ID: 1009493611

View in Genome Browser
Species Human (GRCh38)
Location 6:64323829-64323851
Sequence ATCCATCCAGATCTCCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009493608_1009493611 16 Left 1009493608 6:64323790-64323812 CCATAATGGACATATGGAGTGTG 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1009493611 6:64323829-64323851 ATCCATCCAGATCTCCCTCTAGG 0: 1
1: 0
2: 1
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009493611 Original CRISPR ATCCATCCAGATCTCCCTCT AGG Intronic
902368501 1:15991881-15991903 ACCCAGCCAGACCTCCCTCTGGG - Intergenic
903812782 1:26044166-26044188 CCCCATCCAGATCACCCTCCTGG + Intronic
904379386 1:30101017-30101039 ATCCATCAGGCCCTCCCTCTGGG - Intergenic
906724926 1:48037222-48037244 ATCCATCCAGATGTCCTTAAAGG + Intergenic
907222362 1:52916354-52916376 CTCCACCTACATCTCCCTCTCGG + Intronic
907487496 1:54787833-54787855 ACCCAACCACATCTCCTTCTCGG - Intronic
909389443 1:75102017-75102039 ATACTTCCATATCTCACTCTGGG + Intergenic
909985421 1:82155556-82155578 TTACATCCTGATATCCCTCTCGG + Intergenic
911420114 1:97630430-97630452 CTCCCTCCACATCCCCCTCTTGG + Intronic
912711418 1:111952669-111952691 ATCCTTCGGCATCTCCCTCTGGG - Intronic
915971857 1:160360747-160360769 AGCCATCCAGATGACCCACTGGG + Intergenic
916047712 1:161013216-161013238 ATTCATCCAAACTTCCCTCTGGG + Intronic
918503624 1:185227191-185227213 ATCCATCCACAGCTCCCTTCAGG + Intronic
921410959 1:214836027-214836049 ATTCTTCCAGACCTCCCTTTGGG + Intergenic
924707550 1:246511833-246511855 ACCCAGCCAGACCTCCCCCTGGG + Intergenic
1066008674 10:31171888-31171910 TTCCAAGCTGATCTCCCTCTGGG - Intergenic
1068797440 10:61099215-61099237 ATCCATTCAGAACTTCCTCAGGG - Intergenic
1077445968 11:2591029-2591051 CTGCATCCATCTCTCCCTCTCGG + Intronic
1083440352 11:62672056-62672078 AACCATCCAGTTCTTCCTCCAGG - Exonic
1084121442 11:67071413-67071435 CCCCATCCACCTCTCCCTCTAGG + Exonic
1084366811 11:68706859-68706881 CTCCATCCTGCTGTCCCTCTCGG - Intergenic
1085104708 11:73832095-73832117 ATCCTTCCACATCTTTCTCTTGG - Intronic
1085691645 11:78669172-78669194 ATCCATGTAGATCTCCCCATAGG + Exonic
1087203377 11:95368234-95368256 ATGCTTCCATTTCTCCCTCTAGG - Intergenic
1087353182 11:97059830-97059852 ACCCAACATGATCTCCCTCTAGG - Intergenic
1087659999 11:100976164-100976186 ATCCCTCCAGATTTCTCCCTGGG - Exonic
1089366080 11:117921858-117921880 TTCCATCCTGATGTCCCTGTTGG - Intronic
1089857729 11:121561488-121561510 ATCTATCCAGACCTCACTCTGGG - Intronic
1090249974 11:125244414-125244436 ACCCTTCCAGATCTGTCTCTTGG + Intronic
1090357957 11:126153140-126153162 ATCCATCCTGATGTCCCTCATGG + Intergenic
1092988241 12:13868144-13868166 ATCAATACAGGTCTCCTTCTTGG - Intronic
