ID: 1009474925

View in Genome Browser
Species Human (GRCh38)
Location 6:64078779-64078801
Sequence CAAGCTGATGATAGTGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009474925_1009474927 16 Left 1009474925 6:64078779-64078801 CCTATGGCACTATCATCAGCTTG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1009474927 6:64078818-64078840 GATTAAAGTACGAACTTTAATGG 0: 1
1: 0
2: 0
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009474925 Original CRISPR CAAGCTGATGATAGTGCCAT AGG (reversed) Intronic
901970601 1:12904688-12904710 GAAGTTAATGGTAGTGCCATTGG + Intronic
902014564 1:13297082-13297104 GAAGTTAATGGTAGTGCCATTGG - Intergenic
902862609 1:19257082-19257104 CAAGGTGATGATGGTGGCCTTGG + Exonic
903812139 1:26040609-26040631 GAAGATGATGATCGTGCCCTGGG - Intronic
907116625 1:51974447-51974469 CAAGGTGATGCTGATGCCATGGG + Intronic
908033055 1:60021690-60021712 ACAGTAGATGATAGTGCCATGGG - Intronic
910430920 1:87159026-87159048 CCAGCTGCTGAGAGTACCATTGG + Intronic
910620586 1:89248984-89249006 TAAGCTGATGAAAGAGCCCTTGG + Intergenic
914463032 1:147902407-147902429 CCAGCTGATGATAAGGCCTTGGG + Intergenic
918806516 1:189053630-189053652 CAAGGAGATGATAATGGCATGGG + Intergenic
919129899 1:193438523-193438545 CAAGCTGATGGAAGAGCCCTTGG - Intergenic
919434066 1:197534914-197534936 AAAGCTGATGCTAGAGCCACGGG - Intronic
919842571 1:201619841-201619863 CAAGCTGGTGATAATTCCCTGGG + Intergenic
922642306 1:227246111-227246133 CAAGCTGATGAAAGAGCTCTTGG + Intronic
1065514508 10:26511728-26511750 CGAGCTGAGGATAGAACCATGGG - Exonic
1067772078 10:49133853-49133875 CAAGCTGAGGGTGGTCCCATCGG + Exonic
1070105345 10:73426021-73426043 CAAGCTCATCATAGTCCCCTGGG + Exonic
1070170160 10:73926858-73926880 CAAGCTGGGGTTAATGCCATTGG + Intergenic
1072868311 10:99088089-99088111 CAAGCTGATGGGAGTATCATGGG - Intronic
1077279144 11:1734166-1734188 CAAGCTGATGAGGGTGCACTAGG - Exonic
1077467592 11:2740915-2740937 CAAGCAGCTGATCGTGCAATGGG - Intronic
1081212557 11:40354670-40354692 CAAGCTGATTAAAGAGCCCTTGG - Intronic
1083611570 11:64006936-64006958 CCAGTTGATGATGGTGCCAACGG - Intronic
1087720940 11:101664944-101664966 CAAGCTGATGGAAGAGCCCTTGG - Intronic
1093301591 12:17465036-17465058 GAAGCTGAGGATAGGGGCATGGG - Intergenic
1093617245 12:21241329-21241351 GAAGCTGATTAAAGTGCCCTTGG + Intergenic
1093800714 12:23368433-23368455 TAAGCTGATGATATTACCCTTGG + Intergenic
1096558898 12:52422046-52422068 CAAGCAGATGTTGGTGCAATGGG + Intergenic
1098157099 12:67610461-67610483 GAAGCTGATGATAGGGACGTGGG + Intergenic
1098760524 12:74419247-74419269 CAAGCTGAAGATTGGGTCATAGG - Intergenic
1102616301 12:114157666-114157688 CAAGCAGCCGATATTGCCATTGG + Intergenic
1106587387 13:31069208-31069230 AAATGTGATGATAGTGACATTGG - Intergenic
1106794392 13:33189519-33189541 CTAGCCTATGAAAGTGCCATCGG - Intronic
