ID: 1009492033

View in Genome Browser
Species Human (GRCh38)
Location 6:64303181-64303203
Sequence GCAGTTGCAATGTTAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009492033_1009492037 10 Left 1009492033 6:64303181-64303203 CCGGCTTCTAACATTGCAACTGC 0: 1
1: 1
2: 1
3: 20
4: 160
Right 1009492037 6:64303214-64303236 GAGATTATCATACCCCCAGTGGG No data
1009492033_1009492036 9 Left 1009492033 6:64303181-64303203 CCGGCTTCTAACATTGCAACTGC 0: 1
1: 1
2: 1
3: 20
4: 160
Right 1009492036 6:64303213-64303235 AGAGATTATCATACCCCCAGTGG No data
1009492033_1009492038 11 Left 1009492033 6:64303181-64303203 CCGGCTTCTAACATTGCAACTGC 0: 1
1: 1
2: 1
3: 20
4: 160
Right 1009492038 6:64303215-64303237 AGATTATCATACCCCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009492033 Original CRISPR GCAGTTGCAATGTTAGAAGC CGG (reversed) Intronic
901231591 1:7644608-7644630 GCAGTTGCAATGGCAGGAGCTGG - Intronic
901517234 1:9756627-9756649 GCTGTAGCAATCGTAGAAGCCGG - Intronic
904995693 1:34629693-34629715 AAAGTTGCAATGGCAGAAGCTGG - Intergenic
912445015 1:109729017-109729039 GCAGGTGCAATATAAGGAGCTGG - Intronic
913090284 1:115472118-115472140 GCAGATGCAATGGTAGCAGGAGG - Intergenic
915480989 1:156184891-156184913 GCAGTTGCTTTATTAGAAGCTGG + Intergenic
919120948 1:193339527-193339549 GCAGTTGGAATTTCAGAAGCAGG + Intergenic
923409187 1:233690591-233690613 ACAGTTGCAATGTTAGATGTTGG - Intergenic
1063319124 10:5036131-5036153 GTAGTTGCAACATTAAAAGCTGG + Intronic
1063366629 10:5494713-5494735 GGGCTTGCAATGTTAGAACCGGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064893661 10:20209232-20209254 GCAGCTGCAACCTTAGAAGACGG + Intronic
1065815081 10:29475845-29475867 ACAGTTGCAATGTTGGAAATGGG - Intronic
1071410133 10:85382944-85382966 GCACTTGCAATACTAGAGGCAGG + Intergenic
1072623659 10:97097161-97097183 GTGGTTGCAGTGTTAGACGCAGG - Intronic
1075340213 10:121641522-121641544 GCAGTTGTAATGTCTGAATCAGG - Intergenic
1075657575 10:124172456-124172478 GCAGCTGCAATCGGAGAAGCAGG - Intergenic
1080166346 11:29242181-29242203 GTAATCCCAATGTTAGAAGCCGG - Intergenic
1080835335 11:35935380-35935402 GCAGTGGTAATACTAGAAGCTGG - Intergenic
1086426999 11:86694980-86695002 GCAGCTGCAAAGAGAGAAGCAGG + Intergenic
1088400169 11:109415022-109415044 GCAGTAGAATTGTTTGAAGCCGG + Intergenic
1090996393 11:131869568-131869590 GCAGTTGGAAGGCTACAAGCTGG - Intronic
1091263157 11:134249858-134249880 GCAGTTGCTATGGTAGAAGAAGG + Exonic
1098348368 12:69529958-69529980 GCAGTTGGATTGTTTGAACCTGG + Intronic
1098509330 12:71292985-71293007 CCATTTGCTATGTAAGAAGCTGG + Intronic
1099984903 12:89650940-89650962 GCAGTTAGGATGTTATAAGCAGG + Intronic
1100528634 12:95443670-95443692 GCAGTTACATTGTCAGAAGCTGG + Intergenic
