ID: 1009478995

View in Genome Browser
Species Human (GRCh38)
Location 6:64131656-64131678
Sequence CTGAATATGCAGATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009478994_1009478995 -9 Left 1009478994 6:64131642-64131664 CCTGAGCTGTGAGACTGAATATG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG 0: 1
1: 0
2: 7
3: 66
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009478995 Original CRISPR CTGAATATGCAGATGAAAAA TGG Intronic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902342820 1:15795478-15795500 ATGAATGTGCAAATGAAAACTGG - Intergenic
902784405 1:18723748-18723770 CTGGCTATGCATATTAAAAATGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903687381 1:25141705-25141727 TTCAAGATGCTGATGAAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904367779 1:30026959-30026981 GTTAATAAGCACATGAAAAAAGG + Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
907317385 1:53581156-53581178 CTGATAATGCCGATGAAGAAGGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
908023207 1:59919992-59920014 CTGACTGTGCAGAAAAAAAATGG + Intronic
908288499 1:62637017-62637039 ATGAATATTCAGAGGAAAACAGG + Intronic
908363830 1:63396999-63397021 CTGAATTTGCAGATCTGAAAAGG + Intronic
909410416 1:75344045-75344067 CAGAATATGAATATGAAAAGGGG - Intronic
909930108 1:81487783-81487805 CTGAATACTCACTTGAAAAATGG + Intronic
911315117 1:96346954-96346976 CTGAACAGGGAGATGAAATATGG - Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912045399 1:105447843-105447865 CTGAATATGGAAAGGAAAAGTGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916298344 1:163245681-163245703 CTGATTATGCATCTGTAAAATGG + Intronic
916902199 1:169239380-169239402 CAGAGTATGAAGATGAAAGAAGG + Intronic
917112883 1:171569435-171569457 CTAAATATGTAGCTGAGAAAAGG + Intronic
917169791 1:172158391-172158413 ATGAAGAAGCATATGAAAAAAGG + Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918205939 1:182309560-182309582 CTCAATATACTGATCAAAAAGGG - Intergenic
918794621 1:188876848-188876870 CGGAAGATGAAGTTGAAAAATGG + Intergenic
919080836 1:192863940-192863962 CTGAACATGAAAATGAAAATCGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
919988062 1:202689597-202689619 CTTAGTATGCAGATGAGGAAGGG - Intronic
922304705 1:224334203-224334225 CTGAACATGTGAATGAAAAATGG - Intergenic
922375295 1:224957933-224957955 TTGGATATGCAAAAGAAAAAAGG + Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923741814 1:236661647-236661669 GTAAATATGCATATGAAAAGAGG + Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065248685 10:23786939-23786961 CTGAATATGACAATGAGAAATGG + Intronic
1065283928 10:24168875-24168897 TTGATGATCCAGATGAAAAATGG - Intronic
1065430502 10:25649981-25650003 CTTCATATCCAGTTGAAAAATGG + Intergenic
1068223866 10:54081218-54081240 CTGAACATGCTGAGGAATAATGG - Intronic
1068412111 10:56669510-56669532 CTAAAAAGGCAGATCAAAAAGGG + Intergenic
1068564340 10:58555478-58555500 CTGATTATCAAGATCAAAAAAGG + Intronic
1068635674 10:59345554-59345576 ATGATTAAGCCGATGAAAAATGG - Intronic
1069170642 10:65224716-65224738 GTGGATATGTAGATGAAAGAAGG - Intergenic
1069372994 10:67766808-67766830 CTGTATATGCATATTAAAAATGG - Intergenic
1070652759 10:78249817-78249839 CTGCATATGCAGATTAAATTTGG + Intergenic
1072166075 10:92814289-92814311 TAGTATGTGCAGATGAAAAACGG - Intergenic
1072276389 10:93827528-93827550 CTGAATAAGTGGATGAAGAATGG + Intergenic
1074702875 10:116107867-116107889 CAGAATATGCAGAATTAAAATGG + Intronic
1074937444 10:118196319-118196341 ATGAATAAGCACATGAAAAAAGG - Intergenic
1075993705 10:126859598-126859620 CTGAAGATGCAGGAGAGAAAGGG - Intergenic
1077548976 11:3191230-3191252 GTGAATATGGAGCTGAAAACAGG - Intergenic
1077926324 11:6684907-6684929 CTGAATATGTACATGTAAAGAGG - Intergenic
1077939825 11:6829159-6829181 ATGAATATGCCAATGAAAGATGG - Intergenic
1078260563 11:9703303-9703325 CTGAATATGTAAATAAAACATGG - Intronic
