ID: 1009472307

View in Genome Browser
Species Human (GRCh38)
Location 6:64042847-64042869
Sequence GTGGAAGTCCTTAAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009472307 Original CRISPR GTGGAAGTCCTTAAAGATGG TGG (reversed) Intronic
902216471 1:14937398-14937420 TTGCTAGTCCTTGAAGATGGAGG - Intronic
908339654 1:63163553-63163575 TTGGAAGTCCTAGAAGATGAGGG - Intergenic
913215748 1:116618897-116618919 GAAGCAGTCCTTAAAGATGCTGG - Intronic
915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG + Intergenic
918558982 1:185841731-185841753 GTGGTAGCCCTTAAAGAGGCTGG + Intronic
920748883 1:208655376-208655398 GTGGAAGTCCTCAAGCATGCTGG + Intergenic
921359719 1:214319469-214319491 GTGGAAGTCTTTCCTGATGGTGG + Intronic
922048979 1:221972499-221972521 GTGGAAGAGCTCAAAGGTGGGGG - Intergenic
923354613 1:233141883-233141905 GTGAAAGTCCTTCAAGATATTGG + Intronic
924426980 1:243960379-243960401 GTGGATGTCCTTAAGGATGGAGG - Intergenic
924508631 1:244710222-244710244 AGGGAAGTGCTCAAAGATGGGGG - Intergenic
924758704 1:246964927-246964949 GTGGCAGTACTGCAAGATGGGGG + Intronic
1065740122 10:28790097-28790119 GCACAAGTCCTTAAAGATGTAGG - Intergenic
1066178615 10:32937898-32937920 ATGTAAGCCCTTGAAGATGGAGG - Intronic
1066329177 10:34399375-34399397 GTAGAAGTCCCCAACGATGGAGG - Exonic
1070698898 10:78584605-78584627 GTGATGGTTCTTAAAGATGGCGG - Intergenic
1071812756 10:89200931-89200953 GAGGAAGTTCTTAAAGAAAGGGG + Intergenic
1072761854 10:98063076-98063098 GAGGAAGCCATTAAAGCTGGAGG - Intergenic
1079024672 11:16937000-16937022 CTGGTAGTCCTCAAAGATGAGGG - Intronic
1079039212 11:17046679-17046701 GAGGAAATCCTTAGAGATTGGGG + Intergenic
1082733625 11:56830749-56830771 TTGTATGTCGTTAAAGATGGGGG - Intergenic
1084965100 11:72740388-72740410 GTGAAAGTCTTTCAAGATTGGGG - Intronic
1087383288 11:97436605-97436627 GTGGAAGCCCAGCAAGATGGAGG + Intergenic
1087538812 11:99488456-99488478 CTGGAAGTTCTTAAAAATGGTGG - Intronic
1087544674 11:99569597-99569619 CTGGAAGTTCTTAAAAATGGTGG - Intronic
1091144564 11:133266363-133266385 GTGGGAGTCATGAAAGATTGGGG - Intronic
1091835125 12:3580305-3580327 GTGGAATTCCTGCCAGATGGGGG + Intronic
1093027873 12:14260952-14260974 GTGACAGCCCTTAAAGATGAGGG + Intergenic
1093770982 12:23018381-23018403 GTGATACTCCTTAAAGATTGGGG + Intergenic
1095254388 12:40017431-40017453 GAGGAAATCCTTAAAGAAGAGGG - Intronic
1096140235 12:49236901-49236923 GTGGACCTCATTAATGATGGTGG - Intronic
1096438034 12:51612028-51612050 CTGGAAGTCTGTAAAAATGGGGG - Intronic
1096507490 12:52104238-52104260 GAGGAAATCCTTAAAGGTTGGGG + Intergenic
1103998351 12:124844351-124844373 GTGGAAGTGCTTTGAGCTGGGGG - Intronic
