ID: 1009486144

View in Genome Browser
Species Human (GRCh38)
Location 6:64224918-64224940
Sequence AAGAGGGGCCATTTTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009486144_1009486154 19 Left 1009486144 6:64224918-64224940 CCCAAGGAAAAATGGCCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 191
Right 1009486154 6:64224960-64224982 ACAGGCAGTGGGTTAGCATATGG No data
1009486144_1009486151 7 Left 1009486144 6:64224918-64224940 CCCAAGGAAAAATGGCCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 191
Right 1009486151 6:64224948-64224970 TCCTTCTCTTGCACAGGCAGTGG 0: 1
1: 0
2: 4
3: 36
4: 454
1009486144_1009486155 25 Left 1009486144 6:64224918-64224940 CCCAAGGAAAAATGGCCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 191
Right 1009486155 6:64224966-64224988 AGTGGGTTAGCATATGGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 121
1009486144_1009486149 1 Left 1009486144 6:64224918-64224940 CCCAAGGAAAAATGGCCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 191
Right 1009486149 6:64224942-64224964 TTCCTCTCCTTCTCTTGCACAGG 0: 1
1: 0
2: 5
3: 47
4: 436
1009486144_1009486153 8 Left 1009486144 6:64224918-64224940 CCCAAGGAAAAATGGCCCCTCTT 0: 1
1: 0
2: 2
3: 28
4: 191
Right 1009486153 6:64224949-64224971 CCTTCTCTTGCACAGGCAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009486144 Original CRISPR AAGAGGGGCCATTTTTCCTT GGG (reversed) Intronic
900410282 1:2509597-2509619 AAGAGGGGCCAATGTCCCTGTGG - Intronic
901581242 1:10245566-10245588 AGGAAGGATCATTTTTCCTTTGG + Intronic
904813491 1:33179356-33179378 AACATGGGCCATTTCTCCTGAGG + Intronic
905471641 1:38196608-38196630 AAGAGGGGCCCTTTGTACTTAGG + Intergenic
907255053 1:53172937-53172959 AAGAGGGGACATTTGTGTTTAGG - Intergenic
907373461 1:54017727-54017749 AAGAGCGGCCAGTTTTACTGGGG - Intronic
908823901 1:68115344-68115366 AGCAGGGGCAATTTATCCTTGGG - Intronic
910034016 1:82768345-82768367 TGGAGGGGCCTTTTTTCCTTTGG - Intergenic
911324784 1:96457692-96457714 GAGAGTGTCTATTTTTCCTTGGG + Intergenic
915090450 1:153420534-153420556 AAGATGGGCTATTTGTTCTTTGG + Exonic
915263741 1:154699107-154699129 AAGAGGAAACATTTTTCCTTTGG - Exonic
915776062 1:158487735-158487757 AAGATGAGGCATTTATCCTTGGG + Intergenic
920051953 1:203169633-203169655 CAGAGGTGCCACGTTTCCTTTGG + Intronic
920780720 1:208988562-208988584 AAGAGGGTGTGTTTTTCCTTGGG + Intergenic
920975140 1:210778667-210778689 AAGAGGGGCAGATTTTCCTCTGG + Intronic
921152322 1:212412440-212412462 CTGAGGGGGGATTTTTCCTTGGG - Intronic
923766453 1:236896541-236896563 AAGAAGAGACAGTTTTCCTTGGG - Intronic
1066518628 10:36191842-36191864 CAGTTGGGCCATTTTTACTTAGG - Intergenic
1068776773 10:60875761-60875783 AGGAAGAGCCATTTTTGCTTGGG + Intronic
1070487194 10:76942453-76942475 AAGAGTGCCCTTTTTTTCTTTGG + Intronic
