ID: 1009465663

View in Genome Browser
Species Human (GRCh38)
Location 6:63965749-63965771
Sequence CCTTGGTATTTGTAAGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009465655_1009465663 28 Left 1009465655 6:63965698-63965720 CCTGATTTTCATAAAAACATAAA 0: 1
1: 0
2: 9
3: 122
4: 975
Right 1009465663 6:63965749-63965771 CCTTGGTATTTGTAAGATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 203
1009465658_1009465663 0 Left 1009465658 6:63965726-63965748 CCATAGTTTGGCTTTTGGACCTT 0: 1
1: 0
2: 0
3: 25
4: 189
Right 1009465663 6:63965749-63965771 CCTTGGTATTTGTAAGATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009465663 Original CRISPR CCTTGGTATTTGTAAGATCT GGG Intronic
900439219 1:2645023-2645045 TCTTGGTCTTTGAAAGGTCTTGG - Intronic
901674079 1:10872826-10872848 CCGTGGAATTAGGAAGATCTCGG - Intergenic
901876080 1:12167653-12167675 CCCTGGTATTTCTAAGAAATCGG - Intronic
902308586 1:15562946-15562968 CCTAAGGATTTGTAAAATCTAGG - Intronic
903456390 1:23490046-23490068 CCATGGCATTTGTAAGCTGTCGG + Intergenic
905012535 1:34757055-34757077 CACTGGTATTGGTAAGAGCTGGG + Intronic
908826758 1:68140890-68140912 CCTTGGCATTAGTAAGATTTTGG - Intronic
909955936 1:81778876-81778898 CGTTTGTAGTTGTATGATCTTGG + Intronic
910771633 1:90836931-90836953 CCTTGGCATTTTAAAGATCCAGG + Intergenic
911181679 1:94866381-94866403 CCTTGGTCCTTGTGGGATCTGGG - Intronic
911835445 1:102613163-102613185 CTTTGGTATTTGTTTGCTCTTGG - Intergenic
913448165 1:118972031-118972053 CCCTTGTATTTGTACAATCTTGG + Intronic
914976296 1:152366378-152366400 CATTGGAATCTGAAAGATCTGGG + Intergenic
915263593 1:154697742-154697764 CCATTGGATTTGTAAGATCCAGG - Exonic
917484642 1:175444557-175444579 CCATGGTATTTGTTAATTCTGGG - Intronic
919002527 1:191851434-191851456 CCTTGGTATCTGTCAGAGATTGG - Intergenic
919169229 1:193932709-193932731 CCTTGGTATATGTAATAGCTAGG + Intergenic
919177662 1:194038471-194038493 TCTTTGTATTTTTAAGATTTTGG + Intergenic
924386662 1:243505155-243505177 CCCTGCTATGTGTAAGAGCTAGG + Exonic
924710569 1:246527382-246527404 CCTTGTTATTTGTTCTATCTTGG + Intergenic
1063016735 10:2085397-2085419 CCTTGGTCTTTCAAAGTTCTGGG + Intergenic
1064780175 10:18828588-18828610 CTGTGGTATTTCTAAAATCTTGG + Intergenic
1064853801 10:19741849-19741871 TCTTAATGTTTGTAAGATCTGGG - Intronic
1071013363 10:80965488-80965510 CCTGGGTCTTTTTATGATCTGGG + Intergenic
1071583980 10:86801389-86801411 CCTTGGTCTCTGAAAGTTCTGGG + Intronic
1074140374 10:110667221-110667243 CCTTGGGATTCTTAGGATCTTGG - Intronic
1078435575 11:11322226-11322248 CCTTTCTAGTTGTAAAATCTTGG - Intronic
1078465137 11:11544556-11544578 CCTTTTTATTTTTAAGTTCTAGG + Intronic