1106439613 13:29754436-29754458 GCAGTTTCAATGTTAGTATCAGG + Intergenic
1107240662 13:38230731-38230753 TCAGTTCCAATGTGAGAACCGGG - Intergenic
1107570457 13:41652066-41652088 GCTGTTGCCATGTGAGAATCTGG - Intronic
1108417409 13:50212292-50212314 GCAGTTGCACAATTAGAACCTGG - Intronic
1109606958 13:64708440-64708462 GTAGTTGCAACGTTAAAACCTGG - Intergenic
1110608701 13:77464403-77464425 GCATGTGCAATGTTAAATGCAGG - Intergenic
1111704344 13:91729905-91729927 GCAGGTGAAATGTTACAAACTGG + Intronic
1113144371 13:107191558-107191580 GAAGCTGATATGTTAGAAGCCGG + Intronic
1115997583 14:39210296-39210318 GCAGGAGAATTGTTAGAAGCCGG + Intergenic
1116194241 14:41702017-41702039 GCAGTAGCAATATTAGAAATAGG + Intronic
1116881412 14:50173131-50173153 GCAGTTAAAAAGTTGGAAGCTGG - Intronic
1119141898 14:72274693-72274715 GAAGTTGTAATGATAGAGGCAGG + Intronic
1125374740 15:39016391-39016413 GCAGTTGTGTTGTTAGAAGCTGG - Intergenic
1125404080 15:39334934-39334956 GAATTTGCAATGTCAGAAACAGG + Intergenic
1125707168 15:41748851-41748873 GCTGATGCAAAGGTAGAAGCTGG - Exonic
1130901226 15:88208120-88208142 GAAGTGGCAATGTCAGAAACAGG + Intronic
1133487805 16:6237268-6237290 GAAATTGCAATGTTAGAAGGTGG + Intronic
1134008853 16:10836321-10836343 GCAGTTGTGATGGTAGGAGCTGG + Intergenic
1134816037 16:17206832-17206854 GCAGGTGCCATGTTAGCAGTTGG + Intronic
1137690406 16:50422944-50422966 GCAGTTGCAATAATGCAAGCAGG + Intergenic
1138852899 16:60651503-60651525 GCAACTGTAATGTTTGAAGCGGG - Intergenic
1141215971 16:82024138-82024160 GCAGTTGCAATGCTGGCAGGGGG + Intergenic
1142826732 17:2517332-2517354 TGAGTTGGAATGTTAGAAGTGGG + Intergenic
1144036371 17:11369733-11369755 GCTGTTGCATTGTCATAAGCAGG - Intronic
1144595412 17:16566216-16566238 GCAGTTCCAATGGTAGAGCCGGG + Intronic
1145400430 17:22527651-22527673 GCATCTGCTATGATAGAAGCTGG + Intergenic
1149355204 17:55832345-55832367 GCAGTAGCCATTTTAGAAGAAGG - Intronic
1150714011 17:67556172-67556194 GCAGTTGCAATGTGAAAAGAAGG + Intronic
1153803229 18:8689886-8689908 GCAGCTGAAATGTCACAAGCAGG + Intergenic
1153838951 18:8989256-8989278 GCAGTTGCAATTTCACAACCTGG - Intergenic
1156797074 18:41058860-41058882 GCAGTTGAAAAGTTACAAGCTGG - Intergenic
1157655013 18:49376758-49376780 GCTGTTAAAATGTTAGAAGATGG + Intronic
1158030445 18:52957959-52957981 GAAGAGGCAATGTTAGAAGCTGG + Intronic
1158578531 18:58661189-58661211 GCAGTGCCTATGTTAGAAACCGG + Intergenic
1158754246 18:60303047-60303069 GGAGGGACAATGTTAGAAGCAGG - Intergenic
1158967866 18:62638331-62638353 GCAGTGCCCATCTTAGAAGCTGG + Intergenic
1160827317 19:1086669-1086691 GCAGCTGCAAGCTTAGAAGAAGG + Exonic
1162025405 19:7891042-7891064 GCAGTTGCAATCCTACAGGCAGG + Intronic
1164539215 19:29109858-29109880 GCAGTTACAATTTCAGATGCGGG - Intergenic