1078264853 11:9747353-9747375 CTGATAATGAAGATGAAGAAAGG - Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079214379 11:18494949-18494971 CTGAATATTTAGATAAAGAAAGG - Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079566843 11:21892810-21892832 CTGAATGTGCAGTTGCAAAATGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1079800023 11:24857533-24857555 TTGGATATGCACCTGAAAAAGGG - Intronic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1081475630 11:43427795-43427817 TGGGGTATGCAGATGAAAAAAGG - Intronic
1082691900 11:56315355-56315377 CTTAAAAAGCATATGAAAAATGG - Intergenic
1082926134 11:58549482-58549504 CTGGATTTGGAGATGAGAAAGGG + Intronic
1083117563 11:60477237-60477259 CTGCAGAAGCTGATGAAAAATGG + Intergenic
1083701569 11:64482500-64482522 TTAAATATGCATATGAAAAAGGG - Intergenic
1085971293 11:81594297-81594319 CTGAAAACGCAAATAAAAAATGG + Intergenic
1086166263 11:83782518-83782540 CTGACTAAGCAGATTAAAAATGG + Intronic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1089047233 11:115512758-115512780 ATGAAGATGCAAAAGAAAAATGG + Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089699766 11:120237577-120237599 GTGACTTTGCACATGAAAAAGGG + Intronic
1089773567 11:120820257-120820279 TTGAGTTTGCAGATGCAAAAAGG - Intronic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1090801334 11:130174346-130174368 CTTCATTTTCAGATGAAAAAAGG + Intronic
1092632883 12:10403009-10403031 AAAAATATGAAGATGAAAAATGG + Intronic
1092927052 12:13280719-13280741 CTGACGATGCAGGAGAAAAAGGG - Intergenic
1093444174 12:19235735-19235757 GTGAATAGGCATATGAAGAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093595255 12:20951369-20951391 TTTAATATGCACATTAAAAAGGG + Intergenic
1094756817 12:33480571-33480593 CTGAATAGCCACATGCAAAAGGG + Intergenic
1095398262 12:41785977-41785999 AGGAATATGCAGCTGAGAAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095790917 12:46166084-46166106 ATCAAAATGTAGATGAAAAAGGG + Intergenic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1096612633 12:52813171-52813193 CTGATTTTGCAAATGAAAAAGGG - Intronic
1096887502 12:54732306-54732328 CTGAACATGCAGAAAAATAATGG - Intergenic
1096972580 12:55679705-55679727 CTGAAGATGGGGATGAAAGAGGG + Intergenic
1097172678 12:57126366-57126388 CTGAGGGTGCAGCTGAAAAATGG + Intronic
1097332390 12:58345545-58345567 CTGACTAAGGAGATGAGAAAGGG - Intergenic
1097725366 12:63069819-63069841 AGGAATATGCTGATGAAATAAGG - Intergenic
1098656597 12:73038892-73038914 CTGAATATGAAGATCAAAAGAGG + Intergenic
1098830210 12:75352009-75352031 CTAAATATGGAAAGGAAAAATGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099708111 12:86183054-86183076 CTGAACATGATGAAGAAAAATGG - Intronic
1099838758 12:87939641-87939663 CTGTTTTTGCATATGAAAAATGG + Intergenic
1100040814 12:90314691-90314713 CTGTGGATGCATATGAAAAATGG + Intergenic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100457040 12:94762573-94762595 CTGAATAGGCAGTTGTAACATGG - Intergenic
1100791940 12:98140093-98140115 CTAAATATGAATATGAATAACGG + Intergenic
1101349479 12:103915536-103915558 CCCAGCATGCAGATGAAAAAGGG + Intergenic
1101974156 12:109340798-109340820 TTGAACATGCATATGCAAAAAGG - Intergenic
1102635811 12:114322873-114322895 CTCAATTTGCAGAGGAAAAGGGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107361992 13:39628623-39628645 CTGACTCTGCAGAAGTAAAAAGG - Intergenic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108899597 13:55384293-55384315 CTGAATATCTCCATGAAAAAAGG + Intergenic
1109376819 13:61506179-61506201 ATTAATATCCAGATTAAAAAAGG + Intergenic
1109533769 13:63688465-63688487 CTGTAAAGGCAAATGAAAAATGG - Intergenic
1110631721 13:77715535-77715557 CTGGTTATGAAAATGAAAAATGG - Intronic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111245289 13:85530187-85530209 CTGAATATGCTGTAGTAAAAAGG - Intergenic
1111353278 13:87062334-87062356 CTGAACATGGAGTTGAGAAAGGG - Intergenic
1111393415 13:87629888-87629910 TTGAATATGAAGATAATAAAAGG - Intergenic
1111453796 13:88453538-88453560 GTGAATATGAAGATAAAACAGGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111583551 13:90255076-90255098 CTGAATGTTCAGATGTAAACTGG + Intergenic
