ID: 1009467521

View in Genome Browser
Species Human (GRCh38)
Location 6:63990556-63990578
Sequence GTTCTCAGTGATCCCCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009467521_1009467524 -7 Left 1009467521 6:63990556-63990578 CCACATTGGGGATCACTGAGAAC 0: 1
1: 0
2: 2
3: 8
4: 123
Right 1009467524 6:63990572-63990594 TGAGAACAAAGGTGATGGTTTGG 0: 1
1: 1
2: 1
3: 21
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009467521 Original CRISPR GTTCTCAGTGATCCCCAATG TGG (reversed) Intronic
902197205 1:14806491-14806513 GCTCTCAGAGAACACCAATGAGG + Intronic
905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG + Intergenic
905320463 1:37113075-37113097 GATCTCACTGATCCCAAATGTGG + Intergenic
905883783 1:41480985-41481007 GTTCTCTTTGCTGCCCAATGAGG + Intronic
906835600 1:49080444-49080466 GCCCTCACTGATCCCCAGTGAGG + Intronic
907226830 1:52955587-52955609 GTTGGCAGTGATCCCACATGAGG - Intronic
908065019 1:60393429-60393451 GTGCTCAGTGACCCCCAAAGTGG - Intergenic
908456964 1:64313449-64313471 GATCTCAGTGACCCTGAATGGGG + Intergenic
911163605 1:94706038-94706060 GCTCTCAGAGCTCCCCAGTGGGG + Intergenic
912526024 1:110283272-110283294 GTTGAAACTGATCCCCAATGTGG - Intergenic
913487317 1:119343567-119343589 GTTTTCAGTGATTCCAAATTAGG + Intergenic
918354220 1:183690980-183691002 AATCTCAGTGAACCCCAATCAGG - Intronic
922195913 1:223360421-223360443 GGTCTCAGTGGCCCCAAATGAGG + Intronic
922601231 1:226855919-226855941 GCTTTCAGTGATTCCCAATTAGG - Intergenic
1065169547 10:23012659-23012681 CTTCTCATTTATCCCCAATATGG + Intronic
1066500093 10:35984492-35984514 GTGCTCAGAGCTCCCCATTGAGG - Intergenic
1066661485 10:37741390-37741412 GTTCACAGTGATGCCGAGTGAGG + Intergenic
1069662121 10:70130777-70130799 ATTCTCTGTGATTCCCACTGGGG - Intronic
1071447731 10:85764408-85764430 GTCCTCAGTGAAGCCCAAAGTGG + Intronic
1073518787 10:104105129-104105151 TGACTCAGTGATCCCTAATGTGG + Intergenic
1074428251 10:113370952-113370974 GTTCTCAGAGCTCACCAAGGAGG - Intergenic
1077118160 11:894716-894738 GTTCTCACTGAGCCCCACAGAGG - Intronic
1077405452 11:2380534-2380556 GTTCTCACTGGCCCCCAAAGCGG - Intronic
1078917729 11:15795702-15795724 ATTCTCAGTGATACTCCATGTGG + Intergenic
1080236371 11:30073053-30073075 GTTCTCTGTGATGGCAAATGAGG + Intergenic
1080757830 11:35219209-35219231 CTTCTCAGTGATTCAGAATGTGG + Intronic
1083042898 11:59705403-59705425 GTTTTCAGTGATCCCCGATGGGG - Intergenic
1092740383 12:11623064-11623086 GTTCTCAGTGGTGCCAAATCAGG - Intergenic
1101225778 12:102686924-102686946 TTTCGCAGTGACCCACAATGGGG + Intergenic
1102433730 12:112903918-112903940 GTTTTCAGTGATTCCAAATTAGG + Intergenic
1103170219 12:118811609-118811631 GTACTCAGTCATTCCAAATGGGG - Intergenic
1104635254 12:130434525-130434547 TTTTTCAATTATCCCCAATGAGG + Intronic
1106020925 13:25914770-25914792 CTTCGCAGTGCTCCCCCATGGGG + Intronic
1108509667 13:51145158-51145180 GTTTTCAGTGATTCCAAATTAGG - Intergenic
1109987158 13:70002604-70002626 AATCTCAGTGAACCCCAATCAGG + Intronic
1112618258 13:101027497-101027519 GTTGTCTGTGATCCTCAAAGAGG + Intergenic
1113768827 13:112895922-112895944 GTTCTTGGGGATACCCAATGTGG - Intronic
1114967715 14:27983854-27983876 GTTCTCAGTGATCCCAGACCTGG + Intergenic
1115910770 14:38254962-38254984 GTGCTCTGTGATCCCCATCGAGG + Exonic
1121228216 14:92337183-92337205 GTTCTCAGTAATCCACAGTTGGG + Intronic