1078798600 11:14619778-14619800 CCTTGTTATGTGTAATTTCTAGG + Intronic
1079879346 11:25905114-25905136 CTTTGGGATTTGTTTGATCTTGG + Intergenic
1080223012 11:29928531-29928553 TCTTGGTCTTTGAAAGATTTGGG - Intergenic
1080474222 11:32574751-32574773 CCTTGGTGGTGATAAGATCTTGG + Intergenic
1080707524 11:34711951-34711973 CCTCTGTATATGTAAGCTCTGGG + Intergenic
1083030907 11:59591374-59591396 CTTTGGTATTTGTGAGAGATTGG + Intronic
1086032236 11:82374052-82374074 CCTTGGTAGTTTTATGATCCTGG + Intergenic
1087679067 11:101198751-101198773 ACTTGGTATCTATAAGACCTTGG - Intergenic
1088028561 11:105217602-105217624 CCTTAGTATCTGTGTGATCTTGG + Intergenic
1090980886 11:131720788-131720810 ACTTACTATCTGTAAGATCTTGG + Intronic
1091595199 12:1873776-1873798 CCTGGCTTTTTGTAAGCTCTGGG - Intronic
1092492368 12:8956928-8956950 CCTTGGTGGGTGTGAGATCTGGG + Intronic
1092929849 12:13305585-13305607 CCTGGAAATTTGTAAGGTCTTGG - Intergenic
1095237752 12:39818658-39818680 CCTTGGTATTTATAAAAACTTGG - Intronic
1095797177 12:46232677-46232699 CCTTGGTATTTGTAGGGGATTGG + Intronic
1097417625 12:59331815-59331837 CCTAGGTTTTTGTGGGATCTTGG + Intergenic
1097598267 12:61661362-61661384 CTTTGGGATTTGTATGCTCTTGG + Intergenic
1098208907 12:68141718-68141740 CCTCTGTATTTGTTTGATCTTGG - Intergenic
1098232006 12:68380998-68381020 CCTTGGTTTTTATTAGATCATGG - Intergenic
1098593954 12:72248816-72248838 CCTTGGTAGATGTGAAATCTAGG + Intronic
1099054324 12:77819588-77819610 CCACTGTATTTGTAAGATTTAGG - Intergenic
1100111698 12:91252220-91252242 CCTTGTTATTTGCAATATCAGGG - Intergenic
1100288875 12:93194461-93194483 AATTGGTATTTGTGTGATCTTGG - Intergenic
1106368257 13:29105148-29105170 CTTTGGAATTTTTCAGATCTTGG - Intronic
1106480984 13:30136589-30136611 ACTTGTTATCTGTAAGATCTTGG - Intergenic
1108992435 13:56677491-56677513 CCCTGGTTGTTGTAAGATTTTGG + Intergenic
1109921120 13:69060793-69060815 TTTTGGTATTTTTAAGATCAAGG + Intergenic
1111243867 13:85509132-85509154 CCTTGGCAGTTGTGGGATCTGGG + Intergenic
1111485830 13:88896724-88896746 CCTTGGCAGTTGTGGGATCTGGG + Intergenic
1114352527 14:21869185-21869207 CCTTGGTATAAGCAAGAACTTGG + Intergenic
1115009378 14:28525691-28525713 CCATGGTATTGGTAAGAGCAGGG + Intergenic
1115751558 14:36498406-36498428 CCTTCGTCTTTGTAAGACCTTGG - Intronic
1116207038 14:41881928-41881950 CTGTGGTAATTGTAATATCTGGG + Intronic
1119393774 14:74310495-74310517 ACTTGGTATTTGTGTGACCTTGG + Intronic
1120525278 14:85569919-85569941 TAGTGGTATTTGTAAGATGTTGG + Intronic
1126762523 15:51982095-51982117 CCTTTCTATTTGTAAAATTTTGG - Intronic
1128286551 15:66441767-66441789 CCTCTGTATATGTAAGAACTAGG - Intronic