1111940990 13:94606593-94606615 CTGAATAATAAGAGGAAAAAGGG - Intronic
1112291386 13:98146149-98146171 CAGAATATGCTTAGGAAAAATGG + Intronic
1112488460 13:99840784-99840806 TTACATATGCATATGAAAAAAGG + Intronic
1113233829 13:108246486-108246508 CTTAATATGCAGCTAAAAACAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114880579 14:26780506-26780528 CTGATTTTGCAGATGAAAGAAGG - Intergenic
1115749403 14:36473882-36473904 CTGAAAATGCAGAACAAAAATGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116565613 14:46440479-46440501 CTAAATATGGAAAGGAAAAATGG + Intergenic
1116566707 14:46454695-46454717 CAGAATATTCAGATGTCAAAAGG + Intergenic
1116609396 14:47047942-47047964 CTGACTATTCAGATTAGAAAAGG - Intronic
1117267554 14:54105670-54105692 CTGAATTTTCAGAAAAAAAAAGG - Intergenic
1117806307 14:59494719-59494741 CTTAATATGCACATAAAAGATGG - Intronic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118235457 14:63999850-63999872 TTGCTTATTCAGATGAAAAATGG - Intronic
1118250518 14:64155935-64155957 CCGAAGATACAGATCAAAAATGG - Intronic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1120882340 14:89423515-89423537 TTGGACATGCAGATGAAAACAGG + Intronic
1121397012 14:93634523-93634545 CAGTATAGGCAGATGAAAAGGGG + Exonic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1121905660 14:97740732-97740754 CTAAATATGGAAAGGAAAAACGG - Intergenic
1124046332 15:26154135-26154157 CTAAATATGGAAAGGAAAAACGG - Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125470532 15:39998286-39998308 TTAAACATGCAGATGAAAAAAGG - Intronic
1125651984 15:41324790-41324812 GTGAATATGAAGAAAAAAAATGG - Intronic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1126789671 15:52209563-52209585 CTGAAGATGCTGGTGAGAAAGGG + Intronic
1130104065 15:80915810-80915832 TTGAATATGCAGATTAAAACTGG - Intronic
1130284561 15:82544297-82544319 CTCATTTTGCAGATGAAAAGCGG - Exonic
1131206065 15:90448559-90448581 CAGAAAATGCTGAGGAAAAAAGG - Exonic
1133991548 16:10711237-10711259 CCTAATATGCAGTTGAAAAGAGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137680710 16:50342413-50342435 ATCAATATGTGGATGAAAAAAGG + Intronic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1138922478 16:61548788-61548810 CTCAATATGCACATGAGAATAGG - Intergenic
1139086371 16:63591489-63591511 ATGAATATTCAGAATAAAAATGG + Intergenic
1139131066 16:64146200-64146222 CTGAATCTGAGGATGAAAACAGG - Intergenic
1140571975 16:76118247-76118269 CTGAATATTCTCCTGAAAAAAGG - Intergenic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1146071340 17:29684748-29684770 TTTAAGATGCTGATGAAAAAGGG - Intronic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146364217 17:32206394-32206416 CTGATTCTGCAGACTAAAAATGG - Intronic
1146931587 17:36782043-36782065 CAGATTCTTCAGATGAAAAATGG - Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1148946144 17:51262968-51262990 ATGAGTCTGCAGATGAAAAAAGG - Intronic
1149122794 17:53190361-53190383 CTGAATCTGCAAGTGAAAATTGG + Intergenic
1149399656 17:56282620-56282642 TCAAATATGCAGATGAAAACTGG - Intronic
1151904858 17:77041066-77041088 CTGAAAATTCACATGATAAAAGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155635936 18:27955477-27955499 CTGAATTTGGAGGAGAAAAAAGG + Intronic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157343075 18:46796941-46796963 CTGAATATGAAGTTTTAAAAAGG - Intergenic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158102485 18:53845176-53845198 CTAAATAAGCAGTTTAAAAAAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159495933 18:69204777-69204799 TTGGATATGCAAGTGAAAAATGG - Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1160605375 18:80045934-80045956 CTGACAACGCAGATGAAAAAGGG + Exonic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639032 19:5408336-5408358 CTGGATATCCACATGCAAAAGGG - Intergenic
1163752147 19:19084252-19084274 CTGACTATGCAGATGTAGAGGGG - Intronic
1163869978 19:19812678-19812700 TAGAATCTGCAGATAAAAAAGGG - Intronic