1070534251 10:77363297-77363319 ACCAGGGCCCATTTTGCCTTTGG - Intronic
1070855443 10:79604879-79604901 ACGAGGGGCCATTATTGCTCTGG + Intergenic
1071818812 10:89259869-89259891 GAGAGGGGACATTTTTCTTTGGG + Intronic
1072464039 10:95646745-95646767 AAGAGGGGACAGATTTTCTTTGG - Intronic
1073146591 10:101285520-101285542 GAGAGGGGCTTCTTTTCCTTCGG + Intergenic
1076420123 10:130325612-130325634 AAAAGGGGCTATTTCCCCTTTGG - Intergenic
1077459612 11:2702256-2702278 AAACGTGGCCATTTTTCTTTGGG + Intronic
1079338133 11:19589322-19589344 AGGTGGTCCCATTTTTCCTTTGG - Intronic
1079424462 11:20326899-20326921 AAGGGAGGCCTTATTTCCTTTGG + Intergenic
1080033965 11:27692026-27692048 AAAATTGGCTATTTTTCCTTTGG - Intronic
1081139971 11:39486251-39486273 AAGAAAGTTCATTTTTCCTTTGG + Intergenic
1081756194 11:45546422-45546444 AAAAGGAGCCATTTCCCCTTTGG - Intergenic
1085315989 11:75545205-75545227 CAGAGGGGGCATTGTTCCTTTGG + Intergenic
1086975011 11:93121275-93121297 ATGGGGAGCCATTTCTCCTTTGG - Intergenic
1088063835 11:105690979-105691001 AGGAAGGGCCAGTTTTTCTTTGG + Intronic
1088212568 11:107472973-107472995 CAGCTGGGGCATTTTTCCTTAGG - Intergenic
1088237542 11:107741755-107741777 GAGTGGGGCCATCTTTCCTGTGG - Intergenic
1089103190 11:115981396-115981418 TAGACAGGCCACTTTTCCTTTGG + Intergenic
1090187898 11:124750336-124750358 AATAGGGGCCCTTGTTCCTTTGG + Intronic
1097746806 12:63312072-63312094 ATGAGGGGCCACTTTTGCTCTGG + Intergenic
1100789560 12:98115553-98115575 ACAAGGGGCCATTTCTCCTTTGG + Intergenic
1101075685 12:101127402-101127424 AAGAAGGGGCATGTTTCCCTGGG - Intronic
1102595048 12:113985931-113985953 AAAAAGTGCCATTTTTCTTTGGG + Intergenic
1103953702 12:124565566-124565588 AAAAGGGGCCACCTTACCTTTGG - Intronic
1106032721 13:26017424-26017446 AAGAGGAGACGTCTTTCCTTGGG - Intronic
1106264090 13:28094411-28094433 AAGAGGAACCATTTTTTTTTAGG - Intronic
1106869611 13:34004624-34004646 AAGAGGGTCTATTTTTTCTATGG + Intergenic
1107526682 13:41239790-41239812 AAGAGGGGCAACTTTGCCTAGGG + Intronic
1110674218 13:78220727-78220749 AAGATTGGCCAGTATTCCTTTGG + Intergenic
1112309670 13:98307364-98307386 AGGAGGAGCCACTTTTCATTAGG - Intronic
1112551234 13:100422885-100422907 AAGAGGGGTCACGTTTCCTATGG + Intronic
1112662842 13:101532946-101532968 TAGAGGGGCCATATTTCCAATGG + Intronic
1112823273 13:103360617-103360639 AATAGGTACGATTTTTCCTTTGG + Intergenic
1112877394 13:104060902-104060924 AAGATGGCCCATTTTTCACTTGG + Intergenic
1116721898 14:48507707-48507729 ATGAGAGGCCATTTTTCCCCGGG + Intergenic
1116770202 14:49118585-49118607 AAAAGGGGCCATTTCTTCTTTGG + Intergenic
1118022745 14:61735760-61735782 GAGAGGGGCCATATTTTCTTTGG - Intronic
1119034164 14:71215762-71215784 AAGAGGCACCCTTTTTCCATGGG + Intergenic
1119690108 14:76664966-76664988 ATCAGGGGCCCTTTTCCCTTGGG - Intergenic
1119844933 14:77822204-77822226 AAGAGGGGCAATTTTGGCGTGGG + Intronic