1111916511 13:94366358-94366380 CAAGATGATGCTAGTGGCATAGG - Intronic
1113481189 13:110622939-110622961 GCAGCTGTTGATCGTGCCATAGG + Intronic
1116889162 14:50250300-50250322 CAAGCTGATGGAAGAGCCCTTGG + Intronic
1117110406 14:52447218-52447240 CAAGCTGATGGAAGAGCCCTTGG + Intronic
1119001671 14:70887727-70887749 CAACCTTAGGACAGTGCCATTGG - Intergenic
1120541379 14:85754984-85755006 CAAGCTTATGATATTTCCTTGGG + Intergenic
1123912607 15:24983350-24983372 CAAGCTGAATGGAGTGCCATTGG - Intergenic
1124606082 15:31171277-31171299 CAAGCTGATGACACGGACATCGG - Intergenic
1137451909 16:48583831-48583853 CAAGCAGATGAGAGTCCCTTCGG - Intronic
1139755890 16:69143265-69143287 CACACTTATGATAGTGCCATCGG - Exonic
1144813469 17:18017279-18017301 CTAGCTGATGGCAGTGCCCTTGG - Intronic
1146951119 17:36907238-36907260 CAGGCTGATGATAAGGCAATTGG + Intergenic
1153280155 18:3407415-3407437 CAAGGAGATGACAGAGCCATGGG + Intergenic
1154295051 18:13140261-13140283 CAAGGTGATGATGGTGGCCTTGG - Intergenic
1155282169 18:24250916-24250938 TAAGCTGATGAAAGAGCCCTTGG + Intronic
1155997494 18:32345707-32345729 TAAGCTGATGAAAGCGACATTGG + Intronic
1162044248 19:7988174-7988196 CAAGTGGATGGTGGTGCCATCGG + Intronic
1167807700 19:51799978-51800000 CTTGCTGATGATAGGGCCATGGG + Intronic
925085515 2:1104826-1104848 CAAGCTAAGGATGGTGCCACGGG - Intronic
930066409 2:47331189-47331211 CAACCTGAGAATAGTGACATGGG - Intergenic
936901299 2:117484812-117484834 AAAGCTGATTAAAGTGCCCTCGG - Intergenic
938217026 2:129526681-129526703 CAAGCTGATCAAAGAGCCGTTGG + Intergenic
939244775 2:139609679-139609701 AAAGCTGATGGTAGTGTCTTTGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
942886511 2:180931343-180931365 CAGCCTGATGATACTACCATGGG - Intergenic
944046202 2:195414395-195414417 CAAGCTGCTGAAAGAGCCTTTGG + Intergenic
945804408 2:214472688-214472710 CATGGTGATGAGATTGCCATTGG + Intronic
946760744 2:222990699-222990721 CAAGGTGATGATAGAGCCTTTGG - Intergenic
1171400065 20:24867399-24867421 CAGGCTGAGGATGGTGACATGGG + Intergenic
1172920267 20:38475242-38475264 CAAGCAGATGGGATTGCCATTGG + Intronic
1173657558 20:44710910-44710932 CCAGCTGATGCTGATGCCATCGG + Intergenic
1173847685 20:46198421-46198443 CAGGCTGAAGATAGAGCCAGTGG - Intronic
1177212872 21:18091757-18091779 CAAGCTGATGAAAGAGCCCTTGG + Intronic
1177856089 21:26401826-26401848 GACTCTGATGATAGTTCCATTGG + Intergenic
1181682784 22:24507365-24507387 CAAGATGGTGGTGGTGCCATTGG + Intronic
949959454 3:9300198-9300220 CAAGTTGATGATAGTGTTGTTGG - Intronic
953450414 3:43000964-43000986 CCAGTTCATGATGGTGCCATAGG - Intronic
954217803 3:49133959-49133981 AAAGCTGATGATAGTTCCTCAGG + Intergenic
955495388 3:59526397-59526419 CACTCTCTTGATAGTGCCATTGG - Intergenic
957907600 3:86578153-86578175 GAAGCTGATGAAAGAGCCCTTGG - Intergenic
962705891 3:138044162-138044184 TGAGCCGAGGATAGTGCCATAGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964887350 3:161499791-161499813 CAAGCTTATAATAATGACATTGG + Intronic