1095864112 12:46952670-46952692 AGCCATCTAGCTCTTCCTCTGGG + Intergenic
1097494814 12:60317542-60317564 CTCCATCCACACCTCCTTCTTGG + Intergenic
1098359477 12:69640947-69640969 ATCCATCAAGATCCATCTCTAGG + Intergenic
1101204816 12:102475947-102475969 CTCCATCCACAACTCCCTCTGGG - Intronic
1101789099 12:107911869-107911891 TTCACTCCAGATCTTCCTCTGGG + Intergenic
1101856341 12:108446467-108446489 ATCCATTGAGATCTCCCTATGGG + Intergenic
1106235793 13:27859101-27859123 ATCCATCTAGATCCCCATCCAGG - Intergenic
1107230419 13:38103637-38103659 AGCCATCCAGATCTCTTTCCTGG + Intergenic
1111702691 13:91710914-91710936 AACCACCCACATTTCCCTCTAGG - Intronic
1112360421 13:98712519-98712541 GTCCAGCCAGTGCTCCCTCTTGG + Exonic
1112809571 13:103202031-103202053 ATCTACCTAGATCTCCTTCTTGG + Intergenic
1114035632 14:18624478-18624500 ATCCCTCCAGATTTCTCCCTGGG + Intergenic
1114123004 14:19690544-19690566 ATCCCTCCAGATTTCTCCCTGGG - Intergenic
1117396428 14:55314873-55314895 ATCCCCCCACTTCTCCCTCTTGG + Intronic
1119912379 14:78361461-78361483 TTTCATCCGCATCTCCCTCTTGG - Intronic
1121783512 14:96637923-96637945 GTCCATCCATGTCTCCCTCCCGG + Intergenic
1202855374 14_GL000225v1_random:47423-47445 ATACGTCCTGATGTCCCTCTAGG + Intergenic
1125583622 15:40805009-40805031 AACCCTCCAGATTTCCCACTTGG + Intronic
1127531104 15:59844354-59844376 TTTCATCCAGATCTGCATCTTGG - Intergenic
1128808867 15:70555513-70555535 TTCCCTCCAGAGCTCCCTGTGGG - Intergenic
1129185052 15:73900991-73901013 ATGCATCCACATCTCTCCCTGGG - Intergenic
1129592883 15:76932354-76932376 ATTCATCCACATCTTCCTTTAGG - Exonic
1134317787 16:13135518-13135540 TTCCATCCAGATCTCCTTGCTGG + Intronic
1135684218 16:24485239-24485261 TTCCATCCAGACCTATCTCTGGG - Intergenic
1135812318 16:25599280-25599302 ATCCAGCATGATCTCCCTCCTGG - Intergenic
1139227249 16:65244756-65244778 ATCCATCCACACCTCCCCATCGG + Intergenic
1140801308 16:78491003-78491025 TTCCTTCCACCTCTCCCTCTTGG + Intronic
1142132721 16:88438241-88438263 CTCCAGCAAGCTCTCCCTCTGGG + Exonic
1143017003 17:3896243-3896265 ATTCCGCCAGATCTCCCTCCTGG + Intergenic
1143454648 17:7058606-7058628 AACCATCTAGAACTCCCTGTTGG + Intergenic
1150686740 17:67327043-67327065 ATCCTGCCACATCCCCCTCTCGG - Intergenic
1151391880 17:73792958-73792980 ATCCCTCCATATCTCCAACTCGG - Intergenic
1203160410 17_GL000205v2_random:43913-43935 ACTCCTCCAGTTCTCCCTCTTGG - Intergenic
1155297934 18:24402352-24402374 AACCATCTAGATTTCTCTCTTGG + Intergenic
1157324410 18:46658301-46658323 AGCCATCCAAATCTTCCACTAGG + Intergenic
1157689393 18:49668784-49668806 TTCCATCCCACTCTCCCTCTAGG + Intergenic
1160274053 18:77413820-77413842 CTCCATTCTGCTCTCCCTCTAGG + Intergenic