1119983019 14:79103287-79103309 AGGAGGGGCCATATGTACTTAGG + Intronic
1120323859 14:83000873-83000895 AAGAGGGGCAATTTTTTCTTTGG + Intergenic
1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG + Intronic
1121504119 14:94463197-94463219 AAGAGGGGCCATCCTTCGATCGG + Exonic
1125040954 15:35186812-35186834 AACTGGGGCCCCTTTTCCTTTGG + Intergenic
1127501388 15:59557110-59557132 GAGAGGGACCATCTTGCCTTAGG + Intergenic
1128870347 15:71150468-71150490 CAGAGGGGCAATTATTCTTTGGG - Intronic
1129145261 15:73641351-73641373 GGGAAGGGCCATTTGTCCTTTGG + Intergenic
1130620082 15:85453356-85453378 CAGTGGGGCCACTTTTCCCTAGG + Intronic
1133673575 16:8047869-8047891 GAGAGGGGCCATTTGTGCTGTGG + Intergenic
1135961280 16:26996414-26996436 ATCAGGGGCCAGTCTTCCTTGGG - Intergenic
1137553163 16:49454222-49454244 AAGAGGAGCCATTTTTCCCCAGG - Intergenic
1138703983 16:58895151-58895173 AGGAGTGGACATTTTTCCTCTGG + Intergenic
1139043433 16:63028676-63028698 AAGTGGGGCCTTTTCTGCTTAGG - Intergenic
1140032888 16:71352577-71352599 GAGAGGGGCCTATTTCCCTTAGG - Intergenic
1140261873 16:73387575-73387597 AAAAGAGGCTATTTTTCCGTGGG - Intergenic
1143771248 17:9170437-9170459 AAGAGGGGCCGGTTCTCCTGAGG - Intronic
1143926014 17:10371020-10371042 AGGAGAAGCCATTCTTCCTTTGG + Intronic
1149180179 17:53926842-53926864 CAAAGGGGCTATTTTTCATTTGG - Intergenic
1155034458 18:22013967-22013989 TAGAGTAGCCATTTTTCCTATGG + Intergenic
1155361948 18:25011780-25011802 AACAAGTGCCATTCTTCCTTTGG - Intergenic
1157609381 18:48946843-48946865 AAGAAAGGCCATGTTCCCTTGGG - Intronic
1161048916 19:2151693-2151715 AAGAGGTGCCACATTTCCATTGG - Intronic
1161795695 19:6385421-6385443 AAGAGATGGCATTTCTCCTTTGG + Intronic
1161857767 19:6775496-6775518 AAGAGGGGACATTTGTGCTGGGG + Intronic
1162559883 19:11410827-11410849 AAAATGGGTCATTTTTCCTGAGG - Intronic
1163739946 19:19005294-19005316 TACGAGGGCCATTTTTCCTTTGG - Intronic
1163831945 19:19551143-19551165 AAGAGAGGGCATTTTGACTTGGG + Intergenic
1165420612 19:35720290-35720312 AAGATGGGACAATTGTCCTTGGG + Exonic
1166825914 19:45608938-45608960 ATGAGGGACCATTGTTACTTAGG - Intronic
1167463592 19:49638895-49638917 AGGAGGGGCTGGTTTTCCTTGGG + Intronic
1167507143 19:49876797-49876819 AGGCGGGGCCATTTTTCTTAGGG - Exonic
925722312 2:6841131-6841153 ATGAGGGGCCATTGTCACTTTGG + Intronic
926599799 2:14830204-14830226 TAGAGGGGCCATCTTTTCTTAGG + Intergenic
928518117 2:32063226-32063248 GAGATGGGCCAATTATCCTTCGG + Intergenic
929578648 2:43068325-43068347 AAGAGGGGCCTTTTGTTCTCTGG - Intergenic
931259014 2:60600393-60600415 AAGAGGGACCATTCTCCCATGGG - Intergenic
933368680 2:81388133-81388155 ACGAGGGGCCATTGTTACTTTGG - Intergenic
934783772 2:96989842-96989864 AGGAGGGGCCATTGTCGCTTTGG + Intronic
936695243 2:114938658-114938680 AAGAAGTGACATTTTTCCTTAGG + Intronic