1129020766 15:72515387-72515409 CTTTGATAATTGTAATATCTGGG + Intronic
1131714163 15:95090431-95090453 CCTTAGTATTTGCAAGTCCTTGG + Intergenic
1133241191 16:4415703-4415725 CCGTGTTATTTGTAAGGCCTGGG - Intronic
1138882935 16:61038147-61038169 CCTTGATTATTATAAGATCTAGG + Intergenic
1139088377 16:63616450-63616472 CCTTGGCAGTTGTGGGATCTGGG - Intergenic
1139768104 16:69249528-69249550 CCTTGGTCTTTGTTAAAACTTGG + Intronic
1144126674 17:12209375-12209397 TCTTGGAATTGGTGAGATCTTGG + Intergenic
1146934790 17:36806400-36806422 CCTTGGTATCTGTGAGAGGTTGG - Intergenic
1149344955 17:55725452-55725474 CTTTGCTTTTTGAAAGATCTGGG - Intronic
1157807437 18:50668534-50668556 TCTTGGTCTTTGCAAGGTCTAGG + Intronic
1158339797 18:56453522-56453544 CATTGGCATTTGTCATATCTCGG + Intergenic
1158680473 18:59562018-59562040 CCTACGTACTTGTTAGATCTGGG - Intronic
1158726319 18:59976094-59976116 CAATGTCATTTGTAAGATCTGGG - Intergenic
1159154458 18:64564868-64564890 TCTGGTTATTTGTATGATCTTGG + Intergenic
1159331881 18:67005444-67005466 CCTGGGTAATTGGAATATCTGGG + Intergenic
1159984802 18:74829421-74829443 CTTACCTATTTGTAAGATCTTGG + Intronic
1163646506 19:18492685-18492707 CCTTGGTAGTTGAGAGGTCTGGG - Intronic
1166956364 19:46468141-46468163 CCCTGGCATTTGGAAGAGCTGGG - Exonic
1167615907 19:50533456-50533478 CTTTGGTATTTGTATTATTTGGG - Intronic
1167933150 19:52884700-52884722 CCTTGGTCTTTGAAAGTGCTAGG + Intronic
925314087 2:2908033-2908055 CCTTGGTGGTTGTAGGAGCTGGG + Intergenic
925492262 2:4407842-4407864 ATATGATATTTGTAAGATCTAGG + Intergenic
926893753 2:17661521-17661543 CATTGGTAAATGTAAGAACTTGG - Intergenic
927464237 2:23325054-23325076 CCTTCCCATTTGTAAGAACTCGG + Intergenic
928308115 2:30187953-30187975 GCTTGGAGTTTGTTAGATCTAGG + Intergenic
931724593 2:65096485-65096507 CATTGGTGTTTATAAGATTTGGG - Intronic
932140444 2:69272811-69272833 CATTAGTATTTGTATGATATTGG + Intergenic
933733897 2:85479669-85479691 CCTTGGCATTTTTAACTTCTGGG - Intergenic
934962501 2:98689521-98689543 CCTTCTTATTTATAATATCTGGG - Intronic
935537896 2:104315793-104315815 CCTTGTTATTTGTAATATCCTGG + Intergenic
936246863 2:110836148-110836170 CCATGGAATCAGTAAGATCTGGG + Intronic
939642620 2:144659558-144659580 CCTTAGCATCTGTATGATCTGGG - Intergenic
941145918 2:161845362-161845384 ACTTGATATTTGTAACATGTGGG + Intronic
942117989 2:172747972-172747994 CCTTGGTATTTGTGACAACATGG - Intronic
943179294 2:184523797-184523819 CCTTGGTAAATGTGGGATCTGGG - Intergenic
945103992 2:206290906-206290928 CCTTGGTTTTTTTTGGATCTTGG + Intronic
945711710 2:213305420-213305442 CCTTGTTATGTTTCAGATCTTGG + Intronic
948532275 2:238616900-238616922 GCTGGGTATTTGCAAGTTCTTGG + Intergenic
