ID: 1009491956

View in Genome Browser
Species Human (GRCh38)
Location 6:64302500-64302522
Sequence CCATAAATGCAAAAGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009491956_1009491962 8 Left 1009491956 6:64302500-64302522 CCTTTCAACTTTTGCATTTATGG 0: 1
1: 0
2: 5
3: 20
4: 339
Right 1009491962 6:64302531-64302553 ACAAAAATTGAAACTGATAATGG 0: 1
1: 27
2: 30
3: 104
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009491956 Original CRISPR CCATAAATGCAAAAGTTGAA AGG (reversed) Intronic
900256174 1:1699488-1699510 ACATAAATGTAAACATTGAATGG + Intronic
900264843 1:1752098-1752120 ACATAAATGTAAACATTGAATGG + Exonic
907205702 1:52768753-52768775 CTAAAAATGCAAAAATTAAATGG - Intronic
907900401 1:58735911-58735933 CCATACATGCAATATTTGAAAGG - Intergenic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908677955 1:66627320-66627342 CAACAAAAGCAAAAGTGGAAAGG + Intronic
908762846 1:67527798-67527820 CCATAAAATCATAATTTGAATGG + Intergenic
909273667 1:73656947-73656969 TCAGAGATGCAAAAGTTAAATGG - Intergenic
909500876 1:76334346-76334368 CCACAAAAGCAAAAGGTAAATGG - Intronic
909699372 1:78504684-78504706 ACATAAATACAAATGATGAATGG - Intronic
909953893 1:81753876-81753898 CCCTAAAGGCAAATGTTTAAAGG + Intronic
910588101 1:88900830-88900852 GCCCAAATGCAAGAGTTGAATGG - Intergenic
912328274 1:108790222-108790244 ATATAACTTCAAAAGTTGAAAGG - Intronic
912602710 1:110954048-110954070 AAATAAATACAAAAGTTCAAGGG + Intronic
913402362 1:118449883-118449905 CAATTAAGGCAGAAGTTGAAGGG - Intergenic
914007865 1:143749002-143749024 CAATCATTGCAGAAGTTGAAGGG + Intergenic
915955660 1:160218080-160218102 TCATAAAGGCAAAAGCTGGAGGG - Intronic
917910781 1:179642874-179642896 GCAAAAAAGCAAAAGTTAAATGG + Intronic
921290256 1:213650535-213650557 ACATAGATGCAAATGCTGAAAGG - Intergenic
921349653 1:214222555-214222577 CTGTAAATGCAAAAGCTGGAAGG + Intergenic
921393798 1:214646673-214646695 CCCTAAAAGCAAAAATAGAAGGG + Exonic
921401548 1:214728743-214728765 CCATCAATGAAGAAGTGGAAAGG - Intergenic
921677436 1:217991704-217991726 CCATATATACAAAACTAGAAAGG + Intergenic
922643211 1:227257586-227257608 CCAAAAATACAAAAATTAAATGG + Intronic
923994580 1:239478638-239478660 CCATAAATTTAATAGTGGAATGG + Intronic
924102143 1:240615648-240615670 CAATAAATCCATAAGTTAAAGGG - Intergenic
924519720 1:244795479-244795501 CCATAAATGCAGAAGTATAAAGG + Intergenic
1063654750 10:7976747-7976769 CCAAAAATTGAACAGTTGAATGG + Intronic
1064499825 10:15958504-15958526 ACAAAAATGTAAAAATTGAAAGG - Intergenic
1064952342 10:20866897-20866919 CCATGAATGAAAAAGATTAACGG - Intronic
1065128538 10:22597546-22597568 CAAAGAATGCCAAAGTTGAAAGG + Intronic
1065183521 10:23150124-23150146 GCATAAATGGAAACGTTCAATGG - Intergenic
1065555814 10:26914507-26914529 CCTTGAATGCAAAAGTGGCACGG + Intergenic
1065615453 10:27516879-27516901 GCAAAAATGCAAAAGTGGTATGG + Intronic
1066434901 10:35388500-35388522 GCAAAAATGCAAATGTTGAGTGG - Intronic
1067989923 10:51200376-51200398 CAATAAATACAAAAGTAGACAGG + Intronic
1069088346 10:64168962-64168984 CAGTAAATGTAGAAGTTGAAGGG + Intergenic
1069387867 10:67900894-67900916 CCATAAAAATAAAATTTGAAAGG - Intronic
1069536794 10:69259693-69259715 CCATAATGGCAGAAGGTGAAGGG + Intronic
1069547443 10:69338856-69338878 ACAGAAATAGAAAAGTTGAAAGG + Intronic