1164787821 19:30948744-30948766 TTTAATATTCAGATGAAAATAGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1166238140 19:41471279-41471301 CCAAATATCCAGAGGAAAAAAGG - Intergenic
1166649479 19:44561309-44561331 CAGAATATGCGAAGGAAAAATGG + Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925664740 2:6240706-6240728 CTGAATGTGGATGTGAAAAATGG + Intergenic
925787258 2:7444515-7444537 CTTAAAATTCAGATGAAAAGTGG - Intergenic
926445723 2:12940075-12940097 CTAGATATGGAGATGTAAAATGG + Intergenic
926537745 2:14134316-14134338 CAGAAAAAGCAGATGAGAAAGGG + Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
927670585 2:25065708-25065730 GTGAATTTCCAGAAGAAAAATGG - Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928587886 2:32780224-32780246 TTGAATCTGCAGGTGAATAAGGG + Intronic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
929259072 2:39844690-39844712 CTGCCTATGAAGATGAAAGAAGG - Intergenic
930532684 2:52609910-52609932 CTGTATATGGAGATGTAAATTGG - Intergenic
931080610 2:58765695-58765717 CCTAATATGTAGATGAAAAGGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933343362 2:81050566-81050588 CTGAATATCAATATTAAAAATGG + Intergenic
933364988 2:81341200-81341222 GTCAATAAGCACATGAAAAAAGG + Intergenic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
934036195 2:88090599-88090621 CTGAGTAGGCAGAGGAAACAGGG + Intronic
935323235 2:101908594-101908616 CTTAAAATCCAGATGAAATAAGG - Intergenic
935929752 2:108111746-108111768 CTAAATATGGAAAGGAAAAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936895242 2:117420355-117420377 CTGAGTTTGAAGATGAAAAGGGG - Intergenic
937044790 2:118845487-118845509 CTGGATGTGCGGGTGAAAAAAGG + Intronic
937375150 2:121331182-121331204 CTGAGTTTGCAGATAAAAATGGG + Intergenic
937438705 2:121899539-121899561 ATGAAAATGGTGATGAAAAAAGG + Intergenic
937570965 2:123360850-123360872 CTGAAGTTGCTGATGAAAATGGG - Intergenic
937703205 2:124887647-124887669 CTGAAAATGAGGATGAAAGAAGG + Intronic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
938603486 2:132867573-132867595 AGGAATATGAAGATGATAAAGGG - Intronic
939010083 2:136836362-136836384 CTGACAGTGAAGATGAAAAAAGG - Intronic
939728939 2:145757490-145757512 CTGAATATGGAGCCTAAAAAGGG - Intergenic
940125022 2:150312699-150312721 CTGAATATGGAAAGGAGAAATGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940628450 2:156207112-156207134 ATGAATATGTAGATCACAAATGG + Intergenic
941176406 2:162202388-162202410 CTAAGTTTGCAGATGAGAAAAGG - Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942581891 2:177428459-177428481 CTAAATATGAAAAAGAAAAATGG - Intronic
943014431 2:182494204-182494226 TTGGATATGTAGATGATAAAAGG - Intronic
943156835 2:184190478-184190500 CTGATAATGCAGATGAATAATGG + Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
944196180 2:197055750-197055772 CAGAATAGGGAGTTGAAAAATGG - Intronic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
945501566 2:210581972-210581994 CTCAAGATACAGCTGAAAAAAGG + Intronic
945798562 2:214395449-214395471 GTGAATAAGCATATGAAAAGAGG - Intronic
946469506 2:219945330-219945352 CTGGATATGCTGAAGAAAAATGG + Intergenic
947292107 2:228587146-228587168 ATGAAAATGGAGATGAAATATGG - Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1171174633 20:23042266-23042288 TTGAATATGCAGAAGATAAGTGG + Intergenic
1171431079 20:25083462-25083484 CTAAACATGCAGATTAAACAAGG + Intergenic
1171727647 20:28640232-28640254 TTGACGATGCAGATGACAAATGG - Intergenic
1172601390 20:36186011-36186033 GTGCATATACAGGTGAAAAATGG - Intronic
1172760960 20:37321407-37321429 CTAAATATGCAAATCAAAACCGG - Intergenic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174667743 20:52275764-52275786 CAGATTTTGCAGATGTAAAATGG + Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175646862 20:60682088-60682110 CTGCATGTGGAGATGTAAAATGG - Intergenic
1176314175 21:5226541-5226563 TTGAAGATGCAGATGACAAATGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177426088 21:20924099-20924121 CTAAATATGGAAAGGAAAAATGG + Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1177927532 21:27236831-27236853 CTGAAGGTGCAGATGACAATGGG + Intergenic
