ID: 1009478698

View in Genome Browser
Species Human (GRCh38)
Location 6:64128330-64128352
Sequence GCTCCATTTTAGAAAGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009478698 Original CRISPR GCTCCATTTTAGAAAGTTCA TGG (reversed) Intronic
900014638 1:139456-139478 GGTCAACTTGAGAAAGTTCAGGG + Intergenic
900044505 1:494658-494680 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
900065909 1:729564-729586 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
902114232 1:14107711-14107733 GCTCCATTTTAACCAGATCATGG + Intergenic
902227626 1:15006747-15006769 TTGCCATTTTAGAAAGTTCCAGG + Intronic
903498609 1:23789348-23789370 GCTGCATTTTAGAAATTTTGAGG - Intergenic
907184754 1:52601409-52601431 GCTCCATGTTTGACATTTCATGG + Intergenic
908035844 1:60051973-60051995 GCTCAGATTTAGAAAGTTCAAGG - Intronic
908112090 1:60908004-60908026 GCAACATTTTACAAAGTACATGG + Intronic
909986447 1:82166251-82166273 GCTCCAACTTAGAAAACTCAAGG + Intergenic
912023940 1:105142241-105142263 TCTCCAACTAAGAAAGTTCATGG - Intergenic
913515444 1:119601513-119601535 GTTCCATTTTAGACACTGCATGG + Intergenic
915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG + Intronic
917273409 1:173303577-173303599 GTTCCATTTTATAAAGATCAAGG - Intergenic
917825892 1:178819898-178819920 ACTACATTTTGGAAAGATCAGGG - Intronic
918388348 1:184033910-184033932 GTTCTATTTTACAAAGTTCTGGG + Intronic
920516809 1:206591031-206591053 GCACCATTTCAGGGAGTTCATGG + Intronic
922101034 1:222476913-222476935 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
922262133 1:223952051-223952073 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
922733585 1:227967759-227967781 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
923043582 1:230337495-230337517 GCTTCAGTTTGGAAAGGTCAAGG + Intronic
923581170 1:235215171-235215193 GCTCAGTTTTAGAAAGTACATGG - Intronic
924343960 1:243057030-243057052 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
1064184688 10:13151249-13151271 TCTGCATTTTAAAAAGTGCAAGG - Intergenic
1064651269 10:17512399-17512421 TCTCCTTTTAAGAAACTTCACGG - Intergenic
1066732373 10:38448033-38448055 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1072433540 10:95395013-95395035 GCTGGATTTCAGGAAGTTCAGGG + Exonic
1073377561 10:103049757-103049779 GATCCATTTTATGAAGTTCTGGG + Exonic
1074004122 10:109402350-109402372 GCACCATTTAATAAAGGTCATGG + Intergenic
1075041952 10:119115068-119115090 CCTCTATTTTAGAAAGCTAATGG + Intronic
1075506425 10:123026766-123026788 GCTACATTTTTGAAAGGACAGGG + Intronic
1076970835 11:131133-131155 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
1077708223 11:4509293-4509315 GCTCCAGTGTAGAAAGATGAGGG + Intergenic
1078187684 11:9066278-9066300 GCTCCATTTTAGAGGTTTCCAGG - Intronic
1078345771 11:10546674-10546696 GCTCTATTTTACAAAGTTGAAGG - Intergenic
1079571469 11:21948878-21948900 GCTCCATCTTACAAACTTCTTGG + Intergenic