1069880631 10:71590510-71590532 CCATAAAGGCAGATGCTGAAGGG + Intronic
1070007876 10:72442916-72442938 CCAAAAATACAAAAATTAAACGG - Intronic
1070846521 10:79526817-79526839 CCAAAAATACAAAAATTGACTGG + Intergenic
1070927275 10:80233457-80233479 CCAAAAATACAAAAATTGACCGG - Intergenic
1071195237 10:83151435-83151457 CAATATATGTAAAAGTTAAAAGG - Intergenic
1071809561 10:89164654-89164676 CCATCAAAGCCAAAGATGAAGGG + Intergenic
1074727864 10:116332312-116332334 CAGTAAAAGCAAAAGTAGAAAGG - Intronic
1075235791 10:120727654-120727676 CCATGAATGCAAAGGTTGACGGG - Intergenic
1075827621 10:125373188-125373210 CTAAAAATGCAAAAGTTGGCTGG + Intergenic
1076432482 10:130415455-130415477 GCATAAAAGCAAAACCTGAAAGG - Intergenic
1077379501 11:2222633-2222655 CCATAAAAGCAAGATATGAAAGG + Intergenic
1078206213 11:9231552-9231574 CTAAAAATACAAAAGTTGCAGGG + Intronic
1078978972 11:16509802-16509824 CCATTTATGCAAAAGTAAAATGG + Intronic
1080174412 11:29344597-29344619 GCACAAAGGCAAAAGTAGAATGG - Intergenic
1080903815 11:36521118-36521140 CCAAAAATGCAAAATTTGCCAGG - Intronic
1082896400 11:58195059-58195081 TCATAAAAGCAAAAATAGAATGG - Intergenic
1083031728 11:59598749-59598771 CTAAAAATACAAAAGTTAAACGG - Intronic
1084078933 11:66805614-66805636 CCAAAAATGCAAAAATTAACTGG - Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1087285881 11:96264764-96264786 CCTGAAATGAAAACGTTGAAAGG + Intronic
1089042888 11:115470466-115470488 CCATTAAAACTAAAGTTGAATGG + Intronic
1089142619 11:116299167-116299189 AGATAAATGCAGAAATTGAAAGG - Intergenic
1089261463 11:117226709-117226731 CCATCAAGGCAAAAGGTGAAGGG - Intronic
1089714184 11:120340714-120340736 CCATAAATACAAAATTGAAATGG + Intronic
1089811064 11:121131825-121131847 CCAAAAATGCATAATTTCAATGG - Intronic
1090486597 11:127118169-127118191 CCATAAATCAAAAAGAAGAAAGG + Intergenic
1091485231 12:880297-880319 CCATATATGTAAAAGTTGCCAGG - Intronic
1091895848 12:4103725-4103747 CCAGAAATGCAATTGTTGAGTGG - Intergenic
1091905240 12:4181073-4181095 CCAAAAATGCATACTTTGAAGGG + Intergenic
1092350853 12:7754615-7754637 CCAAAAATGCAAAACTTAACTGG - Intergenic
1093040585 12:14374887-14374909 CTATAAATATAAAAGTGGAAAGG - Intronic
1093401286 12:18749873-18749895 TAACAAATGCAAAAATTGAAAGG + Intergenic
1093636363 12:21474708-21474730 CCATAAAAGCAGATGTTGGAGGG - Intronic
1094114153 12:26892049-26892071 GCATAAATACAAAATTTGTATGG + Intergenic
1094388094 12:29917313-29917335 CCAAAAATGCAAAAGTTGAGAGG - Intergenic
1095848446 12:46773434-46773456 TCATAAATGCTAATGTTGAGTGG + Intronic
1096046161 12:48564212-48564234 CAATAAATGAAAAAAATGAATGG + Intergenic
1097713148 12:62936531-62936553 CTATACATGAAAAAGTTAAAGGG - Intergenic
1098501935 12:71202944-71202966 CCACAAATGCAAAAGCTGGGTGG + Intronic
1098977695 12:76920406-76920428 CCATAACAGCAGAAGATGAAGGG + Intergenic
1098987790 12:77031071-77031093 CCATAAATGTACAAGTTTATAGG + Intronic
1101926450 12:108975860-108975882 CCAAAAATACAAAAATTGACTGG - Intronic
1101933867 12:109039770-109039792 CCAAAAATGCAAAAATTCACTGG - Intronic
1103358291 12:120338065-120338087 CAATCATGGCAAAAGTTGAAAGG + Intergenic
1104045694 12:125160955-125160977 CCAAAAAAACAAAAGTTTAAAGG - Intergenic
1106645285 13:31627883-31627905 CCAGAAATACAGAACTTGAAAGG + Intergenic
