ID: 1009502526

View in Genome Browser
Species Human (GRCh38)
Location 6:64433250-64433272
Sequence ATTTTGTTATTGTTGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1999
Summary {0: 1, 1: 0, 2: 8, 3: 191, 4: 1799}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009502526_1009502530 -4 Left 1009502526 6:64433250-64433272 CCATATTTCAACAATAACAAAAT 0: 1
1: 0
2: 8
3: 191
4: 1799
Right 1009502530 6:64433269-64433291 AAATAAAAGAGGGTAAAACTGGG No data
1009502526_1009502531 -3 Left 1009502526 6:64433250-64433272 CCATATTTCAACAATAACAAAAT 0: 1
1: 0
2: 8
3: 191
4: 1799
Right 1009502531 6:64433270-64433292 AATAAAAGAGGGTAAAACTGGGG 0: 1
1: 0
2: 1
3: 38
4: 465
1009502526_1009502529 -5 Left 1009502526 6:64433250-64433272 CCATATTTCAACAATAACAAAAT 0: 1
1: 0
2: 8
3: 191
4: 1799
Right 1009502529 6:64433268-64433290 AAAATAAAAGAGGGTAAAACTGG 0: 1
1: 1
2: 9
3: 104
4: 1195
1009502526_1009502532 -2 Left 1009502526 6:64433250-64433272 CCATATTTCAACAATAACAAAAT 0: 1
1: 0
2: 8
3: 191
4: 1799
Right 1009502532 6:64433271-64433293 ATAAAAGAGGGTAAAACTGGGGG 0: 1
1: 0
2: 1
3: 33
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009502526 Original CRISPR ATTTTGTTATTGTTGAAATA TGG (reversed) Intronic
900144832 1:1153664-1153686 ATTTTTTTATTTTTGAGACAGGG + Intergenic
901037674 1:6346105-6346127 GTTTTGTTTTTGTAGAAACAGGG + Intronic
901265530 1:7907749-7907771 AGTTTGGAGTTGTTGAAATAGGG - Intergenic
901372024 1:8807056-8807078 ATTTTGTTGTTGTTGAGACAGGG + Intronic
901719670 1:11186511-11186533 ATTTTGCTGGTGTTGAAAGAGGG - Intronic
901724686 1:11231737-11231759 TTTTTGTTGTTGTTGAGACAGGG + Intronic
902034590 1:13447883-13447905 ATTTTTGTATTTTTGAGATAGGG - Intergenic
902099927 1:13978926-13978948 ATTTTGTTTTTGTAGATACAGGG - Intergenic
902859581 1:19235393-19235415 ATTTATTTTTTGTTGAGATAAGG - Intronic
902993579 1:20206543-20206565 TTTTTGTTGTTTTTGAGATAAGG + Intergenic
903196230 1:21690528-21690550 TTTTTGTTGTTGTTGAGACAGGG + Intronic
903528027 1:24007727-24007749 ATTTTTTTTTTTTTGAGATAGGG - Intergenic
903606634 1:24579720-24579742 ATTTATTTATTTTTGAAACAAGG - Intronic
903909468 1:26711908-26711930 TTTTTGTTTTTGTAGAGATAGGG - Intronic
904066006 1:27751672-27751694 TTTTTGTATTTGTAGAAATAGGG + Intronic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
904582371 1:31554606-31554628 TTTTTGTTGTTGTTGATACAGGG + Intergenic
904628122 1:31820128-31820150 CTTTTTTTTTTGTTGAGATAAGG + Intergenic
905133734 1:35781433-35781455 ATTTTTTTCTTTTTGAAACAGGG + Intergenic
905428397 1:37902545-37902567 ATTTTTTTTTTGTAGAAATAGGG - Intronic
905439182 1:37982920-37982942 AATTTTTTTTTGTAGAAATAGGG - Intronic
905877723 1:41443599-41443621 ATTTTTTTTTTGTAGAAACAGGG + Intergenic
905966988 1:42106864-42106886 ATTTTTTTATTGTAGAGATGGGG - Intergenic
906113886 1:43342768-43342790 ATTTTATTATTTTTGAGATAGGG + Intronic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
906474035 1:46155313-46155335 TTTTTGTTGTTGTTGAGACAGGG - Intronic
906483987 1:46220611-46220633 ATTTTTTTTTTGTAGAGATAGGG + Exonic
906503176 1:46357183-46357205 ATTTTTTTATTTTTGAGACAGGG + Intronic
907083786 1:51649878-51649900 TTTTTGTTGTTGTTGAAAAAAGG + Intronic
907183809 1:52593558-52593580 GTTTTGTTATCTTTGAAATGGGG - Intergenic
907224150 1:52928764-52928786 TTTTTGTTTTTGTTGAGACAAGG - Intronic
907285081 1:53374925-53374947 ATTTTTTTTTTTTTGAAATGAGG + Intergenic
907353469 1:53852756-53852778 ATTTTGTTATTTGGGCAATAGGG + Intronic
907414786 1:54306788-54306810 ATTTTTTTATTGTGGAGATCAGG - Intronic
907449296 1:54532935-54532957 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
907694905 1:56714979-56715001 TTTTTTTAATTGTTGAAATTGGG + Exonic
907723253 1:56993831-56993853 GTTTTGTTTTGGTTGAAACAGGG - Intergenic
907781808 1:57573784-57573806 GTTGTGTTATTTTTGTAATATGG - Intronic
907816209 1:57920488-57920510 ATTTTCTTTTTTTTGAAACAGGG + Intronic
908008020 1:59746666-59746688 TTTATGTTTTTGTTGAGATAGGG + Intronic
908049700 1:60215708-60215730 ATTTTGGTTGTGTTGAAATATGG + Intergenic
908352741 1:63302218-63302240 TTTTTTTTTTTTTTGAAATAGGG + Intergenic
908695599 1:66837541-66837563 AATTTGTTCTTGTTGACATAGGG - Intronic