1178188912 21:30257801-30257823 CTGAATACTGAGATGAGAAAGGG - Intergenic
1178727649 21:35068915-35068937 ATGAGAATGAAGATGAAAAAGGG - Intronic
1179021892 21:37648159-37648181 CTGAGCATGCAGGTGTAAAACGG + Intronic
1179602772 21:42491400-42491422 TTGAATATGAAGGTTAAAAATGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180391985 22:12292661-12292683 TTGAAGATGCAGATGACAAATGG - Intergenic
1180407759 22:12572095-12572117 TTGAAGATGCAGATGACAAATGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949210314 3:1491207-1491229 CTGAAGATGCAGATGACATCTGG + Intergenic
949419713 3:3853018-3853040 CTGAATATCCATATGATAGATGG - Intronic
949663559 3:6310220-6310242 CAGAAAATGCATTTGAAAAAGGG - Intergenic
951336918 3:21434616-21434638 CTGGATCTGAAGATCAAAAATGG + Intronic
952779619 3:37082853-37082875 CTGAATTTGCACATAATAAAGGG - Intronic
953971239 3:47348982-47349004 CTGATGATGCAGGTGAAAAGGGG - Intergenic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955982438 3:64540487-64540509 GTCAATGTGCAGAAGAAAAATGG - Intronic
956319102 3:67975680-67975702 CAGAAAATTCACATGAAAAAAGG + Intergenic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956688777 3:71856928-71856950 CTGATTATGCAGATGATGGAAGG - Intergenic
956824595 3:72986058-72986080 CTCCATGTTCAGATGAAAAATGG + Intronic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957276882 3:78101704-78101726 CTGAACAGGAAAATGAAAAATGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
958619881 3:96544407-96544429 CTGAAGTGGCAGATGAATAAAGG + Intergenic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959642254 3:108655205-108655227 CACAATATGCAGGTGATAAATGG - Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960276562 3:115736294-115736316 CTAAATATGGAAAGGAAAAACGG - Intergenic
960278379 3:115752879-115752901 CTAAATATGGAAAGGAAAAATGG + Intergenic
960446490 3:117755812-117755834 TAGAATAGGCAGATGACAAAGGG - Intergenic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
963202190 3:142597030-142597052 TTGAAAATGCAGCTGAAACACGG - Intronic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
963608962 3:147441220-147441242 CTGAACATGAACATGAATAAGGG + Intronic
963649329 3:147958159-147958181 TTGACTATGCAGAAGAAAAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965243919 3:166241572-166241594 CTAAGCATGCATATGAAAAAGGG + Intergenic
965501825 3:169466201-169466223 CTGGATATGCATATGCCAAATGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966290035 3:178344329-178344351 CAGAATATGAATAAGAAAAAAGG + Intergenic
967255348 3:187586314-187586336 CTGAATATGCAGAGGAATCCAGG - Intergenic
967498469 3:190169103-190169125 CTGAATCTACAGTTTAAAAAAGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
967660360 3:192100783-192100805 TTGAATATGCAGATAAATATGGG - Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970360173 4:15301430-15301452 ATGAAGAGGAAGATGAAAAAAGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971024290 4:22572826-22572848 CTGAATATGAAGTTGAAAAGAGG + Intergenic
971592025 4:28480575-28480597 CTCAAAATGCAGATAAAAAAAGG + Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
971888134 4:32480251-32480273 CTGAAAATTCTGATTAAAAAAGG + Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
974101101 4:57418042-57418064 TTGAATTTGCATAGGAAAAAAGG + Intergenic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
974414468 4:61588377-61588399 TTGAATATGAAGAAGACAAAAGG - Intronic
975018939 4:69463240-69463262 CTGAAAATGCAAAGGAAACACGG + Intergenic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
975655870 4:76640811-76640833 GTGAATCTGCAGCTTAAAAAAGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978896396 4:113893377-113893399 GTGAATAGGCAGAGGAAATAGGG + Intergenic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979041447 4:115802418-115802440 CTGAATATTTGTATGAAAAATGG + Intergenic
979792269 4:124799901-124799923 CTGAATATTTATATTAAAAATGG - Intergenic