1106714797 13:32376358-32376380 CCAAAAATGCAAAAATTAACCGG + Intronic
1106756627 13:32828673-32828695 CCATCAATGCCAAAAATGAAAGG - Intergenic
1107339859 13:39394439-39394461 CCTCAAATGTAATAGTTGAAAGG + Intronic
1108245826 13:48512520-48512542 CCATAATTGCAAAATTTAAAAGG - Intronic
1108340912 13:49497068-49497090 CCAAAGGTGGAAAAGTTGAAGGG + Intronic
1109129325 13:58561299-58561321 ACAAAAATTTAAAAGTTGAAAGG - Intergenic
1109356607 13:61237374-61237396 CCACAAACGCCAAGGTTGAACGG + Intergenic
1109379853 13:61544912-61544934 CCATAAATCCAAAATTTAGATGG - Intergenic
1109439616 13:62352200-62352222 ACATAATTGCAAATATTGAATGG + Intergenic
1109510085 13:63360466-63360488 CCATAAAAGAAAAATTTGATAGG + Intergenic
1109548674 13:63862438-63862460 CCAGATAAGCAAAAGTTGAAGGG + Intergenic
1110044606 13:70812418-70812440 CCAAAAAAAAAAAAGTTGAAAGG + Intergenic
1110861847 13:80353161-80353183 CCGTAAATGGAAAAATTGATAGG - Intergenic
1113110953 13:106822938-106822960 ACATAAATGCAAGAGTTCTATGG - Intergenic
1113186342 13:107689950-107689972 ACTTAAATGCTAAAGTTAAATGG - Intronic
1113446180 13:110369281-110369303 CCAAAAATCCAAAATCTGAAGGG + Intronic
1114006635 14:18320501-18320523 CCCCAAATGCAAAAGTGGCATGG - Intergenic
1115955633 14:38776031-38776053 CTATAAAAGAAAAAGTTTAAAGG + Intergenic
1117370245 14:55071778-55071800 TCATAAAGGCAAATGTTCAAAGG + Intergenic
1117524409 14:56583082-56583104 CCATAAATTCAAAATTTCAAAGG - Intronic
1117723404 14:58648561-58648583 TCAAACATGGAAAAGTTGAAAGG + Intergenic
1118271904 14:64351371-64351393 CTAAAAATGCAAAAGTTAACTGG - Intergenic
1119455867 14:74755197-74755219 CTATAAATGCAAAAATTGGCCGG + Intergenic
1120384421 14:83826392-83826414 CCATGTAGGCAAAATTTGAAGGG - Intergenic
1121124293 14:91395953-91395975 CCAGTACTGTAAAAGTTGAAGGG - Intronic
1202942799 14_KI270725v1_random:170496-170518 CCAAAAATACAAAAGTTGGCTGG + Intergenic
1123390565 15:19867137-19867159 CCTCAAATGCAAAAGTGGCACGG - Intergenic
1129127549 15:73457117-73457139 GCTTAAAAGCAAAACTTGAAAGG - Intronic
1129582525 15:76827673-76827695 AAAAAAATGCAAAAGATGAATGG + Intronic
1133573575 16:7065834-7065856 TCATAAAAGCAAGAGTAGAATGG - Intronic
1134436757 16:14266497-14266519 ACATAAAGGCAATAGATGAATGG - Exonic
1137874094 16:51979155-51979177 CCATAAATGCAAAACTTAAAAGG + Intergenic
1139064536 16:63296294-63296316 TAATAAAAGCAAAAATTGAAGGG + Intergenic
1139373727 16:66484082-66484104 CCAAAAATGGAATACTTGAATGG - Intronic
1139735854 16:68987528-68987550 CTAAAAATGCAAAAGTTGGCCGG - Intronic
1140446647 16:75034507-75034529 CCATAAATGCAATGCATGAATGG - Intronic
1140937607 16:79689155-79689177 CAATAAATGGAAAAGTGGGATGG + Intergenic
1141310394 16:82908219-82908241 CCATGAATACAAAAGGTGATGGG + Intronic
1142294997 16:89215516-89215538 ATATATATGCAAAAGTGGAATGG - Intergenic
1142788988 17:2248349-2248371 ACTTAAAAGCAAAACTTGAACGG - Intronic
1146334077 17:31954222-31954244 CCAAAAATACAAAAGTTAACCGG - Intronic
1147780260 17:42935813-42935835 ACATAAAAGGAAAAGTAGAAGGG - Intergenic
1148714654 17:49707586-49707608 CCATAGCTGCAAAAGTAGTAGGG + Intronic
1148957548 17:51366111-51366133 CCAAAAAGGCAACAGTTGGACGG - Intergenic
1149266298 17:54931427-54931449 CAATAAATGTAAAGGTTAAATGG - Intronic