908850396 1:68369955-68369977 ATTTTGTTATTTTTGAGCTAGGG + Intergenic
908886885 1:68799453-68799475 ATTTAGTTTTTGTTGTATTATGG + Intergenic
908953606 1:69593609-69593631 ATTTCCTTATTGTTGCAATTTGG - Intronic
909046428 1:70715961-70715983 ATTTTTATTTTTTTGAAATAGGG + Intergenic
909098096 1:71315102-71315124 ATTTTTTTCTTGTTTATATATGG + Intergenic
909161521 1:72157141-72157163 GTTTTGTTTTTGTAGAGATAGGG + Intronic
909196479 1:72632625-72632647 ATTCTCTAATTGTTGAAATAGGG + Intergenic
909212521 1:72842717-72842739 ATTTTGTAATTGTGAAAGTATGG + Intergenic
909508645 1:76425154-76425176 AGTTTGTGATTTTTGAAATGTGG - Intronic
909827534 1:80144042-80144064 ATTTTGTAATTTTTTAAATTGGG - Intergenic
909844491 1:80374682-80374704 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
909914326 1:81298811-81298833 ATTTTTTTTTTTTTCAAATAAGG + Intergenic
910446714 1:87305813-87305835 ATTTTGTAATTGTTCTAATGGGG + Intergenic
910585811 1:88878265-88878287 ATTTTTTTATTTTTGAGACAGGG - Intronic
910615720 1:89196178-89196200 ATTTATTTATTGTTGAAAATTGG - Intronic
910686385 1:89921330-89921352 TTGTTGTTTTTTTTGAAATAGGG - Intronic
910702928 1:90096027-90096049 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
910738011 1:90483344-90483366 ATTTTTTTTTTTTTGAGATAGGG - Intergenic
910815172 1:91284763-91284785 TTTTTGTTATTTTTAATATATGG - Intronic
910905945 1:92178657-92178679 TTGTTGTTATTGTTGAGACAGGG + Intronic
910963080 1:92782824-92782846 TTTTTGTTTTTTTTGAAAGACGG + Intronic
911046176 1:93630625-93630647 ATTTTATTTTTTTTGAAACAAGG - Intronic
911049570 1:93659186-93659208 TTTTTGTTGTTGTTGAGACAGGG + Intronic
911080545 1:93925261-93925283 ATTTTGTTATCATTGATATACGG + Intergenic
911084316 1:93963786-93963808 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
911318582 1:96384517-96384539 ATTTTTTTATTTTTGGATTATGG - Intergenic
911354640 1:96800902-96800924 ATTTTTTTTTTCTTGAAATCTGG - Intronic
911409612 1:97486376-97486398 TTTTTGTTGTTGTTGAAAGTTGG + Intronic
911693838 1:100865007-100865029 ATTTTATTATTTTAGAGATAAGG + Intergenic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
911817682 1:102374634-102374656 ATTTTATTTTTGTAGAGATAGGG - Intergenic
912019337 1:105087466-105087488 ATTTTGTTTTTGTTCAGGTATGG + Intergenic
912045509 1:105449674-105449696 AGATTTATATTGTTGAAATAAGG - Intergenic
912283416 1:108341929-108341951 ATTTTGGTTTTGTTGATCTATGG - Intergenic
912356182 1:109055849-109055871 TTTTTTTTATTTTTGAGATAGGG + Intergenic
912506287 1:110158802-110158824 ATTTTGGAATTGATGAAATAAGG - Intronic
912532556 1:110337055-110337077 ATTTGATAATTGCTGAAATAGGG + Intergenic
912666620 1:111586574-111586596 TTTTTGTTGTTGTTGAGATGTGG - Intronic
912820001 1:112859430-112859452 GTTTTATTATTGGTGAAATAGGG - Intergenic
913171365 1:116235122-116235144 TTTTAGTTTTTGTAGAAATAGGG - Intergenic
913215976 1:116620745-116620767 TTTTTGTTGTTGTTGAGACAGGG + Intronic
913490188 1:119372404-119372426 ACTTTGTTCTTCTTGACATAAGG + Intronic
914238576 1:145835136-145835158 TTTTTTTTTTTTTTGAAATAGGG - Intronic
914255463 1:145958525-145958547 ATTTTGTTATTTTAGGGATAAGG + Intergenic
914422068 1:147538306-147538328 ATTTTATAATTGAGGAAATAGGG + Intergenic
914700393 1:150127321-150127343 ATTTTTTTTTTTTTGAAACAGGG + Intronic
914818840 1:151084074-151084096 ATTTTTTTAATGTGGAAATGGGG + Intronic
915155785 1:153874878-153874900 ATTTATTTATTTTTGAAACAGGG + Intronic
915239641 1:154511037-154511059 ATTTTTTTTTTTTTGAAACAGGG - Intronic
915327832 1:155090156-155090178 TTTTTTTTTTTGTAGAAATAGGG - Intergenic
915396171 1:155586346-155586368 ATTTTTTTATTTTTGTAATAAGG + Intergenic
915562920 1:156697875-156697897 ATTTTGTTGTTTTTTAAACAGGG + Intergenic
915652550 1:157326927-157326949 ATTTTGTTATAGCTGGAATATGG + Intergenic
915987712 1:160482810-160482832 ATATTTTTATTGTAGAATTAAGG - Intergenic
916271576 1:162948365-162948387 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
916339184 1:163709870-163709892 ATTTTGTTATTGTGGAAAACTGG + Intergenic
916723816 1:167505271-167505293 TTGTTGTTGTTGTTGAGATACGG + Intronic
916762005 1:167825476-167825498 TTTTTGTTGTTGTTGAAACAGGG - Intronic