1083529248 11:63403476-63403498 GTGCCATTTTTTAAAGTTCAAGG - Intronic
1083629894 11:64090078-64090100 GCCCCATTCTAGAAGGTTCTGGG - Intronic
1084141412 11:67233008-67233030 CCTCCAGTTTAGATAGCTCAAGG - Intronic
1085787651 11:79469294-79469316 GCTCCTTATAAGAAAGTACATGG + Intergenic
1092607941 12:10140216-10140238 GCTTCGTTTTAGGAATTTCAAGG + Intergenic
1093971694 12:25381970-25381992 GCTCCATTTTAGCAAGTGGTGGG + Intergenic
1094151623 12:27290865-27290887 GCTACAATTTAGAAAGTAGAAGG - Intronic
1095452471 12:42347290-42347312 CCTCCATTTTAGAAAGATATTGG - Intronic
1097522391 12:60685813-60685835 GCTACATTTAAGACATTTCAAGG - Intergenic
1100050024 12:90436820-90436842 GCTCCATTTTAGAAATTCCTTGG + Intergenic
1102399539 12:112616449-112616471 GATCCATTCTTGAATGTTCATGG + Intronic
1106489696 13:30208659-30208681 GTTCCTCTTTAGAAAGTGCACGG + Exonic
1107463719 13:40629862-40629884 GCTACAGTTGAGAAGGTTCAAGG + Intronic
1108396845 13:49997824-49997846 GTTCCATTTTGGAAGGTTCTAGG - Intronic
1111903301 13:94226683-94226705 GCTACATTCCAGAAGGTTCATGG - Intronic
1113150833 13:107261871-107261893 GTTCCAATTTGGAAATTTCAAGG + Intronic
1114703417 14:24702120-24702142 GTTCTATTTTAGTAATTTCAGGG - Intergenic
1115902116 14:38163444-38163466 GGTCCTTTTAAGAGAGTTCAGGG - Intergenic
1116394080 14:44427778-44427800 GCTTAATTTTAGAATGCTCATGG - Intergenic
1117279685 14:54226499-54226521 TCTCCTTCTTAGAAAATTCAAGG + Intergenic
1117542763 14:56764448-56764470 GTTTCATTTTTTAAAGTTCATGG + Intergenic
1117868930 14:60177247-60177269 GCTCCCTTTGGCAAAGTTCAGGG - Intergenic
1118916710 14:70113840-70113862 GTTCAATTATAGCAAGTTCAAGG + Intronic
1119622368 14:76140838-76140860 GCTCCAATTCAGCAAGTTCTGGG - Intergenic
1120749399 14:88183930-88183952 GCTACCTTTTACAGAGTTCACGG - Intronic
1121102284 14:91258180-91258202 GCTCCGCTCTAGAAAGCTCATGG - Intergenic
1121962100 14:98270385-98270407 GCACCATTTTTCAAACTTCATGG + Intergenic
1123879657 15:24665310-24665332 CATCCATTTCAGAGAGTTCAGGG - Intergenic
1125261421 15:37830246-37830268 TCTCCTTTTAAGAAACTTCACGG - Intergenic
1127952548 15:63823543-63823565 GCCCCAGTTGAGAAAGGTCACGG - Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1135815180 16:25625989-25626011 GCTCCATTTTAGACATTATATGG + Intergenic
1137322894 16:47403711-47403733 ACTCACTTTTAGACAGTTCAGGG + Intronic
1141220770 16:82067660-82067682 GCTGGATTATAAAAAGTTCATGG - Intronic
1141420392 16:83911292-83911314 GAACAATTTCAGAAAGTTCATGG + Intronic
1142449422 16:90166385-90166407 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1149530378 17:57390336-57390358 GCTGCATATTAGAATGTTCTGGG + Intronic
1149775814 17:59356102-59356124 CTTCCATTTAAGAAAGTTCAAGG + Intronic
1150570285 17:66379954-66379976 AGTCCATTTTAGAAAAATCAAGG - Intronic
1153224942 18:2892613-2892635 GCTAGATTTTGGACAGTTCACGG + Intronic
1154134335 18:11762477-11762499 GCTACATTTAAGGAAGTTCTTGG + Intronic
1154241259 18:12656594-12656616 CCTCACTTTTAGAAAGTTGATGG - Intronic