1170717407 20:18843936-18843958 CCTTGGCATTTGAAAGTGCTTGG - Intergenic
1172751890 20:37257007-37257029 CCTTGGTTTTTGGAAGCTGTGGG + Intronic
1173676407 20:44839429-44839451 CATTGGTATTTGGCAGAGCTTGG - Intergenic
1174529520 20:51199800-51199822 AATTTGTATGTGTAAGATCTGGG - Intergenic
1174975548 20:55329131-55329153 CTTGCGTATTTGAAAGATCTTGG + Intergenic
1176975954 21:15322337-15322359 TCTTGGTATTTGTAGGTACTCGG + Intergenic
1178353599 21:31892038-31892060 ACTTGGTATCTGTGTGATCTTGG + Intronic
1179400203 21:41076271-41076293 CCTTGGCAGGTGTGAGATCTGGG + Intergenic
1182656605 22:31895285-31895307 CCTTGGCACTTGTGACATCTTGG - Intronic
949613867 3:5732225-5732247 TCTTTGTATTTATAAGACCTAGG + Intergenic
951240432 3:20280400-20280422 CCTTGGTATTTCCAAGATGCCGG + Intergenic
952589910 3:34939403-34939425 CATTGGTATTTGTGAGAAATCGG - Intergenic
953635510 3:44660545-44660567 CCTTGGTATTGTAAAGATCTGGG + Exonic
954643437 3:52116124-52116146 CCTGTGGATTTTTAAGATCTGGG - Intronic
955707061 3:61738430-61738452 CTTTGGTATTTGAAAGAAATAGG - Intronic
955762964 3:62308694-62308716 CCTTAGTATGAGTAAGTTCTTGG - Intergenic
955851343 3:63223379-63223401 CCCTGGTAGTGGTAAGATTTTGG + Intergenic
956247007 3:67195080-67195102 ACTTAGTAGTTGTTAGATCTTGG - Intergenic
956507679 3:69960163-69960185 CCTTAGTATTTGTAGGGTCCGGG + Intronic
956508573 3:69969872-69969894 CCTTGCTGTTTGTAAGACCTAGG + Intergenic
959923219 3:111892733-111892755 CTTTGGTTTTTGTACGACCTTGG - Intronic
960013529 3:112859521-112859543 CTTAGTTATTTGTAATATCTAGG - Intergenic
960376630 3:116910255-116910277 ATTTGGTATTTGTAGCATCTGGG + Intronic
960422055 3:117458900-117458922 ATTTGGCATTTATAAGATCTAGG - Intergenic
962038434 3:131679470-131679492 CTTTGGGATTTGTTTGATCTTGG + Intronic
962069259 3:132016302-132016324 CTTTGATTTTTGTAAGATCTAGG - Intronic
964639853 3:158897434-158897456 CTTTTATATTTGTAAGAACTAGG + Intergenic
967096761 3:186183575-186183597 CCTTGGAATCTGAAAGGTCTAGG + Intronic
970719869 4:18973983-18974005 CATTTGTATTTGTTAAATCTGGG + Intergenic
970947993 4:21717496-21717518 CCTTTGTTTTTGTAAGAATTTGG + Intronic
972354854 4:38270957-38270979 TCTTGGTATTGTTAAGATTTAGG - Intergenic
972567144 4:40279781-40279803 CCTTGGTATTTGTAGGGGATTGG + Intergenic
974194023 4:58547610-58547632 CTTTGGAATTTGTAAAACCTGGG + Intergenic
974240262 4:59237706-59237728 GCTTTGTTTTTGTAAGATGTTGG + Intergenic
975151434 4:71026276-71026298 CTTTGTTATTAGTCAGATCTTGG + Intronic
975675544 4:76824143-76824165 CCTTGGTAAATGTATAATCTTGG - Intergenic
978115108 4:105010135-105010157 CTTTGGTATTTGTTTGCTCTTGG + Intergenic
978442818 4:108751679-108751701 CCTTAGTAATTGTATGACCTTGG + Intronic