916858593 1:168778193-168778215 ATTTATTTATTTATGAAATAGGG - Intergenic
917088961 1:171333227-171333249 TTTTTGTTCTTGTTGAGACAGGG + Intronic
917169629 1:172156737-172156759 ATTTTTTTATTTTTGCAGTAAGG + Intronic
917311385 1:173682801-173682823 AATTTGTCCTAGTTGAAATATGG - Intergenic
917381838 1:174419585-174419607 AATTTGTTATTGTAAAAAGATGG + Intronic
917396377 1:174598906-174598928 ATATTGTTATTGATAAACTAAGG + Intronic
918550542 1:185737159-185737181 ATTTTTTTTTTTTTGAAACAGGG + Intronic
919023480 1:192137990-192138012 GTTTTGTTTTTTTTGAGATAGGG - Intergenic
919312910 1:195933780-195933802 CTTTTTTTATTGTTTTAATAAGG - Intergenic
919503046 1:198362145-198362167 GTTTTATAATTATTGAAATATGG - Intergenic
919716338 1:200781317-200781339 ATTTTTATATTGTTGGCATAGGG + Intronic
919958654 1:202443469-202443491 AACTAGTTATTGTTGAAACATGG + Intronic
920030128 1:203032437-203032459 TTGTTGTTGTTTTTGAAATAGGG + Intronic
920053464 1:203176924-203176946 TATTTGTAATTGTTGAAATGTGG + Intergenic
920159131 1:203982485-203982507 ATTTTTTTTTATTTGAAATAAGG - Intergenic
920193452 1:204210610-204210632 ATTTTTTTGTTGTTGAGACAGGG + Intronic
920508478 1:206533581-206533603 TTTTTGTTGCTGTTGAAACAGGG - Intronic
920668569 1:207985008-207985030 ATGTTGTTTTGGTTGAAATATGG + Intergenic
920763357 1:208807419-208807441 TGTTTATTTTTGTTGAAATATGG + Intergenic
921452127 1:215321654-215321676 ATTTTGATATTGCTGACAAAGGG + Intergenic
921517480 1:216114172-216114194 GATTTGTTATTGCTGAATTATGG + Intronic
921569475 1:216761174-216761196 ATTTTCTTGTTCTAGAAATAAGG + Intronic
921592424 1:217020236-217020258 ACATTGTTATTTTTAAAATATGG - Intronic
921881964 1:220265750-220265772 TTTTGGTTTTTGTTGAGATAGGG - Intronic
921894449 1:220384971-220384993 ATTTTTGTTTTTTTGAAATAGGG + Intergenic
922008905 1:221561242-221561264 ATTTTGTTATTGTTAAATTTAGG + Intergenic
922128943 1:222757603-222757625 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
922189621 1:223306496-223306518 ATTTTTTTGTTTTTGAGATAGGG + Intronic
922277046 1:224088828-224088850 AATTTGTTTTTGTGGAAATGAGG - Intergenic
922296969 1:224259093-224259115 ATTTTTTTTTTTTTGAGATAGGG + Intronic
922605208 1:226885874-226885896 ATTTTCTTTTTCTTGAAACATGG + Intronic
922686384 1:227641748-227641770 TTTTTTTTTTTGTAGAAATATGG - Intronic
922708179 1:227802717-227802739 ATTTATTTATTTTAGAAATAGGG - Intergenic
922936806 1:229429352-229429374 ATTTATTTATTTTTGAAACAGGG + Intergenic
923191220 1:231622646-231622668 ATTTTTTTTTTGTAGAGATAGGG + Intronic
923459830 1:234199044-234199066 TTTTTTTTTTTGTAGAAATAAGG - Intronic
923691415 1:236197047-236197069 ATTTTTTTATTTCTGAATTATGG + Intronic
923715214 1:236419389-236419411 GTTTTGTTTTTGTTGAGATGGGG - Intronic
923734451 1:236590657-236590679 ATTAGGTTATTGTTAAAATGGGG + Intronic
923780056 1:237014141-237014163 TTTTTGTTATGGTTGAGACAGGG - Intergenic
923923073 1:238590931-238590953 ATTTTATTCTTTTTGTAATATGG - Intergenic
923982443 1:239340505-239340527 ATTTATTTATTATTGAGATAGGG + Intergenic
924052232 1:240091271-240091293 TTTTTGTTGTTGTTGACAGAAGG - Intronic
924075556 1:240331166-240331188 ATTGTGTTATTTTCAAAATATGG - Intronic
924235408 1:241995910-241995932 ATTTTTTTTTTTTTGAAACAGGG - Exonic
924248045 1:242104304-242104326 TTTTTTTTTTTGTAGAAATAGGG + Intronic
924307563 1:242706659-242706681 ATTTTATTGTTGATGAAATTTGG - Intergenic
924391689 1:243567312-243567334 ATTTTCTTATTTTTGAGACAGGG + Intronic
1063128456 10:3156254-3156276 GTTTTTTAATTGTTGAAACAAGG - Intronic
1063392867 10:5661501-5661523 ATTTATTTATTTTTGAAACAGGG + Intronic
1063597265 10:7447356-7447378 ATTTATTTATTTTTGAAATGGGG + Intergenic
1063716321 10:8530437-8530459 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1063771708 10:9210970-9210992 ATTTTTTTGTTGTTGTAATTTGG - Intergenic
1063996211 10:11622434-11622456 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1064187246 10:13173034-13173056 ATTTTATTACTGTAGAGATAGGG - Intronic
1064374782 10:14785710-14785732 TTTGTTTTGTTGTTGAAATAGGG + Intergenic
1064382113 10:14854027-14854049 AATTTATTATTGTTTTAATAAGG + Intronic
1064427275 10:15240865-15240887 ATTTTTTTTTTGTAGAGATAGGG - Intronic