925300392 2:2807643-2807665 GCACTTGCAATGTAAGGCGCTGG + Intergenic
928849931 2:35733946-35733968 TCAGTTCCAATGTCAGAACCTGG - Intergenic
929912186 2:46099602-46099624 GCAGATGCAATGTTAACAGGGGG - Intronic
929970507 2:46570539-46570561 ACAGTTGCATTCTCAGAAGCTGG + Intronic
932959175 2:76391874-76391896 GCAGTGCTAATCTTAGAAGCTGG - Intergenic
934944371 2:98527386-98527408 GCAGCTGCAATGTTAAAAAATGG - Intronic
936116503 2:109706994-109707016 GCAGTTGTACTGTGAGCAGCTGG - Intergenic
936590981 2:113804077-113804099 GCAATTCCAATGTCAGAAACTGG + Intergenic
937949830 2:127375787-127375809 GCAGTCACGTTGTTAGAAGCTGG - Intronic
941818454 2:169821943-169821965 GGAACTGCAATGTTAGGAGCAGG - Exonic
942750874 2:179285674-179285696 GCAGATTAAATGTTAAAAGCAGG - Intergenic
946153499 2:217791809-217791831 GCAGTTGTAATGGCAGGAGCTGG + Intergenic
947133638 2:226955192-226955214 GCAGTTGTAGTGTCAGAAGGTGG + Intronic
1170261373 20:14412109-14412131 GAAATTGCAATTTTAGAAGCTGG - Intronic
1170963456 20:21046112-21046134 GCAGTTTCCATCTTAGGAGCTGG + Intergenic
1172522142 20:35574781-35574803 GCAGGAGCATTGTTTGAAGCTGG - Intergenic
1173915850 20:46708628-46708650 GCTGTTGCAAGGTGAGAAGTTGG - Intergenic
1175961729 20:62640835-62640857 GCAATTCAAATGTCAGAAGCAGG - Exonic
1178491791 21:33057185-33057207 GCAGTGGCCATATTAGAAGTTGG - Intergenic
1179128205 21:38611247-38611269 GTAGTTTCAAGGTTTGAAGCAGG - Intronic
1179278652 21:39914828-39914850 GTATTTGAAATTTTAGAAGCTGG + Intronic
1180556424 22:16581390-16581412 GCAGTTTCAATCTTAGAAGGTGG + Intergenic
949238610 3:1841981-1842003 GTGCCTGCAATGTTAGAAGCTGG - Intergenic
950191903 3:10982635-10982657 ACAGTTGCACTTTTATAAGCTGG - Intergenic
953755299 3:45640929-45640951 GCAGTTGGAATGTTGGAGACTGG + Intronic
954982636 3:54760348-54760370 GCAGTTGGCATGTGAGAGGCGGG + Intronic
955393339 3:58536908-58536930 GCAGTTTCTGTGTTAGTAGCAGG - Intronic
955507057 3:59642688-59642710 ACATTTTCAATGTTAGAACCAGG - Intergenic
956296272 3:67717068-67717090 AGAGTTTCAATGTTAGAAGAAGG + Intergenic
956903239 3:73738837-73738859 GTAGTTACATTGTTAGAGGCTGG + Intergenic
957091673 3:75736622-75736644 GCAGAAGAAATGTTTGAAGCTGG + Intronic
957582138 3:82087774-82087796 GCAGTTTTAGTGCTAGAAGCGGG - Intergenic
963226245 3:142865001-142865023 GCAGTTGTACTTTTAGATGCAGG - Intronic
964167581 3:153726902-153726924 GCAGTGGCAATGTTTGATACCGG - Intergenic
964256187 3:154777001-154777023 GCTTTTGAAATGCTAGAAGCAGG - Intergenic
965095289 3:164217659-164217681 GCAGTTACATTGTTATAGGCTGG + Intergenic
965599725 3:170442794-170442816 GCAGTTGCATTTTGAGAAGCGGG - Intronic
966092768 3:176159897-176159919 GTAGCTGCAATAGTAGAAGCAGG - Intergenic
966370175 3:179243387-179243409 GCAGTTTCAATCTTAGAAGGTGG + Intronic