1162412550 19:10515148-10515170 CTCCATCCTGAACTCCCCCTTGG - Intronic
1164513612 19:28916346-28916368 AACCTTCCAGAGCTCCCTCTTGG + Intergenic
1166106209 19:40599340-40599362 ATGCATCCAGCTCTCCCACTGGG - Intronic
1166361071 19:42253316-42253338 CTCCATCCAGTTCTCCATCCCGG - Intronic
1167682280 19:50931124-50931146 CTCTTTCCAGATCTCTCTCTGGG + Intergenic
1167684673 19:50949230-50949252 AACCATCCTCAACTCCCTCTTGG + Intronic
1168201910 19:54821735-54821757 TTCCAGGCAGATTTCCCTCTGGG + Exonic
925450680 2:3966914-3966936 ATGCATCCAGTTCTCCCCCTTGG - Intergenic
925765612 2:7232353-7232375 ATCCATCCATTTCTACCTCGTGG - Intergenic
926269805 2:11356711-11356733 ATCCAGCCAGATGTCCTTCATGG - Intergenic
927499131 2:23570609-23570631 ATCCATCCACAGCTCCAACTGGG - Intronic
935882604 2:107580681-107580703 ACCCATCCAGACCTCTCTCTAGG - Intergenic
937127809 2:119485379-119485401 ACCCACCCAGACCTGCCTCTGGG - Intronic
938274762 2:130008469-130008491 ATCCCTCCAGATTTCTCCCTGGG - Intergenic
938440607 2:131328809-131328831 ATCCCTCCAGATTTCTCCCTGGG + Intronic
938566251 2:132521581-132521603 ATGCTTCCAAATATCCCTCTGGG - Intronic
940538951 2:154985743-154985765 ATACATAAAGATCTCCATCTTGG - Intergenic
944287780 2:197971477-197971499 ATCCGTCCATAACTCCTTCTGGG - Intronic
945977102 2:216279581-216279603 TTCCATCCGGGTCTCCCTGTTGG - Intronic
946142775 2:217705873-217705895 ATCCTTCTAGATGTCCCTCTGGG - Intronic
1168823460 20:792868-792890 ATCCCTCCAGATGGCCCCCTAGG + Intergenic
1170574429 20:17651942-17651964 CTCCTGCCAGGTCTCCCTCTGGG + Intronic
1171157864 20:22892906-22892928 ATTCATCCACATCTCCATTTTGG + Intergenic
1174334095 20:49845557-49845579 ATCCTTCCATGTCTCCCTCTCGG + Intronic
1174900532 20:54494834-54494856 CTGCATGCAGATCTCCTTCTTGG + Intronic
1175921553 20:62452750-62452772 CTCCACCCAGATCACCCTCTGGG + Intergenic
1178188493 21:30253360-30253382 ATCCATACTGTTCTCCATCTTGG - Intergenic
1178507565 21:33175158-33175180 GTCCATGGAGATCTCCCTCAGGG - Intergenic
1179928893 21:44553993-44554015 CTCCACCCAGGTATCCCTCTTGG + Intronic
1180459755 22:15551532-15551554 ATCCCTCCAGATTTCTCCCTGGG + Intergenic
1181942066 22:26485769-26485791 ATAGACCCAGATCTCTCTCTGGG + Intronic
1183731546 22:39621421-39621443 ATCCATCCTGAGCGCCCTGTGGG + Intronic
1184781828 22:46653520-46653542 ATCCATCCACATCTGTCCCTGGG + Intronic
1185243298 22:49758476-49758498 CTCCATCCACAGCTCCCTTTAGG + Intergenic
950836072 3:15920201-15920223 CTCCATCCACATATCCCTCAAGG + Intergenic
952185480 3:30963388-30963410 CTTCAGTCAGATCTCCCTCTAGG + Intergenic
953223970 3:40999485-40999507 ATCCAGCCAGCTCTCCCTGTGGG - Intergenic
953522923 3:43659844-43659866 ATACAACCAGATGCCCCTCTGGG + Intronic
