - Intronic
1057477198 9:95412686-95412708 GCTGATAATGAGGCTGCGGTGGG + Intergenic
1061710156 9:132481717-132481739 CCTGTTAATAAGGCTGGGGTCGG - Intronic
1202630272 M:10842-10864 GCTAATAATTAGGCTGTGGGTGG - Intergenic
1190373721 X:49767518-49767540 CCTGAGCATTAAACTGTGCTTGG - Intergenic
1192381643 X:70622905-70622927 CATGATAATTGTAGTGTGGTTGG - Intronic
1193648658 X:84101824-84101846 CCTGATTATTACATTCTGGTTGG + Intronic
1194226440 X:91265424-91265446 ACTGATTATTAGACTTTTGTTGG + Intergenic