1064540606 10:16401769-16401791 TTGTTGTTATTTTTGAGATAGGG + Intergenic
1064586218 10:16842049-16842071 CTTTTTTTTTTTTTGAAATAAGG + Intronic
1064637225 10:17380636-17380658 ATTTTGTCCTAGCTGAAATATGG + Intronic
1064858545 10:19798447-19798469 ATTTACTTATTTTTGAGATAGGG - Intergenic
1064873642 10:19968317-19968339 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1064895557 10:20231997-20232019 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1065030905 10:21584923-21584945 TTTTTGTTTTTTTTGAGATAGGG + Intronic
1065512082 10:26489366-26489388 ATTTTTTTCTTCTTAAAATAGGG + Intronic
1065729213 10:28695135-28695157 TTATTGTTATTTTTGAAACAGGG + Intergenic
1065775946 10:29120354-29120376 ATGTTGCTAGTGTTGGAATATGG - Intergenic
1065837698 10:29674156-29674178 ATTTTTTTTTTGTAGAAATCAGG - Intronic
1065843510 10:29725910-29725932 ATTTTTTTATTTTTTAAAAAAGG - Intronic
1065957065 10:30703203-30703225 TTTTTGTTTTTTTTGAGATAAGG - Intergenic
1066002338 10:31116249-31116271 AGGTTGTTGTTGTTGAGATAAGG - Intergenic
1066114136 10:32224865-32224887 TTTTTTTTTTTTTTGAAATAAGG - Intergenic
1066130995 10:32393886-32393908 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
1066335715 10:34476114-34476136 ATTTTATTTTTGTTGAGGTAAGG - Intronic
1066352052 10:34644858-34644880 ATTTATTTATTTTAGAAATAGGG + Intronic
1066474716 10:35735323-35735345 GTTTTGTTGTTGTTGAATTCTGG + Intergenic
1066668821 10:37815698-37815720 TTTTTGTTGTTGTTGAAAAGTGG + Intronic
1067052783 10:43032421-43032443 AATTTTTTATTGTTGAAAATTGG - Intergenic
1067260856 10:44690162-44690184 ATTTTGTTGTTGTTGAAAATTGG + Intergenic
1067574010 10:47395992-47396014 TTTTTGTTGTTGTTGAAAGTTGG + Intergenic
1067853569 10:49770503-49770525 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1068003384 10:51363587-51363609 ATCTTGTTATTGGTTAACTACGG + Intronic
1068034235 10:51739932-51739954 ATTTTGTTTGTTTTGAGATAGGG - Intronic
1068325041 10:55474111-55474133 ATTTTGTTAATGTAGAAAATTGG - Intronic
1068343444 10:55739150-55739172 ATTTTATAATTTTTAAAATATGG - Intergenic
1068445000 10:57109208-57109230 ATTTTATTATTATTGAAAGGGGG + Intergenic
1068479174 10:57567702-57567724 ATTTTGTTATTTGTGGCATATGG + Intergenic
1068484462 10:57639607-57639629 ATTTTGTCATTGTATAAACATGG - Intergenic
1068582080 10:58753167-58753189 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1068667052 10:59687951-59687973 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1068727687 10:60321348-60321370 CTTTTGTTTTTTTTGAGATAGGG - Intronic
1068828956 10:61471076-61471098 ATTTTGATAATGTTGATATCAGG - Intergenic
1068845456 10:61666695-61666717 ATTTTTTTATATTTGAAATGAGG + Intronic
1069062556 10:63909426-63909448 ATTTTTTGATTGTTGAAACTGGG - Intergenic
1069233772 10:66044893-66044915 ATTTTGTCATTATTAAAATGAGG - Intronic
1069315502 10:67095316-67095338 ATTTTATTATTTCTGAAATTAGG - Intronic
1069505127 10:68990533-68990555 ATTTTGTTGTTGTTGAGAAAAGG - Intronic
1069541681 10:69299177-69299199 AGTGTGTTGTTGTTGAAACAGGG + Intronic
1069658025 10:70104876-70104898 ATTTTAATATTGTTGAAATCAGG - Intronic
1070119564 10:73562713-73562735 ATTTTGAGATTGTAGAAAAATGG - Intronic
1070233217 10:74594746-74594768 ATTTTATAAATGTAGAAATATGG - Intronic
1070272204 10:74967021-74967043 ATTTTTTTATTTTTGAGACAGGG - Intronic
1070587406 10:77776938-77776960 TTTTTGTTTTTTTTAAAATATGG + Intergenic
1070952176 10:80440255-80440277 ATTTTATTATTTTTTAAAGATGG - Intergenic
1071141938 10:82519712-82519734 ATTTTGTTATTATTTTAACATGG + Intronic
1071307615 10:84313061-84313083 TTTTTGTTGTTGTTGAGATAGGG - Intergenic
1072059274 10:91793542-91793564 GTTTTGTTTTTTTTGAAACAGGG - Intergenic
1072385622 10:94924209-94924231 ATTTTTTTATTTTTCAAATGGGG - Intergenic
1072425165 10:95323963-95323985 ATTTTTTTATTTTTGAGACAGGG - Intronic
1072431866 10:95379371-95379393 TTTTTTTTTTTGTTGAGATAGGG - Intronic
1072462473 10:95632370-95632392 ATTTATTTATTTTTGAGATAGGG + Intronic
1072735509 10:97876473-97876495 ATTTCTTTTTTGTTGAAAAATGG + Intronic
1072795239 10:98349589-98349611 TTTTTCTTGCTGTTGAAATATGG + Intergenic
1072961458 10:99933119-99933141 TTTTTGTTATTGTGGAGATGGGG - Intronic