979970487 4:127128533-127128555 CTTAATCTTCAGATGAAAATTGG - Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981580885 4:146247449-146247471 CAGAAGATGTAGAGGAAAAAGGG + Intergenic
981649281 4:147037726-147037748 ATGGATGTGCAGATGAAACAGGG + Intergenic
981665414 4:147219632-147219654 CTGAACTTTCAAATGAAAAATGG + Intergenic
982131793 4:152235336-152235358 CTCAAAATTCAGATGAAATAAGG + Intergenic
982156226 4:152523930-152523952 CTGAATCTGCTGCTGAATAAAGG + Intronic
982387787 4:154831099-154831121 CTGAATAGGCAGATGACAAATGG + Intergenic
982538173 4:156632897-156632919 GGGAATATGCAGATTAATAAAGG - Intergenic
983671829 4:170246656-170246678 ATCACTCTGCAGATGAAAAAGGG + Intergenic
984539030 4:181014056-181014078 CTCAATAAGTATATGAAAAAAGG + Intergenic
984592996 4:181637170-181637192 CTAATTTTGCAGAGGAAAAAAGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985082844 4:186283919-186283941 CAAAACATGCACATGAAAAATGG - Intronic
985383045 4:189415642-189415664 GTGAAAAGGCACATGAAAAATGG - Intergenic
985432940 4:189898817-189898839 TTGAAGATGCAGTTGACAAATGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989657218 5:43758210-43758232 CTAAATATGGAAAGGAAAAATGG - Intergenic
989825528 5:45849772-45849794 CTAAATATGGAAAGGAAAAAGGG + Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
993538052 5:89111603-89111625 CTCAAAGTGCAGATGAAAATTGG - Intergenic
993907666 5:93641459-93641481 ATAAATCTGCACATGAAAAAAGG + Intronic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995278149 5:110301541-110301563 ATGAACAGGCATATGAAAAAGGG - Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995989608 5:118221438-118221460 CAGAAGCTGCAGAAGAAAAATGG - Intergenic
996269291 5:121583111-121583133 TTGAATTTGAAGATGAAAACGGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996686732 5:126290785-126290807 ATGAATATGTAGATGAAATGTGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997140089 5:131369773-131369795 TGGAATATGCTGATGACAAAGGG - Intronic
997682346 5:135765341-135765363 CTTAATATCCAGGGGAAAAAAGG + Intergenic
997684638 5:135780077-135780099 CTTAATATACAGGGGAAAAAAGG + Intergenic
999120924 5:149208831-149208853 GTGAATATTCAGAGAAAAAAAGG + Intronic
999855781 5:155592189-155592211 CTGAAAATGGAGATTAATAATGG - Intergenic
1000010016 5:157222250-157222272 CTCAATATGGACATGAAGAAAGG + Intronic
1000316134 5:160093591-160093613 CTAAATATGAAGATAAAAAACGG - Exonic
1000500755 5:162046358-162046380 TTGAATATGCACATGAGAACTGG - Intergenic
1000579593 5:163018876-163018898 CTGAAAATTCAGTTAAAAAATGG - Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001717771 5:173830924-173830946 GTGAAAATGCCCATGAAAAAGGG + Intergenic
1003199191 6:3943259-3943281 ATGAATATGCACAGTAAAAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004914900 6:20322438-20322460 CTGTATCTGCTGAGGAAAAATGG + Intergenic
1007179480 6:39918720-39918742 CACAAGATGCAGAGGAAAAATGG + Intronic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1008264810 6:49411882-49411904 CAGAATATGCAGCTTAAAAGTGG + Intergenic
1008679022 6:53852737-53852759 CTGAATTTGAAGATAAAAACTGG + Intronic
1008855284 6:56078042-56078064 CTAAATATTCATATAAAAAATGG + Intronic
1009283747 6:61785539-61785561 GTGTATATGCATATGAAAATTGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010484979 6:76399923-76399945 CTTAATATGCAGAAGAGAAACGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011500184 6:87979649-87979671 TTGAATATCCAGCTGAAAATAGG + Intergenic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012981523 6:105835453-105835475 CTTAAGAAGCAGATGAATAAAGG + Intergenic
1013281499 6:108641523-108641545 TTAAATATGCAAAAGAAAAATGG - Intronic
1013643828 6:112115867-112115889 CTAAATGTTCACATGAAAAATGG - Exonic
1013972989 6:116042588-116042610 CTAAATATGGACAGGAAAAACGG + Intronic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014106961 6:117575981-117576003 CTCAATATCCAGAATAAAAAGGG - Intronic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014871477 6:126601763-126601785 CTGATAATGCAGGTGAAAGAAGG - Intergenic
