ID: 1009486248

View in Genome Browser
Species Human (GRCh38)
Location 6:64225835-64225857
Sequence GATTACCTATTATCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009486248 Original CRISPR GATTACCTATTATCAAAGAC AGG (reversed) Intronic
903492427 1:23739650-23739672 GAGTACCTATGATTACAGACAGG + Intergenic
909125112 1:71657742-71657764 CATTATCTATTATCAAAGGAGGG - Intronic
909330625 1:74405728-74405750 GATTTCCTATGATCAACTACTGG + Intronic
911907971 1:103593976-103593998 TAGTACCTGTTATGAAAGACTGG + Intergenic
912078870 1:105911344-105911366 GGTTGCCTATTCTCAAAGAAAGG - Intergenic
912120273 1:106462763-106462785 AATTTCCTGTTTTCAAAGACTGG + Intergenic
918272398 1:182914809-182914831 GATCACCAATTAAAAAAGACAGG + Intronic
923533885 1:234833411-234833433 GAATAACTATTTTCAGAGACAGG + Intergenic
923757346 1:236804006-236804028 TATTACCTGTTACCATAGACTGG + Intronic
923865627 1:237936191-237936213 GATTGCCTATTATCAGAGGTAGG + Intergenic
1063441402 10:6076161-6076183 GATTAATTATAATCAAAGTCTGG + Intergenic
1065542688 10:26785784-26785806 TACTACCTATTATCAAAGTTTGG + Intronic
1068246751 10:54381712-54381734 TATTACCTATTCTGCAAGACAGG - Intronic
1071419911 10:85482988-85483010 GGATAGCTATTATCAAAGAATGG - Intergenic
1077600307 11:3570096-3570118 GATTCCCTATTAGCAGGGACTGG + Intergenic
1080752936 11:35167399-35167421 GATTATCTATTTTTAAAGCCAGG - Intronic
1080941355 11:36921941-36921963 AATTACCTATTAGTGAAGACAGG + Intergenic
1089287728 11:117418365-117418387 GATTACCTATTATGTTAGGCTGG + Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092948621 12:13479722-13479744 TATTACCTATTATGAAACACAGG + Intergenic
1093500513 12:19806549-19806571 GATTACATATTTCCAAAGAAAGG - Intergenic
1093622484 12:21308715-21308737 GATAACCTGTTATCCTAGACAGG - Intronic
1096976448 12:55701800-55701822 TATTACCTATTATTAAAGCCTGG + Intronic
1097002438 12:55888913-55888935 GAAAACCAATTATCAAAGCCAGG + Intergenic
1099708553 12:86189577-86189599 GATTTCCTATTAGCAAATAAGGG + Intronic
1099839986 12:87953298-87953320 CATAACCTTTCATCAAAGACAGG - Intergenic
1100389617 12:94137071-94137093 GCTTGCCTATTCTCAAAGTCTGG + Intergenic
1100945915 12:99783842-99783864 GATTATATATTTTCAAATACTGG + Intronic
1103127078 12:118432865-118432887 GACTGCCTATTTTCAAAGACTGG + Intergenic
1109152680 13:58863133-58863155 GAGTACCTATTATCTAATAAAGG + Intergenic
1109868422 13:68298032-68298054 AATTATCTCTTATAAAAGACAGG - Intergenic
1111097361 13:83533657-83533679 GATTGCCCATTCTGAAAGACAGG - Intergenic
1112594832 13:100798118-100798140 TTTTTCCTATTATCAGAGACAGG - Intergenic
1115835738 14:37399879-37399901 GGTCACCTATTGCCAAAGACTGG + Intronic
1116340713 14:43720076-43720098 GATTACCTATTTTCAAATTAGGG + Intergenic
1116421795 14:44741801-44741823 GTTTATCTATTATGAAAGATTGG + Intergenic
1118334989 14:64845670-64845692 AATTTCCTATTGTCAAAGGCTGG - Intronic
1126009103 15:44285637-44285659 GATAACATATTCTAAAAGACAGG + Intergenic
1131717824 15:95132613-95132635 CATTACCTATTATCAAGAAGGGG - Intergenic
1134911896 16:18035015-18035037 GATTCCCTTATATCAAAAACAGG + Intergenic
1139836189 16:69840461-69840483 AATTACATATTTACAAAGACTGG - Intronic
1140315194 16:73889564-73889586 AAGTACCTATGATCAAAGAGGGG + Intergenic
1144571896 17:16405557-16405579 GATTAGTGATTATCAGAGACTGG + Intergenic