1072964869 10:99963242-99963264 TTTTTGTTATTGTGGAGATGGGG + Intronic
1073198646 10:101716478-101716500 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1073531180 10:104233135-104233157 ATTTATTTATTTTTGAGATAGGG + Intergenic
1073588485 10:104733530-104733552 TTTTTTTTTTTGTAGAAATAAGG + Intronic
1073655778 10:105414499-105414521 ATTTTATTTTTGTTTTAATATGG + Intergenic
1073659744 10:105461826-105461848 CTTTTGTTATTTATAAAATATGG + Intergenic
1073716492 10:106114361-106114383 ATTTTCTTAATGTTCCAATATGG - Intergenic
1073767855 10:106703170-106703192 ATTTTTTTTTTTTTTAAATAAGG - Intronic
1073841131 10:107500424-107500446 ATTTTGTTTTTGTAGAGATGGGG + Intergenic
1073940369 10:108691193-108691215 ATCTTGTTATTATTGACATTGGG + Intergenic
1074169852 10:110920568-110920590 TTTGTGTTATTGTGGAATTATGG + Intronic
1074171215 10:110939390-110939412 ATTTATTTATTATAGAAATAGGG + Intronic
1074330627 10:112504370-112504392 ATTTTGTTGTTGTTTAAAGCAGG - Intronic
1074358517 10:112806590-112806612 TTTTTTTTATTTTTGAGATAGGG + Intronic
1074786355 10:116845286-116845308 ATTTTGTTATTGTTGTTAAAAGG + Intergenic
1074799820 10:116988553-116988575 ATTTTATTATTTTTGAGACAGGG + Intronic
1075174191 10:120144092-120144114 TTTTTGTTGTTGTTGAGATGGGG + Intergenic
1075293309 10:121249802-121249824 ATTTTATGTTTGATGAAATATGG - Intergenic
1075352770 10:121739275-121739297 ATTTTGTTTTTGTAGAGATGGGG + Intergenic
1075388578 10:122075803-122075825 TTTTTTTTATTGTTGAGACAGGG + Intronic
1075416103 10:122265600-122265622 ATTTTGTTATGATTGAGATATGG + Intergenic
1076173661 10:128346263-128346285 ATTTTGTTGTTGTTGAGACAGGG + Intergenic
1076292468 10:129357447-129357469 ATTTTGTTGTTGTTGTGATTGGG - Intergenic
1076660435 10:132052217-132052239 GTTTTGTTGTTGTTGAGACAGGG - Intergenic
1077534203 11:3111856-3111878 AATTTGTCCTAGTTGAAATATGG + Intronic
1077999215 11:7479894-7479916 TTTTTGTTTTTGTTGAGATAGGG + Intergenic
1078126718 11:8572589-8572611 ATTTTATTTTTTTAGAAATAGGG + Intronic
1078173511 11:8949892-8949914 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1078370294 11:10738882-10738904 TTTTTGTTTTTGTAGAGATAGGG - Intergenic
1078378645 11:10819136-10819158 TTTTTGTTTTTTTTGAAACAAGG - Intronic
1078904178 11:15669106-15669128 ATCTTGTTATCTTTTAAATACGG - Intergenic
1078980777 11:16531099-16531121 ATTTGGTGATTGTTGCAATAAGG + Intronic
1079058432 11:17227465-17227487 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1079059529 11:17235996-17236018 ATTTATTTATTTTTGAGATAGGG - Intronic
1079142274 11:17819843-17819865 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1079467910 11:20749592-20749614 ATTTAGTTATTTTTGAGAAAGGG - Intronic
1079660836 11:23035084-23035106 ATTTAGTCCTTGTTAAAATAAGG + Intergenic
1079744882 11:24113028-24113050 GTTCTTGTATTGTTGAAATAAGG - Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1079922208 11:26447035-26447057 ATTTTCTTTTTGTAGAAACAGGG - Intronic
1079956574 11:26873756-26873778 ATTTTGCCATTGTTGTAAAAGGG - Intergenic
1080048026 11:27829858-27829880 TTTTTATTATTATTGAAATTAGG - Intergenic
1080096101 11:28408897-28408919 TTTGTGTTATTGTTGAAAGAGGG - Intergenic
1080152414 11:29068752-29068774 TTTTTGTTTTTGTTGCAATTGGG - Intergenic
1080307088 11:30848442-30848464 ATTTAGTGATTGTGGAAATGTGG + Intronic
1081019454 11:37926544-37926566 ATTTTATTGTTGTTGAATTTAGG - Intergenic
1081261557 11:40967866-40967888 ATTTTAATATTGTTGAAATTAGG - Intronic
1081351563 11:42059249-42059271 ATTTTGTTATAGATGACATTTGG - Intergenic
1081513773 11:43804420-43804442 ATTTTGTTGTTGTTAAAATGAGG - Intronic
1081600193 11:44487542-44487564 ATTTTTTTCTTGTAGAGATAGGG - Intergenic
1081721428 11:45291826-45291848 CTTTTCTTATTGGTAAAATAGGG + Intergenic
1081882483 11:46465391-46465413 ATTTTGTTTTTATTCCAATATGG - Intronic
1081889087 11:46525292-46525314 ATTTATTTATTTTTGAAACAGGG - Intronic
1081920460 11:46770599-46770621 ATTTTGTTTTTGTAGAGATGGGG + Intronic
1082003327 11:47406659-47406681 ATTTTTTTATTTTTGAGACAGGG + Intergenic
1082797059 11:57385848-57385870 TTGTTGTTAATATTGAAATAAGG + Intergenic
1082864113 11:57882847-57882869 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1082907921 11:58332521-58332543 ATTTGTTTATTGTTGAAAGAGGG + Intergenic