1151126580 17:71851899-71851921 CAATCAAGGCAAAAGGTGAAAGG - Intergenic
1154006444 18:10532529-10532551 CAATAATTGGAAAAGTTGTAAGG + Intronic
1154232074 18:12565870-12565892 CTATAAATACAAAAGTTGGCTGG + Intronic
1156741129 18:40329758-40329780 TCATAAATACAAAAATAGAATGG - Intergenic
1156947375 18:42851497-42851519 GCATAGAAGCAAAAATTGAAAGG + Intronic
1157182942 18:45513590-45513612 CCCCAAATGTAAAGGTTGAAGGG + Intronic
1157885819 18:51365408-51365430 CTAAAAATGCAAAAGTTAGAAGG - Intergenic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1159236035 18:65673720-65673742 CCAAAAATGCAAAAATTGGCAGG + Intergenic
1159522024 18:69538541-69538563 CCAAAAATGCAAAAGTTAGCTGG - Intronic
1159759628 18:72408532-72408554 CCATTAATTCAAAAGTCAAAAGG - Intergenic
1159828748 18:73247435-73247457 CCATAAATGCCAAACTTGCCTGG - Intronic
1160729189 19:632992-633014 CCATAAAGGCAGAAGCCGAAGGG + Intronic
1161539312 19:4840127-4840149 CTAAAAATGCAAAAGTTAGACGG - Intronic
1164508589 19:28879146-28879168 AAATAAATGCAAGAGCTGAATGG + Intergenic
1165140543 19:33697391-33697413 CCAAAAATACAAAAGTTAGACGG - Intronic
1165994624 19:39834968-39834990 CCTTAAATGCAAGAGTTGAGAGG + Intronic
1167540352 19:50082659-50082681 CCAGAATTGCTAAAATTGAAAGG - Intergenic
1167629356 19:50615140-50615162 CCAGAATTGCTAAAATTGAAAGG + Intergenic
1167759323 19:51434992-51435014 CCAAAAATGCAAAAGTTAGCTGG - Intergenic
925228340 2:2206319-2206341 CAATAAAAGAAAAAGGTGAATGG - Intronic
925393376 2:3514617-3514639 TGATAAATGAAAATGTTGAATGG - Intronic
926646224 2:15292431-15292453 CCATGAATGTAAAACTTCAAAGG + Intronic
926869335 2:17395625-17395647 TCAAAAATGTAAAAGTTTAATGG + Intergenic
927418863 2:22908462-22908484 CCAAGAATGGAAAAGTAGAAAGG + Intergenic
928743317 2:34381793-34381815 TAATAAATAGAAAAGTTGAACGG - Intergenic
928835824 2:35543451-35543473 CCATAGAAGCAAGAGTAGAATGG + Intergenic
929121292 2:38486287-38486309 CCATAATTGGACAAGTGGAATGG + Intergenic
929707886 2:44234716-44234738 CCACAAAAGCAAAAGTTCACTGG - Intronic
931124041 2:59253776-59253798 CCATAAGTGCAGAAGTGAAATGG + Intergenic
932513628 2:72322175-72322197 TCATAAATGTCAAAGGTGAATGG + Intronic
933299958 2:80530343-80530365 CCATAAAAGGAAGAGTTGTAGGG + Intronic
933558531 2:83862669-83862691 CCATAAATGCCAATGCTGCAAGG - Intergenic
935171695 2:100615144-100615166 CCATAAAGGCAAAAGTTGCCAGG - Intergenic
936657655 2:114506538-114506560 CCACAGATGGCAAAGTTGAAAGG + Intronic
938529927 2:132174973-132174995 CCCCAAATGCAAAAGTGGCATGG + Intronic
939439636 2:142229911-142229933 CCCTAAATGCAAGAGCTAAAAGG + Intergenic
940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG + Intronic
941695147 2:168543333-168543355 CGACAAATGTAATAGTTGAAAGG - Intronic
941963720 2:171279727-171279749 CATTAAAAGAAAAAGTTGAATGG + Intergenic
943652094 2:190468317-190468339 ACAAAAAAGAAAAAGTTGAAGGG - Intronic
943914715 2:193615402-193615424 CCAGAAAGGGAAAAGTTTAAAGG - Intergenic
945821116 2:214666799-214666821 CCAACACTTCAAAAGTTGAACGG + Intergenic
946076318 2:217076701-217076723 CCATAAATGAAAAAGTTCCTAGG - Intergenic
946118550 2:217487796-217487818 CTTTAAATGCAAAAGAAGAAAGG + Intronic
947721866 2:232374782-232374804 CCAAAAATGCAAAAATTAAATGG + Intergenic
1169365992 20:4992903-4992925 TCAAAAATCCAAAATTTGAAAGG + Intronic