1155196640 18:23481229-23481251 GCTTCATTTTTGAAAGATGATGG + Exonic
1155801276 18:30106855-30106877 GCTCCATTTTAACAAATTTATGG - Intergenic
1155932387 18:31721081-31721103 GCTGCACTTTAGGAAGTTCTTGG + Intergenic
1158265172 18:55653716-55653738 GCTCTATTCTAGATAATTCAGGG - Intronic
1158854606 18:61530588-61530610 TCTCCTTTCTAGAAAGTTGATGG + Intronic
1159128580 18:64254022-64254044 GCTCTACTTTATAAAGGTCAGGG + Intergenic
1160647787 19:201422-201444 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
1165121824 19:33564836-33564858 GCTACATTTTGCAAACTTCAAGG + Intergenic
927797169 2:26060152-26060174 CCTCCATATTAGAGAATTCATGG - Intronic
931512444 2:63015467-63015489 TCTCCATTTTGTAAAGTTCCTGG + Intronic
931538077 2:63300406-63300428 CCTCCATTTTAGACCTTTCATGG + Intronic
931999611 2:67872562-67872584 GTTCCATTTTATTAAGTTCCTGG - Intergenic
935810202 2:106790166-106790188 GCTGCCTTTTAGAAACTCCAGGG + Intergenic
936661697 2:114550150-114550172 CCTGCATTTTAGAAAGCTGAGGG - Intronic
937783679 2:125869884-125869906 GTTCCATCTTGGAATGTTCAGGG - Intergenic
938616773 2:133007425-133007447 TCTCTTTTTGAGAAAGTTCAAGG + Intronic
940198887 2:151128142-151128164 GCTTTATTTTAGAAAGTTGAGGG - Intergenic
940215609 2:151300457-151300479 GCTAGATCTTAGGAAGTTCAGGG + Intergenic
940301093 2:152176985-152177007 GTTGCATTTTATAAAGTTCGGGG + Intergenic
940330729 2:152471661-152471683 GTTCCTATTTATAAAGTTCAGGG - Intronic
941446502 2:165607296-165607318 GCACCATATTAGAAACTTCCAGG + Intronic
941495776 2:166200386-166200408 TCTCCTTTTTACTAAGTTCATGG + Intronic
941594004 2:167452969-167452991 GCTCCATATTAGAATGATCTGGG - Intergenic
942242932 2:173980275-173980297 CCTCCATTTTAGAACTTTTAAGG + Intergenic
944569074 2:201024808-201024830 TTTCCATTTTAGAAAATTTATGG - Intronic
945223352 2:207506771-207506793 CCTCCATGTAAGAAAGTCCAGGG + Intergenic
946602621 2:221368864-221368886 GCCACATTTTAGAAAGGACATGG + Intergenic
1172763702 20:37339528-37339550 GCTCCCTTCTAAAGAGTTCAGGG - Intergenic
1174907162 20:54563412-54563434 CCTCCCCTTTAGAAAGTTAATGG + Intronic
1177162984 21:17568870-17568892 TTTCCATTTTAGAAAGTCCATGG - Exonic
1178140619 21:29679300-29679322 GCTGCATTTTAGAAATCTCATGG + Intronic
1178818301 21:35951677-35951699 GCTCAATCTGAGACAGTTCATGG - Intronic
1179636241 21:42711841-42711863 GCTCCTTTGTTGAAAGTTAATGG + Intronic
1182280600 22:29215975-29215997 GAACCATTTTAGTCAGTTCATGG + Intronic
1182905884 22:33935826-33935848 CTTCCATTTTAGAGAGCTCATGG + Intergenic
1184897529 22:47419952-47419974 GGCCTATTTTAGAAAGGTCAAGG + Intergenic
949147647 3:722023-722045 GCTCCTTTTTGGAAAGTCTAGGG - Intergenic
949809740 3:7993303-7993325 GCTTCATTTTACAAAGAACAGGG + Intergenic
955350951 3:58192478-58192500 GTTCCCTTTTAGACAATTCAGGG + Intronic
956626237 3:71269631-71269653 GCTCTATTTTGCAAATTTCACGG + Intronic
961974938 3:131013805-131013827 GTTCCATTTCAGCAAGTTAATGG - Intronic