1083036656 11:59644168-59644190 ATTTGGTTGATGTTGAAATTGGG - Intronic
1083041454 11:59691500-59691522 ATTTTTTTATTTTTGAGACAGGG + Intergenic
1083078609 11:60067583-60067605 ATTTTCTCATTTTTGAAATGAGG + Intronic
1083211869 11:61193338-61193360 CTTTTGTTGTTGTTGAAACAGGG + Intergenic
1083224327 11:61275046-61275068 TTTTTGTTGTTGTTGACATGGGG - Intronic
1083330171 11:61893902-61893924 TTTTTTTTTTTGTAGAAATAGGG - Intergenic
1083382075 11:62277728-62277750 AATTTGTCCTAGTTGAAATATGG + Intergenic
1083402020 11:62430083-62430105 ATTTATTTATTTTTGAGATAGGG + Intergenic
1083508007 11:63178966-63178988 ATTTTTTTTTTTTTGAAATGGGG + Intronic
1083584412 11:63846342-63846364 ATTTTTTTTTTGTAGAAATGAGG - Intronic
1083585513 11:63855513-63855535 TTTTTTTTGTTTTTGAAATAAGG - Intronic
1083696202 11:64444433-64444455 TTTTTGTTTTTTTTGAGATAGGG + Intergenic
1083929051 11:65829189-65829211 TTGTTGTTGTTTTTGAAATAGGG - Intronic
1083987234 11:66223395-66223417 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1084046484 11:66571328-66571350 TTTTTGTTTTTTTTGAAACAGGG - Intergenic
1084242574 11:67832570-67832592 TTTTTGTTGTTGTCGAAACAGGG + Intergenic
1084327251 11:68408080-68408102 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1084382056 11:68818849-68818871 TTGTTGTTGTTGTTGAGATAGGG - Intronic
1084638852 11:70412252-70412274 ATTATGTTTTTGTAGAGATAGGG - Intronic
1084704569 11:70808550-70808572 TTTTTTTTTTTGTAGAAATAGGG - Intronic
1084750774 11:71203311-71203333 ATTGTTTTCTTGTTGAAATAGGG - Intronic
1084851641 11:71946398-71946420 ATTTATTTATTTTTGAGATAAGG + Intronic
1085086943 11:73674656-73674678 AGTTTTTAATTGTTGAAATGAGG - Intergenic
1085173880 11:74470244-74470266 ATTTTTTTTTTCTTGAGATAGGG - Intergenic
1085175270 11:74480968-74480990 TTTTTGTTGTTGTTGAAACAGGG - Intergenic
1085234277 11:75000809-75000831 ATTTATTTATTGTAGAAATGGGG + Intronic
1085486019 11:76863216-76863238 ATATTTTTTTTGTAGAAATAGGG - Intronic
1085573262 11:77578228-77578250 AATTTGTTCCAGTTGAAATATGG + Intronic
1085620984 11:78037811-78037833 ATTTATTTATTTTTGAAACAGGG - Intronic
1085670797 11:78463230-78463252 ATTTATTTTTTGTTGAGATAGGG + Intronic
1085826677 11:79855332-79855354 ATCTTATTATTGTTCAAATATGG - Intergenic
1086257913 11:84901874-84901896 ATTTTCTTAGTGTTGAATTAAGG + Intronic
1086304506 11:85465147-85465169 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1086364368 11:86093091-86093113 ATTTTGTTTGTTTTAAAATATGG + Intergenic
1086487545 11:87324601-87324623 ATTTTTTTTTTGTAGAAACAAGG + Intergenic
1086506970 11:87515315-87515337 ATTTTGTTTTTGTTGGACCATGG + Intergenic
1086950877 11:92889096-92889118 TTGTTGTTGTTGTTAAAATAAGG + Intronic
1087249220 11:95877442-95877464 TTTTTGTTATTGTTGAATCATGG - Intronic
1087523492 11:99275943-99275965 ATTTTTTTTTTGTTCAAATATGG - Intronic
1087721175 11:101666733-101666755 ATTTTTTTTTTGTAGAGATAGGG - Intronic
1087805389 11:102549727-102549749 ATTATATTAATGTTGAAAAAAGG + Intergenic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1087928670 11:103950243-103950265 GTTTCCTTATTGTTTAAATAAGG - Intronic
1088091414 11:106044294-106044316 ATTTTGTTTCTGTAGAAATGGGG + Intergenic
1088190396 11:107222008-107222030 TTTTTGTTGTTGTTAAAACAGGG - Intergenic
1088269729 11:108021686-108021708 ATTTTGTTTTTGTAGAGATGGGG + Intronic
1088451948 11:109991302-109991324 ATTTTTTCATTGTTTAAATAAGG + Intergenic
1088473992 11:110216377-110216399 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1088619013 11:111663224-111663246 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1088684646 11:112274546-112274568 ATTTTTTTTTTTTTGAGATAAGG + Intergenic
1088785706 11:113179956-113179978 ATTTTGTTAATGTAGAAACTGGG + Intronic
1088800538 11:113302760-113302782 TTTTTTTTATTGTTTAATTATGG - Intergenic
1088981974 11:114872077-114872099 ATTTTTTTTTTTTTGAAAAAGGG - Intergenic
1089039863 11:115436832-115436854 ATTTAATTTTTGTTGAAAAAAGG + Intronic
1089249431 11:117146957-117146979 TTTTTGTTTTTTTTGAGATAGGG - Intronic
1090037301 11:123260151-123260173 ATTTTTTTATTTTTGAGACAGGG + Intergenic