979207960 4:118063784-118063806 ACTTACTAGTTGTAAGATCTTGG - Intronic
979589898 4:122466000-122466022 CCTTAGGATTTCTAAGAACTTGG + Intergenic
980397968 4:132240176-132240198 CCATAGTAATTATAAGATCTGGG + Intergenic
980738404 4:136919032-136919054 CCTTGGCAGATGTAAGATCCAGG + Intergenic
981171005 4:141623346-141623368 CCTTGGTGTGTGTAATAGCTAGG - Intergenic
981704286 4:147642579-147642601 CCTTGGTTATTGTAACCTCTAGG + Intronic
981974102 4:150702643-150702665 ATTTGGGATTTGTAAGAACTAGG - Intronic
982823211 4:159970220-159970242 CCTTGGTATTTGTTTGCTGTGGG + Intergenic
983338726 4:166429745-166429767 CGTTAGTATTTGTAAGACCCTGG + Intergenic
983611555 4:169651445-169651467 TCTTGGTATTTGTGAGAGTTTGG + Intronic
984526571 4:180865907-180865929 TCTTGGCAGTTGTAGGATCTAGG - Intergenic
985441157 4:189983359-189983381 CCTTCTCATTAGTAAGATCTGGG - Intergenic
986377938 5:7151434-7151456 CCTTGCTATTTTTCAGATCTGGG - Intergenic
986902934 5:12459373-12459395 CCTTGATATTGAAAAGATCTAGG + Intergenic
987595014 5:19986774-19986796 ACAAGGTATATGTAAGATCTAGG + Intronic
987728739 5:21739563-21739585 CCTTGGTATTTGTAGGGGATTGG - Intergenic
989544005 5:42651301-42651323 CCTTGGAATTTACAAGATGTTGG - Intronic
990535107 5:56713825-56713847 CCATGGTATGTTTAAAATCTAGG - Intergenic
990849110 5:60181452-60181474 CCTTGGTGTTTGGAAGACATAGG - Intronic
992985440 5:82224307-82224329 CCTGGGTATTTGTGACCTCTAGG - Intronic
993480301 5:88416167-88416189 CTTTGGTAGTTGTAGGACCTTGG - Intergenic
997844043 5:137269844-137269866 CCTTGGTATTGGTAGGGTGTTGG - Intronic
999198632 5:149800463-149800485 TCTTTGGATTTGGAAGATCTGGG + Intronic
1003205347 6:4004626-4004648 CTTTGGTATCTGTAAGAGATTGG + Intergenic
1003439132 6:6123022-6123044 CCTTGGTAGGTGTGGGATCTGGG + Intergenic
1003981616 6:11395446-11395468 ACTTAGTAGTTGTTAGATCTTGG + Intergenic
1005240428 6:23819119-23819141 CTTTGGTATTAGTATGATGTTGG - Intergenic
1007018343 6:38492321-38492343 CCATGCTATTTCTATGATCTTGG + Intronic
1009465663 6:63965749-63965771 CCTTGGTATTTGTAAGATCTGGG + Intronic
1010601974 6:77839965-77839987 CCTTGGTCATTTTAATATCTGGG - Intronic
1010624856 6:78125532-78125554 ACTTGGTATCTGTAGGATATTGG + Intergenic
1010847024 6:80721036-80721058 CCTTGGCAGGTGTGAGATCTGGG + Intergenic
1011792372 6:90912337-90912359 CCTTGGTGTGTCTAAGATCTGGG - Intergenic
1014296105 6:119619940-119619962 ACTTGGGATTTTTAAAATCTAGG + Intergenic
1014371358 6:120612832-120612854 ACTTATTATTTGTAAGATTTAGG - Intergenic
1014776876 6:125521120-125521142 CCTTTCAATGTGTAAGATCTGGG + Intergenic
1014977273 6:127902968-127902990 CCTAGGTAATTGTAAGAGATTGG - Intronic