1145872422 17:28285925-28285947 GAATAGGTATTACCAAAGACAGG - Intergenic
1158076873 18:53540653-53540675 GAATAGATATTAGCAAAGACGGG - Intergenic
1158641371 18:59206820-59206842 AATTACCTATCAGCAAAGAGAGG - Intergenic
1162645597 19:12047784-12047806 GATTATCTATTAGTAGAGACAGG - Intronic
1163052022 19:14691608-14691630 GATTATGTCTTATGAAAGACAGG + Intronic
926538721 2:14147454-14147476 GATTCCATGTTATAAAAGACAGG - Intergenic
928058952 2:28090097-28090119 TAATACCTGTTAACAAAGACAGG - Intronic
928412840 2:31067612-31067634 GTTTACCCAGTTTCAAAGACAGG + Intronic
930600434 2:53436587-53436609 GATCACCCATTACCACAGACTGG + Intergenic
931068734 2:58619961-58619983 CATTTCCTATTCTGAAAGACTGG + Intergenic
933319416 2:80754873-80754895 GAATGCCTATTATCAAAGACAGG + Intergenic
941297413 2:163757390-163757412 GATTATATATAATCAATGACAGG + Intergenic
943405330 2:187476262-187476284 GATTAGATATAATCAAAAACTGG + Intronic
944823117 2:203451659-203451681 GAATACCTATTAAGAAAGAAAGG + Intronic
948372389 2:237497721-237497743 GATTAGCAATGATGAAAGACAGG - Intronic
1182636548 22:31732062-31732084 GATTACCTATCCTGAAAGAATGG - Intronic
952637093 3:35545610-35545632 AATTACCTATCAGCAAAGAGAGG + Intergenic
956455101 3:69412958-69412980 GGTTACCTATTATCACCGATGGG + Intronic
957156199 3:76548431-76548453 TCTTACCCATTCTCAAAGACAGG - Intronic
958632557 3:96701585-96701607 GGTTGCCTATTCTGAAAGACAGG - Intergenic
958824706 3:99016363-99016385 CATTACCAAATATCACAGACTGG + Intergenic
959365684 3:105455062-105455084 GAATAAGTATTATCAAAGACAGG - Intronic
959421456 3:106134977-106134999 GAGTTCCTATTTTAAAAGACTGG + Intergenic
959863234 3:111238895-111238917 GATTACATATTATAAAATGCTGG - Intronic
960312545 3:116134062-116134084 CATTACCTAGAATAAAAGACGGG + Intronic
961103702 3:124223095-124223117 AATTAACTGTTATCAGAGACAGG - Intronic
961343432 3:126245722-126245744 GGTTGCCTATTCTGAAAGACAGG + Intergenic
963251308 3:143105677-143105699 GATTACCTATCCACAAAGAGAGG - Intergenic
963434050 3:145245144-145245166 AATTACCTATTAGTAAAGAGAGG + Intergenic
963761354 3:149289541-149289563 GGTTGCCCATTATGAAAGACAGG - Intergenic
965371747 3:167871264-167871286 GATGACCTACTATCAAATAAGGG + Intergenic
965655807 3:170983406-170983428 TATTATCTATTATCAAAAAGAGG - Intergenic
972031777 4:34469198-34469220 GAATGCTGATTATCAAAGACAGG - Intergenic
973146129 4:46829621-46829643 AATTACTTATTATTAAAGAAGGG + Intronic
974351886 4:60759048-60759070 GATTACAGATAATCAAAGAGAGG + Intergenic
976450425 4:85183422-85183444 GAATAGCTATTATCAAAAAGAGG - Intergenic
980662554 4:135882812-135882834 GATTACCAATTACCAAAGATTGG - Intergenic
980768879 4:137345717-137345739 GATTCCCTATTATCCAAGCTTGG + Intergenic
982613974 4:157616569-157616591 GATTATCTATTTTTGAAGACTGG + Intergenic
988888455 5:35586120-35586142 GATTAACTATTAGTAAAGATAGG + Intergenic
990040708 5:51376480-51376502 GACTATCTATTAACAAAGCCAGG + Intergenic
1001431437 5:171665757-171665779 GAGCACCTATCATCAAACACAGG - Intergenic
1003116390 6:3286585-3286607 GTCTACCTATTAGCAAAGACTGG + Intronic
1003332097 6:5137739-5137761 GTTGCCCTATTCTCAAAGACAGG + Intronic
1003543661 6:7040167-7040189 GATTAGCTAATATCAAACTCAGG - Intergenic
1003747865 6:9023526-9023548 GATTCCCTATTGCCACAGACTGG + Intergenic
1005376336 6:25186265-25186287 GATTACATATTTTAAAAGGCGGG + Intergenic