1090161442 11:124499497-124499519 TTTTTGTTACTAATGAAATAGGG + Intergenic
1090683101 11:129083073-129083095 ATTTTTTTATTTTTAAATTATGG - Intronic
1090684166 11:129097103-129097125 ATTTTTTTTTTTTTGAAAAATGG - Intronic
1091273861 11:134336984-134337006 TTGTTGTTATTGTTGTTATATGG + Intronic
1091432394 12:447612-447634 ATTTTGTTGTTGTTGAGACGGGG - Intergenic
1091494148 12:957781-957803 ATTTATTTATTTTTGAGATAGGG - Intronic
1091535048 12:1398950-1398972 TTTTTTTTTTTGTTGAAACAAGG + Intronic
1092097569 12:5856173-5856195 ATTATGTTTTTGGTGAAAGATGG + Intronic
1092313500 12:7383957-7383979 ATTTTCTTTTTGCTGAAATGTGG - Intronic
1092412804 12:8267273-8267295 CTTTTGTTGTTGTCGAAACAGGG + Intergenic
1092427152 12:8384130-8384152 ATTTATTTATTTTTGAAACAGGG + Intergenic
1092447392 12:8569773-8569795 GTTTTGTTATTTTTGAGATAGGG - Intergenic
1092535450 12:9382281-9382303 TTTTTGTTGTTTTTGAAACAGGG + Intergenic
1092849573 12:12614472-12614494 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1092863013 12:12735764-12735786 ATTTATTTATTGTAGAAATGAGG - Intronic
1093045880 12:14443858-14443880 AATTGGTTATTGTTGATATAAGG - Intronic
1093193770 12:16106140-16106162 TTTTTTTTTTTTTTGAAATAGGG + Intergenic
1093322232 12:17725791-17725813 TTTTAGTGATTGTTGAAAAATGG + Intergenic
1093494016 12:19734852-19734874 ATTTTTTTTTTGTAGAAATGAGG - Intergenic
1093871136 12:24292557-24292579 ATTTTGTCTTTCTTTAAATAGGG - Intergenic
1093966863 12:25337015-25337037 ATTTTTTTTTTTTTGAAATGGGG - Intergenic
1094334814 12:29337605-29337627 ATTTTGATTGTGTTGAAAAAGGG + Exonic
1094588539 12:31799837-31799859 ATTTATTTATTTTTGAGATAGGG + Intergenic
1094686257 12:32718956-32718978 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1095212152 12:39506940-39506962 ATTTTTTTTTTTTTGAGATAAGG + Intergenic
1095264219 12:40134716-40134738 ATTTATTTATTGATGAAATTGGG + Intergenic
1095352272 12:41227656-41227678 TTGTTGTTATTGTTGAGAGAGGG - Intronic
1095426492 12:42080328-42080350 ATTTTTTTATTGTTTCAATTGGG + Intergenic
1095713353 12:45314434-45314456 ATTTTTTTTTTGTAGAGATAAGG - Intronic
1095784915 12:46099700-46099722 ATTTTTTTATTTTTTAATTATGG - Intergenic
1096118965 12:49074272-49074294 ATTTATTTATTTTTGAAACAGGG + Intergenic
1096248944 12:50014569-50014591 ATTTTTTTGTTTTTGAAACAGGG + Intronic
1096340566 12:50794910-50794932 ATTTTTTTATTTTTGAGACAGGG - Intronic
1096506189 12:52095118-52095140 ATTTTTTTTTTGTAGAAATGGGG + Intergenic
1096734481 12:53641864-53641886 ATTTATTTATTTTTGAAACAGGG - Intronic
1096783740 12:54005513-54005535 ATTGTTTTATGGTTTAAATAAGG + Intronic
1096827348 12:54289935-54289957 ATTTTTTTTTTGTAGAAACAGGG + Intergenic
1096930692 12:55205607-55205629 ATTTTGAATTTGTTGACATATGG - Intergenic
1096936432 12:55284659-55284681 ATTTTGCTATTTTTAAAACAAGG + Intergenic
1096988821 12:55781723-55781745 TTTTTGTTGTTGTTCAGATAGGG + Intronic
1097045777 12:56187077-56187099 ATTTTGTAATTTTTGAAATTTGG - Intronic
1097160665 12:57044393-57044415 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1097380899 12:58894768-58894790 ATTTTGTGATTTTTGAACAATGG - Intronic
1097417632 12:59332025-59332047 ATTTTGTTTTTATTTACATATGG + Intergenic
1097420703 12:59375352-59375374 ATTTTGTTCTTCAAGAAATAGGG - Intergenic
1097462435 12:59878592-59878614 ATTTTTTTTTTGTAGAAATGAGG + Intergenic
1097611167 12:61823177-61823199 GTTTTCTTTTTTTTGAAATAGGG + Intronic
1097689409 12:62720381-62720403 ATTTTCTTGTTTTTAAAATATGG - Intronic
1097833222 12:64247510-64247532 ATTTTTTTATTTTTAAATTATGG + Intergenic
1097858950 12:64498947-64498969 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1098001697 12:65950933-65950955 TTTTTGTTTTTTTTGAGATAGGG + Intronic
1098013975 12:66084894-66084916 ATTTTTTTATTGTAGAGATGGGG - Intergenic
1098033617 12:66280078-66280100 ATTTTTTTTTTGTTGAGATAGGG + Intergenic
1098137576 12:67418666-67418688 ATTTTTTTATTTTTGAGACAGGG - Intergenic
1098271084 12:68770825-68770847 TTTTTGTTGTTGTTGAGACAGGG - Exonic
1098392086 12:69980216-69980238 ATTTACTTATTGTACAAATAGGG - Intergenic
1098512662 12:71336353-71336375 ATTTTGTAATTGAAGAAATAAGG + Intronic