939316331 2:140554552-140554574 AAAAGAAGCCATTTTACCTTGGG - Intronic
939600461 2:144183058-144183080 AAGAGGGACTAATTTTTCTTAGG - Intronic
941527819 2:166628415-166628437 GAGACAGGCCTTTTTTCCTTAGG + Intergenic
942511428 2:176706648-176706670 AATAGGAGCCATTTTTGTTTGGG - Intergenic
942539088 2:176996393-176996415 AAAAGGGGCCATTTTAGCTATGG - Intergenic
944595882 2:201260299-201260321 TGGATGGGCCATTTTACCTTTGG - Intronic
947793807 2:232882145-232882167 AGGGGGCGCCATTTGTCCTTGGG - Intronic
1169415783 20:5415126-5415148 AAGAGGGACCTTTTTCCCATGGG + Intergenic
1169889289 20:10435128-10435150 AACAGAGGCCATTTTTCTTTTGG + Intergenic
1169927919 20:10802352-10802374 GAGTAGGGCCATTTTTCCCTCGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173384530 20:42575324-42575346 AAGAGGGGCCATTTTCCCAGAGG + Intronic
1174994753 20:55553543-55553565 AGGAGAGGCCATATTTCCTGAGG - Intergenic
1175573962 20:60046567-60046589 CACAGGGCCCATTCTTCCTTGGG - Intergenic
1176368443 21:6047813-6047835 AAAAGGTAACATTTTTCCTTTGG + Intergenic
1178186305 21:30225890-30225912 AAGAAGGGAAATTTTTCCTGGGG + Intergenic
1179620500 21:42612433-42612455 ATTTGGGGCAATTTTTCCTTGGG - Intergenic
1179755076 21:43490729-43490751 AAAAGGTAACATTTTTCCTTTGG - Intergenic
1181937166 22:26447227-26447249 AAGAGAGGCCACTTTTTATTAGG + Intronic
1183957319 22:41388713-41388735 AACAGGAGCCATGTCTCCTTTGG - Intronic
1184061589 22:42085735-42085757 AAGATGGGCTAGTTTTCCTTGGG - Exonic
1184806771 22:46799924-46799946 AAGAGCTCCCCTTTTTCCTTTGG + Intronic
951593787 3:24295308-24295330 AAGAAGGTACATTTTTCTTTGGG + Intronic
952250046 3:31644392-31644414 ATTTGGGGCCATTTTCCCTTGGG - Intergenic
954651337 3:52165363-52165385 ACAAGGTGCCAGTTTTCCTTAGG - Intergenic
956068876 3:65426439-65426461 AGAACGGGCCATTTTTACTTTGG - Intronic
957217330 3:77337320-77337342 AAGAGATGCCATTTTTCTTAGGG - Intronic
960233145 3:115252592-115252614 AAGAGGAGCAATTTCTTCTTGGG + Intergenic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
966383009 3:179362433-179362455 AAGAGGGCACATTTTGCTTTTGG - Exonic
966417319 3:179702539-179702561 AAGAGGGGACATTTGTGCTTGGG + Intronic
967045627 3:185734077-185734099 AAGAGGGTGCACATTTCCTTAGG + Intronic
969316621 4:6385348-6385370 AAGAGAGGCAACTTTTCCTAAGG - Intronic
969398679 4:6939328-6939350 AAAGGGGGCCATTCTTCCTGGGG - Intronic
973130651 4:46644137-46644159 AAGAGTGGCCCTTCTTGCTTAGG - Intergenic
973188268 4:47356583-47356605 CAGAAGGGCCATTTTACCTACGG - Intronic
974565412 4:63574332-63574354 ATGAGGGGCCATTACTACTTGGG + Intergenic
977875704 4:102147521-102147543 TATAGTGGCCACTTTTCCTTTGG - Intergenic
979731692 4:124030527-124030549 AAGATGGGACATTTGGCCTTTGG + Intergenic
979738167 4:124115664-124115686 AAGAGGGGACATTTGTTCTATGG + Intergenic
980440207 4:132833211-132833233 AAAAGGGCCCAAGTTTCCTTGGG + Intergenic
981215415 4:142160211-142160233 AATAGGCCACATTTTTCCTTAGG - Intronic