1007080019 6:39093585-39093607 GGTTACAGATTGTCAAAGACTGG - Intergenic
1008821761 6:55641189-55641211 TATGAGCTATTATAAAAGACAGG + Intergenic
1009486248 6:64225835-64225857 GATTACCTATTATCAAAGACAGG - Intronic
1011300825 6:85871650-85871672 AATTACCTCTTAACAAAGAAAGG - Intergenic
1014242885 6:119037459-119037481 AATGAACTATTATCAAAGCCAGG - Intronic
1014618466 6:123634549-123634571 GTATACCTTTTATAAAAGACTGG + Intronic
1015006818 6:128292700-128292722 GATTATCTATTACCTGAGACTGG - Intronic
1016562708 6:145414796-145414818 GATAGCATATTATCAAAGGCAGG - Intergenic
1016603914 6:145896532-145896554 CATTTGCTTTTATCAAAGACTGG + Intronic
1017083260 6:150689046-150689068 GATTAGAAGTTATCAAAGACAGG - Intronic
1021591179 7:22264460-22264482 GATTGCATAATGTCAAAGACTGG - Intronic
1023581825 7:41691807-41691829 GATTACTTATTAACAAATAGAGG + Intronic
1028751817 7:94391528-94391550 GTTTACCTTTGATCAAAGAAAGG + Intergenic
1029854177 7:103496897-103496919 GAATACCTAATATCAAAGTCAGG - Intronic
1029934170 7:104405909-104405931 CATTACCTATTACATAAGACAGG - Intronic
1030293298 7:107893022-107893044 GATTAGTTATTGTCAAAGAGGGG + Intronic
1031233040 7:119134711-119134733 CATTACAAATTATCACAGACTGG - Intergenic
1031841536 7:126746610-126746632 GATTACAAATTATCAAAACCAGG - Intronic
1033169109 7:139067646-139067668 GATTACCTAGTAGTAAAGTCAGG - Intronic
1036591878 8:10175723-10175745 GATTACCTATGTACAAGGACTGG - Intronic
1037692703 8:21195687-21195709 TATTACCTGTTATCATTGACAGG + Intergenic
1039734254 8:40313954-40313976 GATTATCTGATATCAAAGATGGG - Intergenic
1040674750 8:49735139-49735161 GATTTCCTATAATGTAAGACTGG - Intergenic
1042169028 8:65974463-65974485 GATAACATAATATCTAAGACTGG - Intergenic
1042272449 8:66968737-66968759 GATTACCTTTTATTAAAGAGAGG + Intronic
1042583822 8:70312963-70312985 AAATACATATTAGCAAAGACAGG + Intronic
1043657719 8:82691542-82691564 GATTGCTGATTACCAAAGACTGG + Intergenic
1052051764 9:23857082-23857104 ATTTACCTATTATCACACACTGG - Intergenic
1055711282 9:79064460-79064482 GATTGACTATAAACAAAGACAGG - Intergenic
1056357350 9:85814932-85814954 TGCTACCCATTATCAAAGACAGG - Intergenic
1057414225 9:94847049-94847071 GTTTACCCACTATCAAAGATGGG + Intronic
1057539333 9:95950893-95950915 TTTTACCTATTATGAAAGTCAGG - Intronic
1059813677 9:117886690-117886712 GTTTTCCTATTTTCAGAGACAGG - Intergenic
1060257413 9:122044807-122044829 GGATAACTATTATCAAAAACAGG + Intronic
1185965667 X:4599138-4599160 GATTACTGATTACCAGAGACTGG + Intergenic
1186748146 X:12591986-12592008 GATTTCCTCTTCTCCAAGACAGG + Intronic
1186898661 X:14030337-14030359 GTTAATCTATTTTCAAAGACTGG - Intergenic
1189472693 X:41326475-41326497 GATTACATATCATACAAGACAGG + Intergenic
1190164537 X:48062053-48062075 CCTTACATATTATCAAAGATGGG + Intronic
1194073104 X:89351510-89351532 CATTTCCTTTTCTCAAAGACAGG - Intergenic
1194708874 X:97208904-97208926 CATTACCTATTGATAAAGACTGG - Intronic
1195071105 X:101280941-101280963 GATTACCAAGTGTCAGAGACTGG + Intronic
1195743097 X:108086336-108086358 AATAACCTATAATAAAAGACGGG + Intronic
1196539152 X:116884319-116884341 GGTTTCCTTTTAGCAAAGACTGG - Intergenic
1200727339 Y:6687250-6687272 CATTTCCTTTTCTCAAAGACAGG - Intergenic
1200728491 Y:6703025-6703047 CATTTCCTTTTCTCAAAGACAGG - Intergenic
1201340104 Y:12924714-12924736 GGTTACCCATTCTGAAAGACAGG + Intergenic