1171567967 20:26212460-26212482 TCATAAACCCAAAAGGTGAACGG + Intergenic
1173955153 20:47026398-47026420 CCATAAATGAAAAGATTGACAGG + Intronic
1174345363 20:49925168-49925190 CTAAAAATGCAAAAGTTGGCCGG + Intergenic
1175306759 20:57981628-57981650 CCACAAGTGCAAAAATGGAAAGG - Intergenic
1178415749 21:32403760-32403782 CCATAAAGACAGAAGTAGAATGG + Intergenic
1178631341 21:34263994-34264016 CCATAAATTTAAAAATGGAATGG + Intergenic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180431144 22:15251312-15251334 CCCCAAATGCAAAAGTGGCATGG - Intergenic
1180513702 22:16119213-16119235 CCTCAAATGCAAAAGTGGCATGG - Intergenic
1182535911 22:31002796-31002818 CCAAAAATGCAAAAGTTAGGTGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
953259895 3:41327585-41327607 CCATAATTGCTGCAGTTGAAAGG - Intronic
953553260 3:43921570-43921592 CCAAAACTGCAGAAGTTGTAGGG - Intergenic
953705641 3:45227816-45227838 CCTGATATGCAAAGGTTGAAAGG - Intergenic
954009731 3:47625394-47625416 CCAAAAATACAAAAGTTAACTGG - Intronic
955081088 3:55658526-55658548 CCAGAACTGCAAAAACTGAAAGG + Intronic
955490101 3:59473233-59473255 CCAAAAATGCAAAAATTCACCGG - Intergenic
955928321 3:64029968-64029990 CTATAAAAGCAAAAATTCAAAGG + Intergenic
956120449 3:65960757-65960779 ACAGAAATGGAAGAGTTGAAAGG - Intronic
957754940 3:84472709-84472731 CCAATACTGCAAAAATTGAAAGG + Intergenic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960361750 3:116720653-116720675 ACATAAAGGAAAAAGTTGAGTGG + Intronic
960467268 3:118012603-118012625 CTCTAAATGTAAAAGTTGGATGG + Intergenic
961502305 3:127345188-127345210 CCATAAATACAAAAATTAACCGG + Intergenic
961849415 3:129800231-129800253 GCATAGATTCAAAAGTAGAATGG - Intronic
962113275 3:132472760-132472782 CAATAAATGCAAAAGATTACAGG - Intronic
965386583 3:168053752-168053774 CCATAAAAGAACAAGTTGATGGG + Intronic
966286000 3:178296145-178296167 ACTTAAGTGCAAATGTTGAAAGG + Intergenic
968515581 4:1014423-1014445 CCATGCTTGCAAAAGTTCAAAGG - Intronic
968677245 4:1890016-1890038 CCATAAAGACAGAAGTAGAATGG - Intronic
970090340 4:12400165-12400187 CCATAATTGGTAAAATTGAATGG - Intergenic
971916185 4:32872694-32872716 CCATATATTCAAAAGTATAATGG + Intergenic
972409231 4:38776043-38776065 CCACAAATACAAAAATTGAGGGG - Intronic
972809475 4:42566350-42566372 CTATAAATCCAAAATCTGAAAGG - Intronic
974597566 4:64034384-64034406 CAATAACTGTAAAAGTTTAAAGG - Intergenic
975076721 4:70218705-70218727 CCATAATTTCAAAACTTAAATGG + Intergenic
975226926 4:71883505-71883527 CCAAAAATGCAAAAATTGGCCGG - Intergenic
975349312 4:73328228-73328250 TTAAAAATGCAAAAGTTGATGGG - Intergenic
975354040 4:73378934-73378956 CCATAAATGGAAAATTTGACTGG - Intergenic
975450829 4:74524436-74524458 CCTTCAATGCAAAAGTTTGAAGG - Intergenic
976418291 4:84805516-84805538 CCATAATTCCAAAATTTAAAAGG - Intronic
976813047 4:89117775-89117797 CCATATGTGAAAGAGTTGAAAGG + Intergenic
977799737 4:101212607-101212629 CCCTAAATTTAAAAGTTGAAGGG + Intronic
979035953 4:115717854-115717876 TTATAAAGGCAAAACTTGAATGG - Intergenic
981204115 4:142018485-142018507 CAATAATGGCAAAAGGTGAAAGG + Intergenic
981232649 4:142375713-142375735 AGATAAATGCAAAAGTTCTAAGG - Intronic
982340920 4:154297820-154297842 CAATATATGAAAAACTTGAAGGG + Intronic