982560527 4:156923994-156924016 AAGAGGGGCCATTTCTTCTCAGG - Intronic
982602501 4:157469721-157469743 AAGAGGAGGCATTTTCCCTCAGG + Intergenic
983369417 4:166839900-166839922 AAGAGGGGCTAATTTCACTTCGG + Intronic
986468974 5:8055181-8055203 AAGAGCAGCAATTTTTCCTCAGG + Intergenic
987431007 5:17833051-17833073 AAGCCAGGCCATTCTTCCTTTGG + Intergenic
989391549 5:40905838-40905860 GAGAGGGGACATTTTTACTTTGG - Intergenic
990810503 5:59717024-59717046 AGGAGAGCCCTTTTTTCCTTAGG + Intronic
996419779 5:123249596-123249618 AAGAGGCAGCATTTTTCTTTAGG - Intergenic
1000325653 5:160170143-160170165 AACAGGGGCCATTATTGTTTTGG - Intergenic
1000950753 5:167479608-167479630 TAAAGGGCCCATTTTTCCTTTGG - Intronic
1001011833 5:168105696-168105718 AAGAAATGCCATTTTTCCTGAGG - Intronic
1001099072 5:168799067-168799089 CAAAGGGGCCATTTTCCCTGTGG - Intronic
1001592914 5:172878628-172878650 GAGATGGACCTTTTTTCCTTTGG + Intronic
1003035291 6:2636284-2636306 AAGAGGGTCCATTTTATGTTAGG - Intergenic
1004417166 6:15435541-15435563 AAGTGGGGTCATTTCTCCTTGGG + Intronic
1004864746 6:19841637-19841659 AAGAGTTGGCATTTTCCCTTTGG + Intergenic
1005237997 6:23788460-23788482 AGGAGGGACCATGATTCCTTTGG - Intergenic
1006900714 6:37499344-37499366 AAAAGGGGAAATTTTTCCTCCGG - Intronic
1007221629 6:40283419-40283441 AAGAAGGGCCATTTTCGCTGGGG + Intergenic
1009486144 6:64224918-64224940 AAGAGGGGCCATTTTTCCTTGGG - Intronic
1009520044 6:64670178-64670200 AAGAAAGTCTATTTTTCCTTAGG + Intronic
1010778906 6:79920765-79920787 AAGAGGGTCTTTTTTCCCTTAGG + Intronic
1011253012 6:85392914-85392936 AATAGGGACTATTTTCCCTTTGG - Intergenic
1012024962 6:93977682-93977704 ATGAAGGGAAATTTTTCCTTAGG + Intergenic
1013648742 6:112171981-112172003 AAGAGGGGCCATCTTTTGATAGG - Intronic
1014276512 6:119395706-119395728 ATGAGGGGCCATTATTGCTCTGG + Intergenic
1016058345 6:139602516-139602538 AAGAGGGGCCCTTTTATCTAGGG - Intergenic
1017361808 6:153581851-153581873 AAAAGGGCTCATGTTTCCTTTGG - Intergenic
1021791660 7:24212007-24212029 AAGAGAGGCCATTTTTGGTGGGG - Intergenic
1021805114 7:24347772-24347794 AAGTGGGATCATTTTTCCTCTGG + Intergenic
1023087085 7:36581570-36581592 AAGAGGGGTTATTTTTCTTTGGG + Intronic
1030739580 7:113092321-113092343 AAGAGGAGCCATATTTCTTATGG + Intergenic
1031991604 7:128202469-128202491 AAGTGTGGACATTTCTCCTTGGG - Intergenic
1033049799 7:137993902-137993924 AAGATGGGCCATTTTATCTATGG - Intronic
1034047779 7:147947943-147947965 AATAGAGACCATGTTTCCTTTGG - Intronic
1035052680 7:156010571-156010593 AAGAGGGGCCCTTGCTCCATCGG - Intergenic
1036397696 8:8383041-8383063 AATAGGGACCATTTTGCCTTAGG + Intronic
1037659858 8:20917158-20917180 AAAAAAGGACATTTTTCCTTGGG - Intergenic
1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG + Intergenic
1038066856 8:23972413-23972435 CAGAGGGATCATTTTTCCATCGG - Intergenic
