ID: 1009478891

View in Genome Browser
Species Human (GRCh38)
Location 6:64130660-64130682
Sequence GATGCCTTCCGAACAAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009478886_1009478891 30 Left 1009478886 6:64130607-64130629 CCTAAAACTTAAAGTATAATTAA 0: 1138
1: 5984
2: 18960
3: 12380
4: 7672
Right 1009478891 6:64130660-64130682 GATGCCTTCCGAACAAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009478891 Original CRISPR GATGCCTTCCGAACAAAGAG GGG Intronic
No off target data available for this crispr