982481549 4:155917851-155917873 CCATAAAGGCAAAGGTGGCATGG + Intronic
982919838 4:161258752-161258774 CCATTGATTCAGAAGTTGAAAGG + Intergenic
983855259 4:172635521-172635543 TCAAATATGCAAAATTTGAAAGG - Intronic
985175311 4:187194138-187194160 CCATAAAGGAACAAATTGAAAGG + Intergenic
985244072 4:187961833-187961855 CTAAAAATACAAAAGTTGATTGG + Intergenic
987186700 5:15428374-15428396 GCAAAAATGCAAAAATTCAATGG - Intergenic
987630579 5:20465792-20465814 ACATTAATGCAAAACTGGAATGG - Intronic
989089518 5:37715473-37715495 CCCTCAATGGAAAAGTTTAAAGG - Intronic
990103484 5:52223545-52223567 ATATAAATGCAAAAATTCAATGG + Intergenic
990248130 5:53883902-53883924 TCCCAAATGCTAAAGTTGAAAGG + Intergenic
990379068 5:55203962-55203984 CCAAAAATGCAAAAGTTAACCGG + Intergenic
990662187 5:58028281-58028303 CCAGAAAAGCAGAAGTTAAATGG - Intergenic
991149664 5:63352252-63352274 CTACAAAAGCAAAAGTTGAGAGG + Intergenic
992652652 5:78875827-78875849 CCAAAAATACAAAAGTTGACTGG - Intronic
992691833 5:79248189-79248211 CTAAAAATACAAAAGTTAAAAGG - Intronic
993726636 5:91375527-91375549 CCTTAAGTGCCAAAATTGAAAGG - Exonic
994189971 5:96858567-96858589 GCATAAATCCCCAAGTTGAATGG - Intronic
994422197 5:99535397-99535419 CAAAAAATGCAAAAGTTGGCCGG - Intergenic
994460644 5:100065183-100065205 CAAAAAATGCAAAAGTTGGCCGG + Intergenic
994484794 5:100378592-100378614 CAAAAAATGCAAAAGTTGGCTGG + Intergenic
994584183 5:101684576-101684598 ACAGAAATGCAAAAGTAGGAGGG - Intergenic
995037385 5:107549981-107550003 TCAAAAATCCAAAAGTTGAAAGG - Intronic
995197031 5:109382550-109382572 CAATAAATGCAACAGTTGCTGGG + Intronic
995300028 5:110568868-110568890 TCATAAATTTAAAAGTTAAATGG + Intronic
995519913 5:112993332-112993354 CCATAACAGCAAAAATTTAAAGG - Intronic
995549628 5:113267831-113267853 CCTTAAATGGATAAGTTGTATGG + Intronic
995882340 5:116857164-116857186 CCATAAAGGGAAAGGATGAATGG + Intergenic
995957085 5:117790005-117790027 CAATTAATGCATAATTTGAAAGG - Intergenic
995987258 5:118193064-118193086 CGATAAACAGAAAAGTTGAATGG - Intergenic
997123232 5:131197937-131197959 AAAAAAGTGCAAAAGTTGAAGGG + Intronic
998264979 5:140661084-140661106 GCATCAATGCATAAGTAGAAAGG + Intronic
998764398 5:145469179-145469201 CCTAAAATGCAAAAGTCTAAGGG - Intergenic
998973984 5:147624194-147624216 CCATAAATGCATTTGCTGAATGG - Intronic
1001211721 5:169815933-169815955 GCATAAAAGCACTAGTTGAAAGG + Intronic
1001671653 5:173478692-173478714 CCCTAGATGCAAAAGATGGAAGG - Intergenic
1002921045 6:1573682-1573704 ACAAAAATGCAAATATTGAACGG + Intergenic
1003559861 6:7171571-7171593 CCATAAAGACAAAGGTTGAGAGG - Intronic
1005357682 6:25000037-25000059 CCATGAAGGCAAAAGATGAAGGG - Intronic
1005435174 6:25802085-25802107 TCATGAAAGCAAAAGTGGAAAGG - Intronic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1006475551 6:34250394-34250416 CCATAAAAGCAAGACCTGAAAGG + Intergenic
1006914819 6:37587494-37587516 CCAAAAATACAAAAATTGACTGG - Intergenic
1006989405 6:38200300-38200322 CCCTATATACAAAAGTAGAAAGG + Intronic
1007684047 6:43654524-43654546 CCAAAAATACAAAAATTGACTGG + Intronic
1007868173 6:44999128-44999150 CCAAAAATGCAAAAATTTATAGG - Intronic
1008333278 6:50268787-50268809 TCAAAAATTAAAAAGTTGAATGG + Intergenic
1008774720 6:55024155-55024177 CCATAAATGTAAAAGGCGAGTGG - Intergenic