1014983304 6:127971949-127971971 CTGGCTATGGAGATGAGAAAGGG - Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015387177 6:132637122-132637144 CTAAATATGGAAAGGAAAAATGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015991823 6:138952783-138952805 CTGGATATCCATATGAAATATGG + Intronic
1016195379 6:141330234-141330256 CAAAATATGCTCATGAAAAAAGG - Intergenic
1016563965 6:145430760-145430782 CTGAAGATGAATATGAGAAATGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017373186 6:153736563-153736585 CAGAATATGGAGATGAAATGGGG - Intergenic
1017742561 6:157419886-157419908 CTGCCTATGGAAATGAAAAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019153840 6:170025942-170025964 CTGCATATGCAGGTTCAAAAGGG - Intergenic
1019170972 6:170133054-170133076 CCGAATAGGCAGATGAGAAGTGG - Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021418515 7:20418090-20418112 GTGAGTATGCACATGAAGAAAGG + Intergenic
1021595194 7:22308199-22308221 CTAAATGTGCATCTGAAAAATGG + Intronic
1021767100 7:23960783-23960805 AAGAATATGCTGATGAAAAGTGG - Intergenic
1021981589 7:26060657-26060679 CTGAAGAAGCAGATTAGAAAAGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022205839 7:28162828-28162850 CAAAATATGCAAGTGAAAAAAGG + Intronic
1023776424 7:43612045-43612067 CTGAATATACTGAGGAGAAAGGG - Intronic
1024803861 7:53112866-53112888 CTGAATATGAGGGTGAAAATGGG - Intergenic
1024877274 7:54040153-54040175 CAGAGTGTTCAGATGAAAAAAGG - Intergenic
1028122740 7:87074496-87074518 ATGAATATGTACAAGAAAAATGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028350659 7:89843102-89843124 ATGTATAACCAGATGAAAAAGGG - Intergenic
1028580763 7:92407765-92407787 GTGAGCATGCAGAAGAAAAAGGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1030113866 7:106048788-106048810 CTTGTTATGCAGATGAAAAAAGG + Intergenic
1030594210 7:111517388-111517410 CTGGCCATGCAAATGAAAAAAGG + Intronic
1030849145 7:114461014-114461036 TTGAGTGTGCAGAGGAAAAACGG + Intronic
1030881326 7:114883393-114883415 AGGAATATGGAGATGAACAAAGG - Intergenic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031668398 7:124514018-124514040 AGGAATTTGCAGATGTAAAAGGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1033058003 7:138077901-138077923 CTGAAAATGCAGATTAAGACAGG + Intronic
1033465974 7:141590149-141590171 CTGAATATGCACAAGAATATGGG - Intronic
1034310165 7:150080319-150080341 GTGAAGATGCAGATGAGAGAAGG - Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1034796680 7:154020301-154020323 GTGAAGATGCAGATGAGAGAAGG + Intronic
1036485979 8:9179036-9179058 CTGAATAGGCAGATTTAACAGGG - Intergenic
1037238215 8:16746310-16746332 CTGAACATGGAGTTGATAAAAGG + Intergenic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037791893 8:21951597-21951619 CTGAACATGCAAATCAGAAAAGG - Intronic
1038104144 8:24414523-24414545 TTGAAGATGCAGTTGAAAGAAGG - Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1038813032 8:30871014-30871036 CTGGCTTTGAAGATGAAAAAAGG - Intronic
1039124567 8:34186972-34186994 CTGAATGTGCAGATAAAAGATGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040398932 8:47028353-47028375 CAGAATAGGCAGACGATAAATGG + Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040835110 8:51723017-51723039 CTGTATGTGGAGATGCAAAATGG + Intronic
1041541749 8:58992811-58992833 TTGAAGATGGAGATAAAAAAGGG + Intronic
1041626171 8:60029840-60029862 TTGAATATGCATATTTAAAACGG - Intergenic
1042012361 8:64261491-64261513 CTAAATCTGGAGATGTAAAAAGG + Intergenic
1042387454 8:68193900-68193922 ATGAATGTGCTTATGAAAAATGG + Intronic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1043168632 8:76936061-76936083 CCAAATTTGAAGATGAAAAAAGG + Intergenic
1043677654 8:82978763-82978785 CTGGAGAAGCAGATGAAAATAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044541700 8:93415741-93415763 CTGAATATGTAGATAAATTATGG - Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046471673 8:114682937-114682959 CTGACCATGCAGAGTAAAAAAGG - Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1046801552 8:118434129-118434151 CTGAATATGCTGTTGAGTAAAGG - Intronic