965177548 3:165355219-165355241 CCAGCTGTTGAAAGTGCTATTGG - Intergenic
969243431 4:5916889-5916911 CAGGCTGGGGACAGTGCCATCGG + Intronic
972021664 4:34323427-34323449 CAAGCTGATAAAAGAGCCCTTGG + Intergenic
974469690 4:62302581-62302603 CAAGCTGACTATAGAGCCCTTGG + Intergenic
975629811 4:76388399-76388421 CAAGCTGATCAAAGAGCCCTTGG + Intronic
976332129 4:83844720-83844742 CAAGGAGGTGATAGAGCCATGGG + Intergenic
977066484 4:92322658-92322680 CAAGCTGATCACAGGCCCATAGG - Intronic
977454982 4:97247689-97247711 GAAGCTGTTGATGTTGCCATGGG + Intronic
983210098 4:164949602-164949624 CAAGCTGATGAGAAAGCCTTGGG + Intergenic
984635305 4:182104024-182104046 CAAGCCCAGGATAGTGCCAAAGG - Intergenic
987966720 5:24886829-24886851 CACTCTGATGATAGTTCCTTTGG - Intergenic
989265900 5:39473541-39473563 AAAACTGCTGATAGTACCATGGG - Intergenic
989425285 5:41289951-41289973 CAAGTTGATGATACTGTCACAGG + Intergenic
989576798 5:42995449-42995471 CAGGCTGATGGTAGTGCTAAAGG + Intergenic
989625155 5:43422541-43422563 AAAGCTGATGATGGTGATATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991291000 5:65033986-65034008 CAAGCTGCTGATTGTGGCTTAGG + Intergenic
997874066 5:137532692-137532714 CAAGCAGATGATAATGGCTTAGG - Intronic
998320024 5:141220867-141220889 CATGCAGATTATATTGCCATAGG - Intergenic
999083282 5:148864281-148864303 CAAGCTGCTAATAGTGACCTTGG + Intergenic
999778574 5:154830522-154830544 CAGGCTGACCACAGTGCCATGGG + Intronic
1000073773 5:157765606-157765628 CATGTTAATGATAGTGCCAGTGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000730142 5:164824841-164824863 CAATCTAATGACAGTGACATCGG - Intergenic
1001199846 5:169706104-169706126 AAAGCCAAAGATAGTGCCATAGG - Intronic
1009312831 6:62177044-62177066 CAAGCACATGATACTGACATAGG - Intronic
1009474925 6:64078779-64078801 CAAGCTGATGATAGTGCCATAGG - Intronic
1010838903 6:80623878-80623900 CCTGCTGATCATAGAGCCATAGG + Intergenic
1013535124 6:111056943-111056965 CAAGGTGATGGTAGGGCGATGGG + Intergenic
1015419291 6:132987613-132987635 CCAGCAGATGCTAGTGTCATAGG + Intergenic
1020847451 7:13305378-13305400 CACTCTGATGATAGTTTCATTGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1025499460 7:61267125-61267147 CACTCTGATGATAGTGTCTTTGG - Intergenic
1025514311 7:61613350-61613372 CACTCTGATGATAGTGTCTTTGG - Intergenic
1025538656 7:62042190-62042212 CACTCTGATGATAGTGTCTTTGG - Intergenic
1028507047 7:91582196-91582218 CAAGCTGTGAATATTGCCATGGG + Intergenic
1029218311 7:98968557-98968579 CAAGCTGATGAGTGAGCCACAGG - Intronic
1029691034 7:102181938-102181960 CAACCTGATGCTTTTGCCATGGG + Intronic
1030782665 7:113620794-113620816 AAAGTTAATAATAGTGCCATAGG + Intergenic
1032259329 7:130322340-130322362 CAGGCTGATGATTTTGTCATAGG + Intronic
1032939164 7:136768524-136768546 TAAGCTGATGAAAGAGCCCTTGG + Intergenic