1108593944 13:51934644-51934666 GCGGAAGTCCCCAAAGCTGGAGG + Exonic
1112100602 13:96184653-96184675 CAGGAAGTCCTGAAAGATGAGGG - Intronic
1124897254 15:33788679-33788701 GTGGTAGCCCGTAAGGATGGAGG - Intronic
1127990702 15:64113949-64113971 GTGGCAGTCAGTAAAGTTGGTGG + Intronic
1128829192 15:70750940-70750962 TTGGAAGTACGTAGAGATGGTGG + Intronic
1129366042 15:75055529-75055551 CTGGAAGTTCTTAAAAATGATGG + Intronic
1129657172 15:77531950-77531972 CTGGAAGTCCTTTAAGAAGATGG + Intergenic
1130101987 15:80901150-80901172 GTGGCATTCTTTAAAGATGTGGG - Intronic
1130932223 15:88437758-88437780 GTGGAATTCCTTGAATTTGGAGG - Intergenic
1131510243 15:93045679-93045701 CTGGAAGTTCTTGAAGATGATGG + Exonic
1134903834 16:17962326-17962348 GTTACAGTTCTTAAAGATGGTGG - Intergenic
1135242518 16:20820883-20820905 GTGAAAATCCTTAAAGCAGGCGG + Intronic
1135574039 16:23571383-23571405 ATGGAACTCCTTGGAGATGGGGG - Exonic
1135980459 16:27142993-27143015 CTGGAAGGCCCTAAAGATCGTGG + Intergenic
1137365427 16:47855662-47855684 GTGGCAGGTGTTAAAGATGGTGG + Intergenic
1137959962 16:52872835-52872857 GAGGAATTCCTTAAAGCTTGGGG + Intergenic
1138366774 16:56485521-56485543 GTGGAACTCATTGAAGATGGTGG - Intronic
1139021748 16:62758927-62758949 GAGGCAATCCTTAAAGATGGTGG - Intergenic
1141013108 16:80421859-80421881 GTGAAATTCCTTAAAGGAGGAGG - Intergenic
1143044583 17:4066912-4066934 GTGGAACTCCGTAGAGTTGGCGG - Intronic
1143077150 17:4353987-4354009 GTGGAAGACCTTAAAAATGCTGG - Intronic
1143362969 17:6386618-6386640 GTGGAAGTCCTCAGAGAAGAAGG - Intergenic
1143475824 17:7203507-7203529 GTGGAAGCCCTCAAAGAGGCAGG - Exonic
1154097471 18:11431750-11431772 GTTACAGTTCTTAAAGATGGTGG + Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1157712250 18:49858081-49858103 GAGGAAGTCCCTTCAGATGGTGG - Intronic
1161040733 19:2109623-2109645 CTGGAAGTCCTGAAGGCTGGAGG - Intronic
1162223304 19:9198230-9198252 GAGGAAGTCCTTAGAGATTGGGG + Intergenic
1162231287 19:9269012-9269034 GAGGAAGTCCTTAAAGACTGGGG - Intergenic
926228481 2:10985095-10985117 CTGGAAGACCTTAGAGATGAAGG - Intergenic
929635878 2:43520886-43520908 GTAGAAATTCTTAAAGAAGGAGG + Intronic
929984624 2:46715606-46715628 GTGGAATATCTTTAAGATGGTGG - Intronic
930029945 2:47052228-47052250 GTAGAATTCATTGAAGATGGAGG + Intronic
930031604 2:47061394-47061416 GTGGAACTCCTTGGAAATGGAGG - Intronic
930800556 2:55438487-55438509 GGGGAAGGCCTCAAAGCTGGGGG + Intergenic
932002018 2:67893826-67893848 GTGCAGGGCCTTAGAGATGGAGG - Intergenic
933316739 2:80724512-80724534 TTAGAAGTCCTGAAAGATGGTGG + Intergenic
935526446 2:104174242-104174264 GTTGAAGTCCTTAAACAGGTTGG - Intergenic
935526521 2:104175792-104175814 GGTGAAGTCCTTAAACATGTTGG - Intergenic