967390161 3:188947597-188947619 GCCGTTGGAAGCTTAGAAGCAGG - Intronic
969867816 4:10086868-10086890 GCAGATGCAGTGTGGGAAGCAGG + Intronic
970612731 4:17740660-17740682 GCAGTTGCCCAGTTGGAAGCTGG + Intronic
970680439 4:18500815-18500837 GGAGTTGCAATGTTCAAAGAAGG - Intergenic
971094805 4:23388787-23388809 GCAGCTGCAAGATTAGAACCTGG + Intergenic
972021899 4:34326337-34326359 TCAGTTCCAATGTGAGAAACTGG - Intergenic
976445446 4:85125915-85125937 GCAGTCACATTGTTAGATGCTGG + Intergenic
980763112 4:137263151-137263173 GCAGTGCCAGTGATAGAAGCAGG - Intergenic
981308551 4:143272188-143272210 GGAGATGCAATGGTAGAAGAGGG - Intergenic
981649418 4:147039058-147039080 GCAGTTCCAATGTAACATGCTGG + Intergenic
982388299 4:154836751-154836773 GCAGTCTCATTGTTAGAAGCTGG + Intergenic
984829826 4:183962184-183962206 GCAGTTCCATTGTTATAAGCAGG + Intronic
986688328 5:10293334-10293356 GCAGATGCAATGTTAGGTGAGGG + Intronic
988430011 5:31108713-31108735 TCAGTTTTAATATTAGAAGCTGG - Intergenic
990421678 5:55641330-55641352 AAAGATGAAATGTTAGAAGCTGG - Intronic
992598564 5:78371589-78371611 GCTCTGGCAATTTTAGAAGCCGG - Intronic
993094311 5:83464125-83464147 ACAGTTGCATTTTTGGAAGCAGG - Intergenic
993527612 5:88985691-88985713 GCAGTGGTAATTTTAGAAGTGGG - Intergenic
994476110 5:100272440-100272462 GCAGAAGAAAAGTTAGAAGCTGG + Intergenic
995622955 5:114047783-114047805 CAAGTAGCAATGTTAGCAGCAGG - Intergenic
999531540 5:152468263-152468285 GCAGGGGTAATGTTAGAAACAGG + Intergenic
1000959620 5:167584528-167584550 GGAGTTGCAAAGGGAGAAGCCGG + Intronic
1001310944 5:170610257-170610279 GCGATATCAATGTTAGAAGCTGG - Intronic
1002815919 6:680289-680311 GCAGTTGATGTGTTAGAATCAGG + Intronic
1003102946 6:3191212-3191234 GCAGATGGAACGTTAGCAGCTGG - Intergenic
1005481536 6:26259701-26259723 GCAGTCACATTGGTAGAAGCTGG - Intergenic
1008304703 6:49887302-49887324 GCAGTTACATTATTAGAGGCTGG + Intergenic
1009492033 6:64303181-64303203 GCAGTTGCAATGTTAGAAGCCGG - Intronic
1012588417 6:100950254-100950276 GCAGTTACATTATTAGAGGCTGG - Intergenic
1012718762 6:102713027-102713049 GTAGTGGCAATTTTAGAAACAGG - Intergenic
1014291515 6:119563914-119563936 GAAGTTGCACTATTAGAAGGTGG - Intergenic
1014766548 6:125413166-125413188 CCATTTGCAAGATTAGAAGCAGG - Intergenic
1015088317 6:129323689-129323711 GCAGTTGAAAGGTTATATGCAGG + Intronic
1015135365 6:129863361-129863383 GCTGTTACAATGTTACCAGCAGG - Intergenic
1015534912 6:134258000-134258022 GAAGTTGCAAGGTGAGAAGGTGG - Intronic
1016545803 6:145222030-145222052 GCAGTTTAAATATAAGAAGCAGG + Intergenic
1016572612 6:145531946-145531968 GCAGTCGCATTGTTAGAAGCTGG - Intronic
1017081438 6:150673024-150673046 TCAGTTTCAATGTTTGAAGTAGG - Intronic
1017282352 6:152638063-152638085 GCAGTGGGAATGTTGGCAGCAGG - Intergenic