955471293 3:59289030-59289052 ATTCATCCAGTTTTCCCTCCAGG + Intergenic
955782574 3:62501077-62501099 ATCCAGCCACATTTCCATCTGGG - Intronic
957769046 3:84664000-84664022 ACCCATCCAGATATTTCTCTTGG - Intergenic
962976458 3:140450308-140450330 ATCCATCCAGGCCTCCATCCAGG + Intronic
964624933 3:158749720-158749742 TTGCATCCAGCTCTGCCTCTGGG + Intronic
967419759 3:189260074-189260096 GTCAATCCAGATTTCCCTCTGGG + Intronic
970287602 4:14535539-14535561 ATCCCTCCTGATGTACCTCTTGG - Intergenic
972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG + Intronic
972808882 4:42561390-42561412 AGCCCTCCAGACATCCCTCTGGG + Intronic
979726111 4:123963570-123963592 ATTCATCCACTTCTCCCTCCAGG - Intergenic
983223311 4:165063699-165063721 ATCCATCCACTTCAGCCTCTAGG + Intergenic
987225631 5:15838116-15838138 ATCCATCCACATCTCCCACTTGG - Intronic
991179149 5:63728597-63728619 TTCAATTCAGATCTCTCTCTTGG - Intergenic
995376454 5:111479860-111479882 ATCCATCCAGTTCTCTCCCCCGG + Intronic
998556130 5:143125389-143125411 ATCCATCTATATCTTCCTCCTGG + Intronic
999929639 5:156417257-156417279 TTCCATCCCTATTTCCCTCTTGG + Intronic
1001802067 5:174552976-174552998 ATCCAGCCAAATCTACTTCTGGG + Intergenic
1003575391 6:7289088-7289110 ATCACTCCAGAGCTACCTCTGGG + Exonic
1005330508 6:24745429-24745451 ACACACACAGATCTCCCTCTTGG - Intergenic
1005728443 6:28672270-28672292 ATCCAGCAAGATCTACCTCAAGG - Intergenic
1008002147 6:46371709-46371731 CTCCATCTTGATCTCCATCTAGG - Intronic
1008292899 6:49739425-49739447 ATTCAACCAGCTCCCCCTCTGGG - Intronic
1008783249 6:55133695-55133717 ATCTATCTATATCTCCATCTAGG + Intronic
1009493611 6:64323829-64323851 ATCCATCCAGATCTCCCTCTAGG + Intronic
1009699763 6:67161087-67161109 ATCCACACAGAGCTCCCACTGGG + Intergenic
1011125152 6:83999319-83999341 ATCCTTCCAGACCTGTCTCTTGG - Intergenic
1015442264 6:133262879-133262901 ATTCATCCAGATCTGTTTCTTGG + Intronic
1016405103 6:143721464-143721486 AGCCATCTAGTTCTCTCTCTAGG + Intronic
1017814370 6:158006003-158006025 ATCCGTCCTGACCTCTCTCTTGG + Intronic
1018237477 6:161740488-161740510 ATCCAGACAGATATGCCTCTGGG + Intronic
1021317794 7:19171447-19171469 TTCCATCCAGAACTCCCTGCCGG + Intergenic
1021481292 7:21120696-21120718 ATCCATCTCCATCTCCCTTTAGG + Intergenic
1021908311 7:25358670-25358692 TTCCATCCACATCTCTCTCCAGG + Intergenic
1022605559 7:31810717-31810739 ATGCACCTGGATCTCCCTCTTGG + Intronic
1024164347 7:46715318-46715340 CTCTTTCCTGATCTCCCTCTGGG + Intronic
1024405611 7:48976037-48976059 ATCCAACCACATCTGCCTGTGGG - Intergenic
1025996305 7:66529606-66529628 CTCCTTCCAGCCCTCCCTCTAGG - Intergenic
1026644661 7:72157120-72157142 ATCGATCAAGATCTCCCACTAGG - Intronic
1029634829 7:101776827-101776849 ACCACTCCAGATCTCCCGCTAGG + Intergenic