1135001927 16:18783956-18783978 GTTCCCTGTGATCCCAGATGAGG - Intronic
1135173170 16:20204492-20204514 TTTCTCAGTCATCCCAAATTGGG + Intergenic
1135285088 16:21186442-21186464 GGTCTCATTGTTCCCCAGTGTGG - Intergenic
1135994444 16:27237674-27237696 GTTCTCAGTGATACCCAGGAGGG - Intronic
1138211223 16:55164816-55164838 GTTCTCACTGCTTCCCACTGTGG + Intergenic
1139327414 16:66163213-66163235 TTTTTCAGAGAGCCCCAATGGGG - Intergenic
1139744702 16:69064961-69064983 GTACTCAGTGATCACATATGGGG - Intronic
1140077040 16:71709751-71709773 GGCCTCAGTGATTCCTAATGGGG + Intronic
1140676759 16:77339762-77339784 GGTCTTAGGGATTCCCAATGAGG - Intronic
1140838709 16:78819227-78819249 GTCTTCAGTGACCCCCAGTGAGG + Intronic
1142852427 17:2710756-2710778 GCTCCCAGCGATCCCCCATGGGG - Intronic
1143952236 17:10642552-10642574 CTTCTCACTGATCCACTATGCGG - Exonic
1144803609 17:17949095-17949117 GTTCTCAGGGACCCTCCATGTGG + Intronic
1147466564 17:40615544-40615566 GTTCTCAGAGCTCCCCCAGGTGG + Intergenic
1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG + Intergenic
1154169647 18:12041819-12041841 GTTCTCAGTGATGCCAAATTAGG + Intergenic
1157260512 18:46172734-46172756 GTTCTCTGTGATTCTCAGTGAGG + Intergenic
1158880421 18:61773964-61773986 ATTTTCAGACATCCCCAATGTGG + Intergenic
1163333605 19:16657542-16657564 ATTCTCATTGATTCCCTATGTGG + Intronic
1166204686 19:41261941-41261963 GTTCTCAGAAACCCCCAGTGAGG + Intergenic
1167660969 19:50795846-50795868 TTACTCAGTGAGCCTCAATGTGG + Intergenic
926509221 2:13752628-13752650 GTTTTCAGTGATTCCAAATTAGG - Intergenic
929668152 2:43849784-43849806 GTTCTCAGGGATCTTAAATGAGG + Intronic
930444112 2:51449551-51449573 GTTCTCAGTGATGCCAAGTCAGG - Intergenic
930498962 2:52186307-52186329 GTTTTCAGTAATACACAATGAGG + Intergenic
932138726 2:69256021-69256043 GTTCTGAGTATTCCCCAATTTGG - Intergenic
932627499 2:73309197-73309219 GTTCACAGTCTTCTCCAATGAGG + Intergenic
935036555 2:99381383-99381405 GTGCTCAGTGAACCAGAATGCGG + Intronic
936234521 2:110732139-110732161 GTTCACAGTAATGCCCAGTGCGG + Intergenic
937650873 2:124317721-124317743 GTCCTCAGTGATCTGCAATTGGG - Intronic
937868995 2:126774275-126774297 GATCTCAGTGAGGCCCAAGGAGG - Intergenic
938661416 2:133490696-133490718 GTGCTCAGTGATTGCCCATGAGG - Intronic
946132067 2:217614216-217614238 GTTGTCAGGGATTCCCTATGTGG - Intronic
946503456 2:220274610-220274632 GATCTGGGTGATCCCCAAAGAGG - Intergenic
947998057 2:234545015-234545037 TTTCTCAAGGATCCCCAGTGTGG + Intergenic
1169388005 20:5167365-5167387 GTTCACAGTCATCCCCAGTATGG - Intronic
1170233936 20:14080825-14080847 GTTCTCAGTGATGCCAAGTGAGG - Intronic
1171468514 20:25350728-25350750 TTTCTCTGGGATCCCCAAAGGGG - Intronic
1180164295 21:46013868-46013890 GTGGTCAGTTATCCCCAAAGTGG - Intergenic
1180249514 21:46572448-46572470 GATTTGAGTGACCCCCAATGTGG + Intergenic
1181458780 22:23074109-23074131 GGACTCAGTGGGCCCCAATGAGG + Intronic
1183648267 22:39139156-39139178 GTTCACAGAGATCCCAAATTCGG - Intronic
1183709597 22:39495095-39495117 GTTCTCAGTGCTTACCAACGTGG + Intergenic
1183785063 22:40024450-40024472 GTTCTCACTGATTCCCACGGTGG - Intronic
949404464 3:3699753-3699775 CTTCATACTGATCCCCAATGGGG + Intergenic
950599949 3:14025150-14025172 GTTTTCAGTGATTCCAAATTAGG + Intronic
950787885 3:15450940-15450962 CTTCTCAGTGTTTCCCAAAGGGG - Exonic