1017292690 6:152759529-152759551 GAAGTTTCAGTGTCAGAAGCAGG - Exonic
1017606920 6:156144719-156144741 GCAGTTGTGATGGCAGAAGCAGG + Intergenic
1020868153 7:13591527-13591549 TCAGTTCCAATGTGAGAACCTGG + Intergenic
1021024077 7:15643192-15643214 GCAGTTGCACTGTTGGCAGTGGG + Intronic
1022552449 7:31253790-31253812 TCACATGCAGTGTTAGAAGCTGG - Intergenic
1022618061 7:31952707-31952729 GCCCTTGCAATGTGACAAGCAGG - Intronic
1022723838 7:32963525-32963547 GTACCTGGAATGTTAGAAGCTGG - Exonic
1022828774 7:34043970-34043992 TGAGTTGAAATCTTAGAAGCAGG + Intronic
1023242562 7:38163383-38163405 GCAGTCCCATTGTTAGAAGCTGG - Intergenic
1024154069 7:46602505-46602527 GCAGTAGCAATAGTAGGAGCAGG + Intergenic
1025049788 7:55724390-55724412 GTACCTGGAATGTTAGAAGCTGG + Intergenic
1025805542 7:64828389-64828411 GCAGTTACACTCTTAGAATCAGG - Intronic
1026086045 7:67264077-67264099 GCAGTAGAAATGTTGGAAGTGGG - Intergenic
1031156749 7:118119748-118119770 GCAGTTGCGTTCTTAGAGGCTGG - Intergenic
1036550366 8:9810324-9810346 GCAGTTACATTATTAGAGGCTGG - Intergenic
1045652902 8:104358296-104358318 GCAGTGACATTGTTAAAAGCAGG + Intronic
1046284248 8:112074215-112074237 CCAGCTGCAATGGTAGTAGCAGG - Intergenic
1046389584 8:113552279-113552301 TCAGTTGCAATATTAGAAATTGG + Intergenic
1047321410 8:123787679-123787701 GCAGTCACAATGTTTGAAGTAGG + Exonic
1051904804 9:22082885-22082907 ACAGGTGCAATATTAGAAGATGG + Intergenic
1053368818 9:37543376-37543398 GGAGTTGCAATTCTAGAATCAGG + Intronic
1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG + Intergenic
1060580698 9:124743597-124743619 GTAATTGCAAAGCTAGAAGCCGG - Intronic
1061266674 9:129509803-129509825 GAAGGTGCCATGTTTGAAGCAGG - Intergenic
1203486013 Un_GL000224v1:55618-55640 GCAGAAGAAATGTTTGAAGCTGG - Intergenic
1186326802 X:8486710-8486732 GCAGTGGAACCGTTAGAAGCAGG - Intergenic
1187841588 X:23494353-23494375 GCAGCTTGAAGGTTAGAAGCAGG + Intergenic
1189908258 X:45783737-45783759 GCAGTTCCTATATTAGAAGAGGG + Intergenic
1191962399 X:66718401-66718423 CCAGTTCCAATGTTATGAGCTGG - Intergenic
1192717588 X:73660358-73660380 GCAGTTACATTATTAGAGGCTGG + Intronic
1193140913 X:78025738-78025760 TCAGTGGAAATGTTACAAGCTGG + Intronic
1195406128 X:104515266-104515288 GCATTTAGAAAGTTAGAAGCTGG + Intergenic
1200573695 Y:4863478-4863500 CCAGCTGTAATGTTAGCAGCAGG + Intergenic
1200849105 Y:7864440-7864462 GCAGTTGCATTGTTAGAAGCTGG + Intergenic
1201435183 Y:13951232-13951254 GCAGTGGAACTGTTAGAAGCAGG + Intergenic
1202053389 Y:20804315-20804337 GCAGTTACATTATTAGAGGCTGG - Intergenic
1202090670 Y:21185417-21185439 ACAGTTACATTGTTAAAAGCTGG - Intergenic
1202142938 Y:21747125-21747147 GCAGTTATGTTGTTAGAAGCTGG - Intergenic
1202143920 Y:21758493-21758515 GCAGTTATGTTGTTAGAAGCTGG + Intergenic