935784932 2:106540498-106540520 GTGAAAGTCCTGAAAGCAGGGGG - Intergenic
935799728 2:106682254-106682276 GTGGTAGTCTTAAGAGATGGGGG + Intergenic
937751245 2:125478283-125478305 GTTACAGTTCTTAAAGATGGTGG + Intergenic
948214463 2:236218356-236218378 GTGGCAGTCATTAAAAATGAAGG + Intronic
948678657 2:239615173-239615195 GTGTATGTCCTTCAATATGGGGG + Intergenic
1170397356 20:15941508-15941530 GTTGAAATCCTTCAAGATTGAGG + Intronic
1170413365 20:16114100-16114122 GAGGAAGTACATAAAAATGGTGG + Intergenic
1171136699 20:22701265-22701287 GTGGAGGTCCTAAAGGAAGGTGG + Intergenic
1175477401 20:59286596-59286618 GTGGAAGTTCTTTAAAATGTAGG - Intergenic
1175485015 20:59339567-59339589 GTGGAAGTTCTGGAAGAAGGTGG + Intergenic
1179285757 21:39976083-39976105 GTTGAAGTCAGTAAAGATGGTGG + Intergenic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
950804469 3:15587242-15587264 GTGGAAGTCCTTAAAACTAAAGG - Intronic
950804485 3:15587483-15587505 GTGGAAGTCCTTAAAACTAAAGG - Intronic
952519902 3:34146115-34146137 GTGGAAGTCTTTAAAGGGGGTGG + Intergenic
953930207 3:47002221-47002243 CTGGAAGTCTTCAAAGAAGGTGG - Exonic
954210571 3:49094617-49094639 GTGGAAGGCGTTAAAGCTGCAGG + Intergenic
955118092 3:56025904-56025926 GTGGAATTCATTCAAAATGGAGG + Intronic
955351400 3:58196136-58196158 CTGGAAGTCCTTCAAAATAGGGG + Intronic
957074876 3:75593977-75593999 GAGGAAGTCCTTAGAGCTTGGGG - Intergenic
957713561 3:83895632-83895654 GTGGAACTCCTTGAGGTTGGAGG - Intergenic
958119788 3:89270352-89270374 GTGGAAGTCCTGGCAGAAGGAGG - Intronic
958910678 3:99990799-99990821 CTGGAATTCCATAAAGAAGGTGG + Intronic
959937637 3:112045842-112045864 GATGGAGTCCTTCAAGATGGCGG - Exonic
961520958 3:127467184-127467206 GTGGGAGTTCCTAGAGATGGAGG + Intergenic
963187107 3:142430642-142430664 GTGGAAGTCATCAAAGAAGGTGG - Intronic
967127069 3:186434006-186434028 GTGGAAATGGTTAAAGATGAGGG + Intergenic
970425368 4:15940894-15940916 GTGGACATTCTTAAAGATGTGGG - Intergenic
973006039 4:45007916-45007938 GTGGGAGACACTAAAGATGGAGG + Intergenic
974220173 4:58958537-58958559 GTGGAAGTCCTTAATGTTCTTGG + Intergenic
974833872 4:67222944-67222966 GTCAAAGGCCTTAAAGCTGGAGG + Intergenic
974877816 4:67719110-67719132 TTAGAGGTCCTTTAAGATGGCGG - Intergenic
975889269 4:79006181-79006203 GTGGAAGTTTTTAAAGATGAAGG - Intergenic
982372062 4:154644726-154644748 GTGGAAGCCCTAAGAGATAGAGG + Intronic
984276397 4:177616287-177616309 GTGTTAGTCCTCAAAGATGCAGG - Intergenic
984940418 4:184927207-184927229 GTGGAACTCCTTAAATATGTGGG + Intergenic
985357193 4:189134035-189134057 GGGGAAGGTCTTAAACATGGTGG + Intergenic
986834845 5:11624782-11624804 TTGGAATTCCTTAATGTTGGGGG - Intronic