956014544 3:64867773-64867795 GGACTCAGTGATGCCCAAAGAGG + Intergenic
959723425 3:109517134-109517156 GTTCTCAGTGATGCCAAACCAGG - Intergenic
959970257 3:112401131-112401153 GTTTTCAGTGATTCCAAATTAGG + Intergenic
960332301 3:116376738-116376760 GTGCTAATTGATCCCCACTGGGG - Intronic
967697817 3:192553865-192553887 GTTTTCAGTGGTCCCCAACCTGG - Intronic
971670920 4:29556512-29556534 GTTTTCAGTGATAGCAAATGAGG - Intergenic
972510397 4:39763579-39763601 GAACTCAGTCATCACCAATGGGG + Intronic
973282086 4:48369634-48369656 GTACTAAGTGAACCCAAATGAGG - Intronic
975205153 4:71637300-71637322 GTTTTCAGTGACTCCCAATTAGG - Intergenic
976502161 4:85803733-85803755 TTTCTGTGTGATCCCCATTGTGG + Intronic
982135135 4:152268109-152268131 GTTCTGAGTGATCCACAAAGAGG + Intergenic
983280154 4:165670688-165670710 GTTTTCAGTAAGCCCCATTGAGG + Intergenic
984872129 4:184335105-184335127 GTTCTCAGTGATGCCAAATCAGG - Intergenic
984965513 4:185136511-185136533 GTTCTCAGATTTCTCCAATGAGG - Intergenic
986686318 5:10278283-10278305 CTTCTCACTGTTCCCCAAGGTGG + Intronic
1000917557 5:167100507-167100529 CTTCTCAGTCTTCCCAAATGTGG - Intergenic
1009298412 6:61983978-61984000 GTTCTCAGTGATTCCAAGTGAGG - Intronic
1009467521 6:63990556-63990578 GTTCTCAGTGATCCCCAATGTGG - Intronic
1013654936 6:112236807-112236829 GTTTCCAGTGATCTCCAAAGGGG - Intronic
1014884947 6:126768634-126768656 GTTCTTAATGTTCCCAAATGGGG - Intergenic
1017351133 6:153443246-153443268 GTTTTCAGTGACTCCCAATTAGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018145938 6:160888831-160888853 GTTTTCAGTGACTCCCAATTAGG - Intergenic
1028648897 7:93128501-93128523 GTTTTCAGTGACTCCAAATGAGG - Intergenic
1030854560 7:114538045-114538067 GTTCATAGTGATCCATAATGAGG + Intronic
1032534227 7:132648465-132648487 ATCCCCAGTGATCCCTAATGAGG + Intronic
1035660615 8:1344756-1344778 GTTACCAGTGATCCCCAAGGAGG - Intergenic
1038883822 8:31640865-31640887 GTTCTCAGCGATCCTCAGAGAGG + Intronic
1039769944 8:40675215-40675237 ATTCTCAGTTATTCCCACTGTGG + Intronic
1040700918 8:50064566-50064588 GTTTTCAGTGATCAGCATTGAGG - Intronic
1041131735 8:54709106-54709128 ATTCTCAGTCCTCCACAATGGGG - Intergenic
1041152772 8:54953830-54953852 GTTCTCAGTGATCCACTTGGGGG - Intergenic
1045347949 8:101311439-101311461 TTTCTCAGTGATCACCTATATGG + Intergenic
1045826703 8:106406194-106406216 GTACTCATTGATCCCCAAAATGG + Intronic
1048119140 8:131560112-131560134 GTTTTCAGTTTTCCCCAATTCGG - Intergenic
1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG + Intergenic
1057764883 9:97907953-97907975 TTTCTCAGTGAGGCCCACTGGGG + Intronic
1058295842 9:103305378-103305400 GTTCTCAGTGATCCCAAATATGG - Intergenic
1060224392 9:121782446-121782468 GTTCTCAGTAATCTGCAATTTGG - Intronic
1187261980 X:17693288-17693310 GTGCTCAGTTGTCCCCACTGAGG - Intronic
1187984605 X:24796779-24796801 CTTCTCTGTGATCTCCATTGAGG + Intronic
1190918341 X:54826524-54826546 GTGCTCAGTGAGCCCCAGCGGGG - Intergenic
1192785649 X:74332365-74332387 GTTCTCAGTCATGCCAAATCAGG + Intergenic
1193911694 X:87314424-87314446 GTTTTCAGTGATTCCAAATTAGG - Intergenic
1195433454 X:104815278-104815300 TTTCTCAGTGATACCCATTTTGG - Intronic
1197568228 X:128115218-128115240 GTTTTCAGTGATCCTAAATTAGG + Intergenic
1201957161 Y:19638128-19638150 GCTCTCAGTGAAACTCAATGGGG + Intergenic