963612393 3:147486479-147486501 TCTCCATTTTAGAAAGCAGATGG + Intronic
965327629 3:167327596-167327618 GCTTCATTTTAAAACATTCATGG + Intronic
965945302 3:174233178-174233200 GCTCCAGTAAAAAAAGTTCAAGG + Intronic
966743690 3:183255257-183255279 TCACCCTTTCAGAAAGTTCAGGG - Intronic
967990587 3:195127346-195127368 GCACCTTTTTAGCAAGTCCATGG - Intronic
968149356 3:196324845-196324867 GCTGCATTTTCAAAAGTTCCAGG + Intronic
968370060 3:198218693-198218715 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
970055650 4:11968705-11968727 ACTCCAGTCCAGAAAGTTCAAGG + Intergenic
972407478 4:38760800-38760822 GCTGCATTTTAGCAAGATCCTGG - Intergenic
977165746 4:93694625-93694647 CCTCCATATTCTAAAGTTCATGG + Intronic
979258758 4:118630658-118630680 GGTCGACTTCAGAAAGTTCAGGG - Intergenic
979329591 4:119409898-119409920 GGTCGACTTCAGAAAGTTCAGGG + Intergenic
980679156 4:136133365-136133387 GCTCCATTGTGTAAAGTCCAGGG - Intergenic
982971474 4:161993256-161993278 GCTCCATTTTAAAAATGACAAGG + Intronic
984113773 4:175652062-175652084 GCTCCATTATAGGAAGTTTATGG + Intronic
986202711 5:5592518-5592540 ACTGCAATTCAGAAAGTTCAGGG + Intergenic
987393110 5:17395353-17395375 CCTGCATTTCAGAATGTTCAAGG - Intergenic
988952579 5:36278423-36278445 GCTACATTTTATAAGGTTCCCGG + Intronic
991159412 5:63479396-63479418 TATCCATTTTAGGAAGTTTATGG - Intergenic
991196997 5:63946413-63946435 CCTGCATTTTAGAAAACTCAGGG + Intergenic
992115981 5:73539030-73539052 GGTCCATTTTGGAAACTACAGGG - Intergenic
993983973 5:94574806-94574828 GCTTGAGTTTAAAAAGTTCAAGG - Intronic
995319788 5:110820715-110820737 TCTCTGTTTTAGAAAGTTCTGGG + Intergenic
996307178 5:122060601-122060623 GCTCCAATTTGAAAAGCTCAGGG - Intronic
996525331 5:124473244-124473266 TTTCCATGTTAGAAAATTCAAGG - Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
1001380536 5:171303600-171303622 GAATGATTTTAGAAAGTTCAGGG - Intergenic
1002729339 5:181324271-181324293 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1004885333 6:20045677-20045699 GCACCATTATAGAAAATTAATGG - Intergenic
1006321368 6:33321543-33321565 TCTGCATCTTACAAAGTTCAAGG + Exonic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1010573412 6:77505561-77505583 ATCCCATTTTAGAAAGATCATGG - Intergenic
1012583043 6:100892101-100892123 GCTCAATTTTTAAAAGTTCTTGG - Intergenic
1013258944 6:108418135-108418157 GCATCATTTTATAAAGTTAAAGG + Intronic
1013365332 6:109433361-109433383 TCTCCCGTTTAGAAAGTTCTGGG - Intronic
1016027012 6:139297949-139297971 CCTCCATTTTAGAAAGACAAAGG - Intergenic
1016489938 6:144588219-144588241 GTGCCATTTTAGAAAGCTCTTGG + Intronic
1018302660 6:162419829-162419851 GAACCATTTTAGAAAGTTGCTGG + Intronic
1019107351 6:169679195-169679217 GCTTCATTTTATATATTTCAGGG - Intronic
1020073695 7:5243741-5243763 GCTCCTTTTGAGGAAGTTCAAGG + Intergenic
1020837907 7:13177463-13177485 TTCCCATTTTAGAAGGTTCAGGG + Intergenic
1021047266 7:15939044-15939066 GCTTCATTTTAGAGCTTTCATGG + Intergenic