1015215814 6:130749122-130749144 CCTTGGTGGGTGTGAGATCTGGG - Intergenic
1016313148 6:142756524-142756546 CCTTGTTATCTGTGTGATCTTGG - Intronic
1021990556 7:26137499-26137521 CCTTGCTATTACTAACATCTAGG - Intergenic
1022137577 7:27463759-27463781 CCTCGGAATTTCTAAGATTTGGG + Intergenic
1028054411 7:86225208-86225230 CCTTGGCAGGTGTAAGATTTAGG - Intergenic
1030334440 7:108309373-108309395 TCTTGGTTTTTATAAGTTCTAGG + Intronic
1031251215 7:119383801-119383823 CCCTGCTATATGTAAGATATAGG + Intergenic
1033053062 7:138023974-138023996 CATTGGAATTTGGAAGATCATGG + Intronic
1033473719 7:141670947-141670969 CCTTGGTATTTGCAGGGCCTTGG - Intronic
1036137173 8:6173123-6173145 CCTTGCTTTGTGTAAGTTCTGGG + Intergenic
1036548625 8:9797148-9797170 CTGTGATATTTGTAAAATCTTGG - Intergenic
1038633750 8:29269133-29269155 CATTGCTATTAGTGAGATCTAGG - Intergenic
1040088828 8:43374249-43374271 CCTTGGTGTGTGTAATAGCTAGG + Intergenic
1040809251 8:51432355-51432377 TCTTGCTATTTGGATGATCTAGG + Intronic
1043466236 8:80510095-80510117 CCTTGGTATCCTTAAGATTTTGG + Intronic
1044165725 8:88981679-88981701 CCTAAGTACTTGTAACATCTTGG - Intergenic
1048125461 8:131630126-131630148 CCATGGTGTTTGGAAGGTCTAGG - Intergenic
1049084453 8:140467780-140467802 TTTTGGTTTTTGTACGATCTCGG + Intergenic
1049394265 8:142391822-142391844 CCTTGGCATGTGTGGGATCTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1056860965 9:90181312-90181334 CCTTGGTGTTTGTGAGAGATTGG + Intergenic
1057924418 9:99131299-99131321 CCTTTGTATATGAAAAATCTTGG - Intronic
1058124993 9:101181544-101181566 CCTAGGTAGTTTTAATATCTTGG - Intronic
1058636398 9:107042515-107042537 CCTTGGTGGTTGTAAGACTTTGG - Intergenic
1058743316 9:107965864-107965886 CCTTTGTAACTGTATGATCTTGG + Intergenic
1059078210 9:111217850-111217872 ACTTACTTTTTGTAAGATCTTGG - Intergenic
1059560219 9:115327438-115327460 CTTTTGTTTTTGTAAGAACTTGG - Intronic
1059998687 9:119938849-119938871 CCTTGGTGTTTGCCAGACCTAGG - Intergenic
1060606465 9:124918945-124918967 CTTTTGTATTTGAAAAATCTAGG + Intronic
1062594660 9:137293903-137293925 CCTTGGGAGTTGAAAGAGCTGGG + Intergenic
1187085216 X:16035576-16035598 CCTGGGTATTTGTAAATTCTAGG - Intergenic
1187694361 X:21903563-21903585 CCTTGGTCTTTCCAAGTTCTGGG + Intergenic
1190523798 X:51308017-51308039 CTTTGGGATTTGTTTGATCTTGG + Intergenic
1191706414 X:64098803-64098825 TGTTGGTAATAGTAAGATCTAGG + Intergenic
1191844422 X:65535828-65535850 CCTTGGTATTTTGGAGTTCTGGG + Intergenic
1197565764 X:128083981-128084003 TCTTGGTATCTGTAATAGCTTGG - Intergenic
1198110521 X:133498756-133498778 CCTTGGTGTTGGTCAGAACTAGG + Intergenic
1198880230 X:141273037-141273059 TCTTGGTTTTTGTAAGTTTTAGG + Intergenic