1008946973 6:57108975-57108997 CCATAGAAGTAAAACTTGAATGG - Intronic
1009271795 6:61623560-61623582 CCAGAAATCATAAAGTTGAATGG + Intergenic
1009491956 6:64302500-64302522 CCATAAATGCAAAAGTTGAAAGG - Intronic
1010407945 6:75526938-75526960 CTAATAATGCAAAAATTGAAAGG + Intergenic
1010408746 6:75536492-75536514 ATATAAAGGCACAAGTTGAAAGG + Intergenic
1010907659 6:81511636-81511658 CAATCAAAGCAAAAGTGGAATGG - Intronic
1011469211 6:87690809-87690831 CTAAAAATACAAAAGTTAAACGG + Intronic
1012306077 6:97659496-97659518 TACGAAATGCAAAAGTTGAAAGG + Intergenic
1012515618 6:100055525-100055547 CAATCATGGCAAAAGTTGAAGGG - Intergenic
1012822704 6:104107166-104107188 GCATAAATGCAAAAATAGGATGG + Intergenic
1013154152 6:107477123-107477145 CTTTAAATGCAAACTTTGAAAGG + Intergenic
1013707838 6:112860008-112860030 CCATAAAAGCAAAAGCATAATGG + Intergenic
1019063173 6:169272498-169272520 TCAGACATGCAAAAGTGGAAAGG + Intergenic
1020341938 7:7121144-7121166 TCATAAAATTAAAAGTTGAAAGG - Intergenic
1020719667 7:11726108-11726130 CCATAAAAGCTAAATTTAAAAGG + Intronic
1021791092 7:24206205-24206227 CCATAACTCCCAAAGATGAATGG + Intergenic
1023664155 7:42503032-42503054 CCTTTAATGAAAAAGGTGAAAGG - Intergenic
1023928873 7:44692371-44692393 TCATAAAAGCAAATGTTAAAAGG + Intronic
1024435383 7:49347235-49347257 CAATAATTTCAAAAGTAGAAAGG + Intergenic
1024524769 7:50338626-50338648 CCTTTTATGCAAAAGTAGAAAGG + Intronic
1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG + Intergenic
1025804753 7:64820223-64820245 CCATAAAATCCAAAGTGGAAGGG - Intronic
1025814262 7:64895864-64895886 CCACAAAAGGAAAAATTGAAAGG + Intronic
1027608983 7:80335689-80335711 ACATAAATGCAAACATTGTAAGG - Intergenic
1028081050 7:86576994-86577016 CTATAAATGCAACAGTAGATGGG + Intergenic
1028195941 7:87908133-87908155 CAGTAAATGTAGAAGTTGAAGGG - Exonic
1028303775 7:89235348-89235370 CCATAAAGTCAAAAGCTAAATGG + Intronic
1028632198 7:92947240-92947262 CCATAAATGACACAGTGGAAAGG + Intergenic
1028864170 7:95688667-95688689 CCACAAATGCAATACATGAAGGG - Intergenic
1029924790 7:104304008-104304030 TCATAAATGCAAGAGATGATTGG - Intergenic
1029982622 7:104893350-104893372 CCAAAAATACAAAAATTAAAGGG + Intronic
1030644734 7:112047474-112047496 CCATATATTCAAAAATTTAATGG + Intronic
1031156650 7:118118927-118118949 CCATACATGCAAAAGTTAAAAGG - Intergenic
1032911543 7:136437179-136437201 CAATAAAAGCAAAAGCTGCAAGG + Intergenic
1034699891 7:153086660-153086682 GAATAAATGAAAATGTTGAAAGG + Intergenic
1035834715 8:2736895-2736917 ACATAAATGAAAAACTTAAAAGG + Intergenic
1038994382 8:32905123-32905145 TCATAAATGCATATGTTGATGGG - Intergenic
1041327072 8:56679379-56679401 ACAGAAATACAAAATTTGAATGG + Intergenic
1041477811 8:58285202-58285224 CCACAGATGCAAAAGATTAATGG - Intergenic
1042995305 8:74691636-74691658 CCTTCAATGCAAAAATTAAAAGG - Intronic
1044031077 8:87238333-87238355 CCCTAAAAGCAAAATTTAAATGG - Intronic
1045378410 8:101599260-101599282 CCACAAAGGCAAAAGATGAAAGG - Intronic
1045616238 8:103915628-103915650 TCATAACTACTAAAGTTGAATGG - Intronic
1046099926 8:109602593-109602615 CCAAAAATGCAAAAATTAACCGG - Intronic
1048053224 8:130839048-130839070 ACATGAATGCAAAAGTGTAAAGG + Intronic
1048065613 8:130965193-130965215 CAACAAAAGCAAAAGTTGACAGG - Intronic