988024944 5:25673497-25673519 CTGGGAGTGCTTAAAGATGTTGG + Intergenic
991228405 5:64300308-64300330 GTGGAAGTACTTAAGCATTGTGG - Intronic
992326761 5:75667437-75667459 GAGGAATTCCTTAAAGCAGGTGG + Intronic
993624240 5:90205052-90205074 CTGGAAGTCCTTTCAGCTGGAGG - Intergenic
1002866244 6:1124865-1124887 GTGGAATACTTTAAAGAGGGAGG - Intergenic
1006007420 6:31013433-31013455 GGGGAAGTCCTTCAAGAATGGGG - Intronic
1006080009 6:31559617-31559639 GTTGAAGTCCTGAGAGGTGGAGG + Intergenic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1008750368 6:54726235-54726257 GTGGAATTTCCTAAAGATAGAGG - Intergenic
1009472307 6:64042847-64042869 GTGGAAGTCCTTAAAGATGGTGG - Intronic
1011598571 6:89039418-89039440 CTGGAAGAACTTACAGATGGAGG + Intergenic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1014783636 6:125592970-125592992 GTGGCAGTCTTGAAAGGTGGGGG + Intergenic
1015950668 6:138549423-138549445 GTGAAGGTCATAAAAGATGGAGG + Intronic
1017144726 6:151224333-151224355 GAGGAAGTGATTAAAGATGGGGG + Intergenic
1021301258 7:18975813-18975835 TTGGAAGTCAGTAAGGATGGTGG + Exonic
1023468610 7:40487886-40487908 GTGGGTATCCTTAAAGATGAAGG + Intronic
1026111950 7:67465429-67465451 GAGGAAGTGGTTAGAGATGGTGG + Intergenic
1026924914 7:74184605-74184627 GTGGAAAACCATAAAAATGGAGG - Intronic
1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG + Intronic
1032623583 7:133563946-133563968 GTGGAAGTCTTTAAAGATAAAGG + Intronic
1033500692 7:141946237-141946259 GTGGTAGTGCTTAAAGTTGTTGG - Exonic
1038643736 8:29347624-29347646 GTGGACATCCTTGCAGATGGAGG - Intronic
1038888231 8:31689636-31689658 TTGGAGGTTCTTTAAGATGGGGG + Intronic
1040956807 8:52988111-52988133 GTGGAGGTCCTGAAAGATTGTGG - Intergenic
1044181351 8:89199082-89199104 CTGGAAGTCCTCAGAGATGCAGG - Intergenic
1045788587 8:105955218-105955240 GTGGAACACTTCAAAGATGGTGG + Intergenic
1045847254 8:106652313-106652335 ATGGAAGGCCTTAAAAATGAAGG + Intronic
1047844356 8:128789834-128789856 TTGTAAGTCCTTGAAGATGATGG - Intergenic
1049057351 8:140248661-140248683 TTAGAAGTCCTGGAAGATGGTGG - Intronic
1050061011 9:1709833-1709855 GGGCAAGTCCTTAAAGAGGTTGG - Intergenic
1050329046 9:4527027-4527049 GTGGAAGCCCTTAAAGAGACTGG + Intronic
1051731792 9:20151485-20151507 GAGGAAGCACTTACAGATGGTGG - Intergenic
1051759660 9:20448206-20448228 GTGGATGGCCTTCAAGATGCAGG + Exonic
1052068169 9:24048710-24048732 GTGAAAGTCTTTGAAGTTGGAGG + Intergenic
1055634643 9:78264294-78264316 TTGGATCTCCTTAAAGATGCTGG + Exonic
1059824651 9:118015611-118015633 AAGGCAGTCCTTAAAGATGAAGG - Intergenic
1059966547 9:119620271-119620293 GTTGAAGTTCTTATAGATGCTGG + Intergenic
1201424404 Y:13832528-13832550 GTTACAGTTCTTAAAGATGGTGG - Intergenic