1034233578 7:149551343-149551365 CACCCTGATGATATTGCCACTGG + Intergenic
1035535120 8:385132-385154 TAAGCAGATGATAGTCCAATAGG + Intergenic
1040095788 8:43440930-43440952 TAAGCTGATTATAGAGCCCTAGG + Intergenic
1040734871 8:50492691-50492713 CATGCTGATGATAGTTTCTTTGG + Intronic
1041823318 8:62063704-62063726 CAAGCTGATGGAAGAGCCCTTGG + Intergenic
1042297977 8:67242828-67242850 CAAGCTCATGAGAGAGCCCTTGG + Intronic
1042321753 8:67482931-67482953 CTAGCTGATGCTAGTGGGATGGG + Intronic
1042425978 8:68649404-68649426 TCAGATGACGATAGTGCCATGGG + Intronic
1048007317 8:130430006-130430028 CAAGCCGATGATCTTTCCATTGG - Intronic
1049122191 8:140748637-140748659 CAAACTCATGTTACTGCCATAGG - Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1052646211 9:31237270-31237292 CAAGTTGATCATAATGCCAAGGG - Intergenic
1052768855 9:32669030-32669052 CAAGCAGAGCGTAGTGCCATGGG + Intergenic
1057134526 9:92678126-92678148 AAAGATGATGCTAATGCCATGGG - Intergenic
1057200511 9:93137347-93137369 CAAGCTGTTGAAAGGTCCATGGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058838348 9:108879940-108879962 CAATCTGATTACTGTGCCATGGG - Intronic
1059555374 9:115275735-115275757 CAGGCTGATGGTAGAGCCCTAGG - Intronic
1060084078 9:120680860-120680882 CAAGCTGATGGAAGAGCCCTTGG - Intronic
1060411573 9:123403740-123403762 CAAGATGAGGATAGTTCCATTGG + Intronic
1060439855 9:123628302-123628324 CAAGCAGATGACAGTGACATGGG + Intronic
1060917819 9:127401590-127401612 TGAGCTGAAGATAGTGCCACGGG - Intronic
1186007269 X:5086462-5086484 CAAGCTGATAAAAGTACCAAAGG + Intergenic
1186026047 X:5313679-5313701 AAAACTGATGAGAGGGCCATTGG + Intergenic
1187704420 X:21995245-21995267 CAAGTTGCTCATATTGCCATAGG - Intergenic
1188579028 X:31687477-31687499 CAAGCTGATGGAAGAGCCCTTGG + Intronic
1189162234 X:38821184-38821206 CAATCTGATTATTGTGCCCTGGG - Intergenic
1191197188 X:57736992-57737014 CAAGCTGATGGAAGAGCCCTTGG + Intergenic
1191646664 X:63488710-63488732 CAAGCTGAAGGTAGAGCCTTTGG + Intergenic
1191831871 X:65423810-65423832 CACTCTGATGATAGTTCCTTTGG + Intronic
1192026795 X:67461628-67461650 CATGCTGATGATAGTTTCTTTGG - Intergenic
1192073209 X:67962608-67962630 CAAGCTGATGGAAGAGCCCTTGG + Intergenic
1192640736 X:72859625-72859647 CAAGCTGACTAAAGTGCCCTTGG + Intergenic
1192640975 X:72861151-72861173 CAAGCTGACTAAAGTGCCCTTGG - Intergenic
1194780749 X:98022979-98023001 CAAGCTGATGGAAGAGCCCTGGG - Intergenic
1196385070 X:115140316-115140338 CCAGCTGATGAAAGAGCCCTTGG + Intronic
1197072947 X:122322273-122322295 CAAGCTGATGGAAGAGCCCTTGG + Intergenic
1198293059 X:135257327-135257349 CAAGCTGATGGAAGAGCCCTTGG + Intronic
1200817392 Y:7547899-7547921 CAAGATGATGAAAGGGACATGGG - Intergenic
1202339663 Y:23849811-23849833 CAAGCTGATAAAATTGCTATTGG + Intergenic
1202531103 Y:25820271-25820293 CAAGCTGATAAAATTGCTATTGG - Intergenic