1029848030 7:103433384-103433406 ACTCATTCAGATCTCCCTCCAGG - Intronic
1030108335 7:106005901-106005923 ATCCATCCAGGTCAGCGTCTTGG - Intronic
1032028769 7:128464217-128464239 ACCCTGCCAAATCTCCCTCTCGG + Intergenic
1033290245 7:140077252-140077274 ATCCATCGAGGTCAGCCTCTGGG - Intergenic
1034748687 7:153547861-153547883 ATCCTCCCAGATATCCCTCTAGG + Intergenic
1034812143 7:154141993-154142015 ATCCTTCAACATCTCCATCTGGG - Intronic
1035035287 7:155890674-155890696 ATGCATCAAGAGCTCCGTCTTGG - Intergenic
1041015690 8:53591265-53591287 TTGCATCCAGATATCTCTCTTGG + Intergenic
1042058339 8:64789827-64789849 ATAAATCCACATCTCCATCTGGG + Intronic
1043294504 8:78646434-78646456 ATCAATCCAAATGTCCCTCTGGG - Intergenic
1044095554 8:88059790-88059812 AACCATCCATGTCTCTCTCTTGG + Intronic
1044440783 8:92221434-92221456 ATACAGCCAGATGCCCCTCTGGG - Intergenic
1045199487 8:99965727-99965749 ATCCATCCATATTTCTCACTAGG + Intronic
1045538079 8:103053346-103053368 ATCCAACCAACTTTCCCTCTAGG - Intronic
1047037428 8:120955247-120955269 CTCCATCCAGTTCTGTCTCTGGG + Intergenic
1047528920 8:125657643-125657665 ATGCACCCAGCACTCCCTCTGGG - Intergenic
1047827436 8:128592882-128592904 ATCCTTCCACATCAGCCTCTTGG - Intergenic
1048756603 8:137746494-137746516 ATCACTCCAGATTTCCCTCATGG - Intergenic
1048965335 8:139610675-139610697 ATCCATCTAGATGTCCCTCCTGG - Intronic
1049261271 8:141640516-141640538 CTCCAACCAGATCTTCCTCCTGG + Intergenic
1050100615 9:2115731-2115753 ACCCTTCCATATTTCCCTCTGGG + Intronic
1052188836 9:25632588-25632610 ATCCATGCAAGACTCCCTCTTGG - Intergenic
1055703877 9:78976767-78976789 ATGCATCCAGATCTCCCGCAGGG + Intergenic
1056414947 9:86366924-86366946 ATCCCCCCAGATAGCCCTCTGGG - Intergenic
1057238163 9:93383037-93383059 GTGCATCCAGATTTCCTTCTGGG - Intergenic
1058914305 9:109550874-109550896 ATCCTTCCAGATATTTCTCTAGG + Intergenic
1059388292 9:113982384-113982406 ATCATTCCAGCTCTACCTCTCGG + Intronic
1059562107 9:115345933-115345955 ACCCATCCAGAAATCTCTCTTGG - Intronic
1062120309 9:134830571-134830593 AGCCATTCAGAGCTCCTTCTAGG + Intronic
1203490691 Un_GL000224v1:102361-102383 ATCCATCCTCGTCTCCCGCTTGG + Intergenic
1203503315 Un_KI270741v1:44239-44261 ATCCATCCTCGTCTCCCGCTTGG + Intergenic
1187433086 X:19242418-19242440 ATTAATCCAGGTCTGCCTCTTGG - Intergenic
1192372864 X:70529562-70529584 ATCTTTCCAGAGCTCACTCTTGG + Intronic
1193207806 X:78769449-78769471 ATCATTCCAGATGTCCCTGTCGG - Intergenic
1198639214 X:138738074-138738096 ATCAATCCAAATCTCCATTTGGG + Intronic
1198688792 X:139257877-139257899 AGACATCCAGATCTCCCACTTGG + Intergenic
1201126529 Y:10920122-10920144 ATACATCCAAATGTCCCTGTAGG - Intergenic