ID: 1009463745

View in Genome Browser
Species Human (GRCh38)
Location 6:63945555-63945577
Sequence ACTTTTGCATATGTGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4472
Summary {0: 1, 1: 0, 2: 3, 3: 98, 4: 4370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009463745 Original CRISPR ACTTTTGCATATGTGTGGTG AGG (reversed) Intronic
Too many off-targets to display for this crispr