1048403410 8:134093983-134094005 CCAAAACAGCAAAGGTTGAAAGG + Intergenic
1048462138 8:134629697-134629719 CAATCATTGCAGAAGTTGAAGGG - Intronic
1049511822 8:143031263-143031285 CCATAAATACAAACCTGGAAAGG + Intergenic
1050079671 9:1903372-1903394 CAATAATGGCAAAAGGTGAAAGG - Intergenic
1052103779 9:24485572-24485594 CCATAAAGGTAGAAGTTGAAAGG - Intergenic
1052218274 9:25992155-25992177 ACTTAAAAGCAAACGTTGAATGG + Intergenic
1052284721 9:26771997-26772019 CCAGACATGCAAATGTTTAATGG + Intergenic
1052495302 9:29216176-29216198 CCATAAAAGCAAAATGTAAAAGG - Intergenic
1053708535 9:40781443-40781465 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1054418446 9:64902238-64902260 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1055547512 9:77394777-77394799 GCATAAAAGCACAAGGTGAAGGG - Intronic
1056084608 9:83133641-83133663 CCATCAGTGCAAAATTTAAAAGG + Intergenic
1056199745 9:84263636-84263658 CCAAAAATGGAAAAGTTGAATGG + Intergenic
1056757871 9:89393387-89393409 CAATGAATTCAAAAGTTAAAGGG + Intronic
1057092794 9:92274947-92274969 TCATAAAGGCAAATCTTGAAAGG + Intronic
1057119788 9:92560774-92560796 CCATAAATGCGGAAGCAGAACGG - Intronic
1058194863 9:101960014-101960036 CCTTAAATGCAAATGTTCATTGG + Intergenic
1059162347 9:112047154-112047176 CCATCAAGGCAGAAGGTGAAGGG + Intronic
1059283292 9:113152384-113152406 GCAAAAAGGCAAAAGTAGAAAGG + Intronic
1059325286 9:113500601-113500623 CCATAAAGTCAAATGTGGAAGGG - Intronic
1059676960 9:116548937-116548959 CCTTAAATGCAAAAGCTTACAGG - Intronic
1060178622 9:121516157-121516179 CCAAAAATACAAAAATTGACCGG - Intergenic
1062456207 9:136640436-136640458 CCATAAAAGCAAGACTAGAAAGG - Intergenic
1186349078 X:8724990-8725012 AGTTAAATGGAAAAGTTGAAAGG + Intronic
1186806378 X:13144182-13144204 CCAATATTTCAAAAGTTGAATGG - Intergenic
1188783646 X:34316315-34316337 CCATAAAAAAAAAAGTTTAATGG - Intergenic
1188891587 X:35617843-35617865 CCATAAAAGCAAGAGGAGAAAGG + Intergenic
1190201910 X:48369039-48369061 CCAGAAAAGCAAAAGCTCAAGGG - Intergenic
1190208628 X:48426372-48426394 CCAGAAAAGCAAAAGCTCAAGGG + Intergenic
1190668759 X:52719661-52719683 CCAGAAAAGCAAAAGCTCAAGGG - Intergenic
1190670658 X:52738743-52738765 CCAGAAAAGCAAAAGCTCAAGGG + Intergenic
1191039532 X:56064799-56064821 CCAGAAAGGCAAAAGCTGAGAGG - Intergenic
1191806213 X:65136491-65136513 CCATGCAAGCAAAAATTGAAAGG - Intergenic
1194737221 X:97526855-97526877 AGATAGATGGAAAAGTTGAATGG - Intronic
1194784519 X:98065413-98065435 CAATAAATTGAAAGGTTGAAAGG - Intergenic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1197593511 X:128439088-128439110 ACATAAATGAAAAATTTTAATGG - Intergenic
1197624719 X:128788909-128788931 CCCTAAATTTAAAAGTTGAAGGG + Intergenic
1198821121 X:140649799-140649821 CTAAAAATGCAAAAGTTAACTGG + Intergenic
1199755843 X:150864402-150864424 GCAAAAATTCAAAAGATGAATGG + Intronic
1199786310 X:151108912-151108934 CAAAAAATGCAAAAGATCAAGGG - Intergenic
1199866433 X:151853958-151853980 CCATAAAGACAAAAGTGGCAGGG - Intergenic
1200418696 Y:2939067-2939089 GCATAAATGCAACAATTCAAAGG - Intronic
1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG + Intergenic
1202350740 Y:23987796-23987818 CTAAAAATGCAAAAGTTAGATGG - Intergenic
1202520039 Y:25682324-25682346 CTAAAAATGCAAAAGTTAGATGG + Intergenic