1038885974 8:31663445-31663467 AGGAGGGGCCATTCTTTTTTGGG + Intronic
1040046126 8:42965463-42965485 AAGAAGGGCCCTTTGACCTTTGG + Intronic
1042046408 8:64657319-64657341 ATGAGGATCCATTTTTCCCTTGG + Intronic
1042973039 8:74432146-74432168 ATTGGTGGCCATTTTTCCTTTGG + Intronic
1043342364 8:79255637-79255659 AAGAGGTGGCACTTTTGCTTTGG - Intergenic
1044114599 8:88319604-88319626 CAGTGGGGGCATTTTTCCGTGGG - Intronic
1044864994 8:96562359-96562381 AAGAGGTGGCATCTTTCCCTGGG + Intronic
1045288698 8:100813362-100813384 AAAATGGACCATTTTTCCTTTGG + Intergenic
1049499838 8:142955952-142955974 AAGAGGGGCCATGTTTCTGGTGG + Intergenic
1052421581 9:28249886-28249908 AAGGGGAACCATTTTTCCTTTGG + Intronic
1053137608 9:35661246-35661268 AAGAAGGCCCAGTTGTCCTTAGG - Exonic
1056463805 9:86834530-86834552 AAGAGTGGCCATTATTCTGTTGG - Intergenic
1058426392 9:104878614-104878636 GAGAGGGGCCATATTTGTTTTGG + Intronic
1058646721 9:107137825-107137847 AAGATGAGATATTTTTCCTTCGG - Intergenic
1059312211 9:113396467-113396489 AAGGGGGCCAATATTTCCTTAGG + Intronic
1059781543 9:117533498-117533520 AAGACGGGCCATCTATCTTTAGG - Intergenic
1060226985 9:121798513-121798535 AAAAGGGGCCATTTTTCTGTTGG - Intergenic
1186411266 X:9346471-9346493 AATAGGGGCCTTTTTTCACTTGG - Intergenic
1186985745 X:15011698-15011720 GTGAGGGGCCATTTTGTCTTGGG - Intergenic
1187484798 X:19693385-19693407 AAGAGGGCCCATCTCTCCATCGG - Intronic
1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG + Intergenic
1190102440 X:47531993-47532015 AAGAGGAGCCAACTTTCCATAGG + Intergenic
1190160248 X:48026999-48027021 AGGAGAGGCCATTTCTCATTTGG + Intronic
1190172480 X:48122477-48122499 GACAGGGAACATTTTTCCTTAGG + Intergenic
1190178125 X:48168128-48168150 GACAGGGAACATTTTTCCTTAGG + Intergenic
1190180020 X:48184303-48184325 GACAGGGAACATTTTTCCTTAGG - Intergenic
1190184094 X:48219770-48219792 GACAGGGAACATTTTTCCTTAGG + Intronic
1190190028 X:48269219-48269241 GACAGGGAACATTTTTCCTTAGG + Intronic
1190193037 X:48293523-48293545 GAAAGGGAACATTTTTCCTTAGG - Intergenic
1190199012 X:48344502-48344524 GACAGGGAACATTTTTCCTTAGG - Intergenic
1190665772 X:52694970-52694992 GACAGGGAACATTTTTCCTTAGG - Intronic
1190673646 X:52763440-52763462 GACAGGGAACATTTTTCCTTAGG + Intronic
1192046949 X:67686062-67686084 AAGATGGACAATTTTTCCTTCGG - Exonic
1192368909 X:70497557-70497579 TAGAGGAGCCATTTTTCTTTTGG - Intronic
1193214895 X:78852312-78852334 AAAGGGGGCTTTTTTTCCTTTGG + Intergenic
1193553889 X:82930885-82930907 ATGAGGGGCCATTTTCACTCTGG - Intergenic
1195878573 X:109568711-109568733 AAGAGGGCACATTTTGCTTTTGG - Intergenic
1195969783 X:110460772-110460794 AAGCAGGGCCATTTTTGCTCAGG - Intergenic
1201274008 Y:12282063-12282085 AAGAGGCACCATTTTTCATCTGG + Intergenic
1202028041 Y:20545139-20545161 ATGAGGGGCCATTGTCTCTTTGG - Intergenic