1021295300 7:18898087-18898109 GCACCATTTTAGACATTTCTTGG + Intronic
1022287682 7:28970028-28970050 GCTCCATTTTAGAAAATTAAAGG - Intergenic
1023637116 7:42223314-42223336 CCACCATTTTGGAAAGTTGATGG - Intronic
1024240723 7:47433479-47433501 GATGCATTTTAGAAAGCTCTAGG + Intronic
1024649671 7:51392492-51392514 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
1025182921 7:56832750-56832772 GGTCGACTTGAGAAAGTTCAGGG + Intergenic
1025689005 7:63744224-63744246 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1027534614 7:79381685-79381707 CCTTCATTTTACAAAGTTTATGG - Intronic
1028295085 7:89119401-89119423 TGGCCAGTTTAGAAAGTTCAGGG + Intronic
1032051062 7:128651407-128651429 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1034556582 7:151854221-151854243 TCTGCATTTTAGAAAGTTCCAGG - Intronic
1035338424 7:158144832-158144854 GCATCATTTTGCAAAGTTCAGGG - Intronic
1037670176 8:21008220-21008242 GCTTCATTTTATACATTTCAGGG - Intergenic
1038239700 8:25797250-25797272 CCTCTATTCTAGAAATTTCAGGG + Intergenic
1041146627 8:54882927-54882949 TCACAATGTTAGAAAGTTCAAGG + Intergenic
1043718767 8:83517489-83517511 GATCTATTTTAAACAGTTCATGG + Intergenic
1046590010 8:116194894-116194916 TCTCCATGCTAGAAAGTCCAGGG - Intergenic
1047302093 8:123622276-123622298 GCTCCATTTTTGCAATTTAATGG - Intergenic
1048688508 8:136931696-136931718 GCTCCAGTTTGGAAAGCCCAGGG - Intergenic
1049831981 8:144706515-144706537 TCTCCACATTAGAAAGTTAAGGG + Intergenic
1052223795 9:26059757-26059779 GCTCAATTTTATATATTTCAGGG + Intergenic
1052275688 9:26673639-26673661 GCTCCATTTTGCAATGTTCTTGG - Intergenic
1053065187 9:35063395-35063417 GCTCAATTTTAGACAGACCAAGG + Intronic
1055251051 9:74305996-74306018 GCTCCACTTTATAAAATTTATGG + Intergenic
1055433319 9:76267157-76267179 GCTCCATTTTAGAAGGCTGGTGG - Intronic
1056642998 9:88387327-88387349 GCTGCAGTTTAGAGTGTTCAAGG + Intergenic
1056771645 9:89481847-89481869 GCTCCATTTGTGAAGATTCAAGG + Intronic
1058327751 9:103719196-103719218 GATTCATTTTATAAAGTTTATGG + Intergenic
1058539512 9:105997094-105997116 GTTCCAATTTGGAAAGTTCTGGG + Intergenic
1059828125 9:118056849-118056871 ATTCCATTATAGAAAGGTCATGG + Intergenic
1059960532 9:119560137-119560159 GCTCCAGTTTAGAAAGGATAAGG - Intergenic
1062754000 9:138277963-138277985 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1203577318 Un_KI270745v1:19572-19594 GGTCGACTTGAGAAAGTTCAGGG - Intergenic
1188164489 X:26845236-26845258 GCTGCAGTTTAGAAAGTCCTTGG - Intergenic
1190512136 X:51184441-51184463 GCTTCATTTGAGAAAGGACAAGG - Intergenic
1192744280 X:73923295-73923317 GCTGCATTTTAGAAATATCTAGG + Intergenic
1193130583 X:77915455-77915477 TCCCCATTTTAGAAATTTGAAGG - Intronic
1194789761 X:98132547-98132569 TCCCCATTATAGAATGTTCAGGG - Intergenic
1195913131 X:109909327-109909349 GCTCCATGTTGTAAAGTTGAGGG + Intergenic
1202116411 Y:21472429-21472451 GGTCCATTGTAGACAGTTCCTGG - Intergenic