1047806740 8:128368953-128368975 CTCATTTTGCAGATGAAAAAAGG - Intergenic
1047988844 8:130264709-130264731 ATGAATATGAACATGAGAAAGGG + Intronic
1048088439 8:131210501-131210523 CAAACTATGCATATGAAAAAAGG - Intergenic
1048499627 8:134963890-134963912 CTGCAGATGCAGGAGAAAAAGGG - Intergenic
1048538667 8:135322261-135322283 CTGAATATTTAGATGAGACAGGG + Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1050009777 9:1173486-1173508 CTGAATGTGCAATTGAAAACAGG + Intergenic
1051254397 9:15198033-15198055 TTGAATAAGAATATGAAAAATGG + Intronic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052366978 9:27623149-27623171 ATGAATAAGCACATAAAAAAAGG - Intergenic
1052566714 9:30162356-30162378 CTCAAGATGCAGAAGAAATATGG + Intergenic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1053722094 9:40956844-40956866 ATGAAGATGCAGATGACAAATGG + Intergenic
1053821358 9:41970246-41970268 CTGAATATGAAGACAAAAATAGG + Intronic
1054090235 9:60838398-60838420 CTGAATATGAAGACAAAAATAGG + Intergenic
1054111646 9:61113955-61113977 CTGAATATGAAGACAAAAATAGG + Intergenic
1054343877 9:63895129-63895151 TTGAAGATGCAGATGACAAATGG - Intergenic
1054609211 9:67217170-67217192 CTGAATATGAAGACAAAAATAGG - Intergenic
1056370699 9:85951377-85951399 CCAAATATGTAGTTGAAAAATGG + Intronic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059905991 9:118986977-118986999 CAGGATATGAAGATGAATAAGGG - Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1203453079 Un_GL000219v1:139113-139135 TTGAAGATGCAGATGACAAATGG - Intergenic
1185978946 X:4754915-4754937 CGCAATGTGCAGATGAAGAAGGG - Intergenic
1186780869 X:12910797-12910819 CAGAATCTGCAGAAGAAAATTGG + Intronic
1188149893 X:26659930-26659952 CTGAATATTCATGTGCAAAATGG + Intergenic
1188351039 X:29131048-29131070 CTGAATATGCATGTAAAACACGG - Intronic
1188709948 X:33383805-33383827 ATGAATATGCACAGGAAGAAAGG - Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1190176436 X:48154554-48154576 CTGAAAATGCAGAAAAAAATGGG - Intergenic
1190187141 X:48245142-48245164 CTGAAAATGCAGAAAAAAAATGG + Intronic
1190200803 X:48358898-48358920 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190281051 X:48930380-48930402 GGGAATTTGCAGATGAACAAGGG + Intronic
1190656034 X:52612922-52612944 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190725813 X:53189969-53189991 CTGAATCTGCAGGTGACAAGGGG - Intergenic
1190751566 X:53366484-53366506 CTGAGGATGGAGCTGAAAAATGG - Intergenic
1190804023 X:53818163-53818185 CTGAGGATGGAGCTGAAAAATGG - Intergenic
1191610894 X:63111990-63112012 CAACATATGCAGATAAAAAAAGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192729575 X:73789706-73789728 CTAAATATGGAAAGGAAAAATGG - Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1193991249 X:88310365-88310387 CTAAATATGGAAAGGAAAAACGG + Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194437913 X:93892568-93892590 CTGAACATGAAGGAGAAAAATGG - Intergenic
1194741072 X:97575034-97575056 CTGGATATGAGGATAAAAAAGGG + Intronic
1195291696 X:103436056-103436078 CTGATTGTGCAGATGAAATCTGG - Intergenic
1195491387 X:105474205-105474227 CTGGCTTTGAAGATGAAAAATGG + Intronic
1195521631 X:105837139-105837161 TAAAATATGCAGATAAAAAATGG + Intronic
1195701805 X:107711362-107711384 GAGAAAAAGCAGATGAAAAAAGG - Intergenic
1196578104 X:117345031-117345053 CTGTTTATGCAGATCAACAATGG + Intergenic
1196631634 X:117947437-117947459 ATGAAACTGCAGATGTAAAAGGG + Intronic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197568979 X:128125970-128125992 CTGAAAATGCAGAACAAAATTGG + Intergenic
1198007738 X:132515845-132515867 CTGATTTTGAAGATGAATAAGGG - Intergenic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1198425209 X:136511688-136511710 AAGAATATGCAGATGAAAAGGGG + Exonic
1198789613 X:140329787-140329809 ATGAATAGGCAGATGATAAATGG - Intergenic
1199019715 X:142863908-142863930 GTTAATATGCAGAACAAAAAAGG + Intergenic
1199714303 X:150495426-150495448 TTGGATATGCAGAAGAAATATGG + Intronic