1098727506 12:73987112-73987134 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1098755841 12:74362423-74362445 TTTTTTTTATTGTTAAATTATGG + Intergenic
1098769445 12:74535358-74535380 CTTTTTTTTTTCTTGAAATATGG - Intergenic
1098871460 12:75821719-75821741 ATTTTTTTATTTTTGATACAGGG + Intergenic
1098941710 12:76544459-76544481 ATAGTGATATTATTGAAATAAGG + Intronic
1099068167 12:78010040-78010062 ATTTATTTATTGTAGAAACAGGG - Intronic
1099352412 12:81590500-81590522 ATTTATTTATTTTTGAAACAGGG + Intronic
1099674898 12:85746286-85746308 ATTTATTTATTTTTTAAATAAGG + Intergenic
1099869273 12:88326265-88326287 GTTTTTTTATTTTTGAAAAAAGG - Intergenic
1099883100 12:88492608-88492630 ATCTAGATTTTGTTGAAATATGG - Intergenic
1099901682 12:88718526-88718548 ATTCTTTTTTTTTTGAAATAGGG + Intergenic
1100007881 12:89916098-89916120 ATTTTGTCATTGATGACAAAGGG + Intergenic
1100081321 12:90855028-90855050 ATTTATTTATTTTTGAAATAGGG + Intergenic
1100197290 12:92261350-92261372 ATTCTGTTATTGTTGTTAAATGG + Intergenic
1100227108 12:92569773-92569795 CTTTTGTTATTGTTGTTATATGG + Intergenic
1100254343 12:92867191-92867213 ATTTTAGTATTGTTGAAGTATGG - Intronic
1100336026 12:93630504-93630526 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1100423635 12:94460864-94460886 ATTTTGTTGTTGTTGAAATGAGG + Intergenic
1100753013 12:97720186-97720208 TTTTTTTTTTTGTAGAAATAGGG - Intergenic
1100802668 12:98249867-98249889 ACTTTGTTATAGTAAAAATATGG - Intergenic
1101120025 12:101569690-101569712 TTGTTGTTGTTGTTGAAATGGGG + Intronic
1101214938 12:102571685-102571707 ATGTTGTTAATGTTGTAATGAGG + Intergenic
1101457096 12:104845282-104845304 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1101679688 12:106953531-106953553 ATTTTATTTTTCTTGAAACAGGG + Intergenic
1101959635 12:109239229-109239251 GTTTTATTATTGTTGAGGTATGG + Intronic
1101977330 12:109371220-109371242 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1102285048 12:111649159-111649181 ATTTTATTTTTGTTGAGACAGGG + Intronic
1102327507 12:112000531-112000553 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1102344448 12:112150419-112150441 TTTTTGTTTTTGTAGAGATAGGG + Intronic
1102368565 12:112361444-112361466 ATTTTATTTTTGTAGAGATAGGG + Intronic
1102381982 12:112474619-112474641 ATTTATTTATTTTTGAGATAGGG + Intronic
1102403374 12:112650734-112650756 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1102485879 12:113256143-113256165 ATTTTTTTTTTGTAGAGATAGGG + Intronic
1102557178 12:113734798-113734820 ATTTTGGCATCATTGAAATATGG - Intergenic
1102562203 12:113770151-113770173 ATTTTATTTTTGTAGAAATTGGG + Intergenic
1102725236 12:115058226-115058248 ATTTTGTTGTTATTGAAAACTGG + Intergenic
1102886035 12:116522685-116522707 GTTTTGTTTTTGTTGAGACAGGG + Intergenic
1103031911 12:117622190-117622212 ATTTTTTTTTTGTTTAAGTATGG + Intronic
1103053053 12:117797652-117797674 ATTTTTTTTTTTTTGACATAGGG + Intronic
1103135674 12:118505295-118505317 TTTTTGTTTTTGTAGAAATAGGG + Intergenic
1103150102 12:118630177-118630199 ATTTTTTTTTTGTAGAGATAGGG + Intergenic
1103305232 12:119958932-119958954 ATTTTATTATTATGCAAATACGG + Intergenic
1103356898 12:120328300-120328322 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1103481334 12:121251862-121251884 ATTTTGTTATTATTGATATCTGG - Intronic
1103758021 12:123225435-123225457 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1103876201 12:124129282-124129304 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1103912088 12:124357466-124357488 ATTTTGTTTTTGTAGAGATGAGG + Intronic
1104112895 12:125720432-125720454 CTTTTGTTATTGTGAAAATGCGG - Intergenic
1104127134 12:125858518-125858540 ATTTTGTTATTTTACAGATATGG + Intergenic
1104271200 12:127284040-127284062 ATTTTGTTATTCTTCAATTTGGG + Intergenic
1104546781 12:129720527-129720549 ATTTTGTGAATGTTAAGATACGG + Intronic
1104674467 12:130703338-130703360 ATTTTCTTATTAGTGAATTAGGG - Intronic
1105219711 13:18314224-18314246 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1105298558 13:19112941-19112963 ATTTTGTTCTAGCTGAAATATGG - Intergenic
1105550529 13:21391048-21391070 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1105906512 13:24816070-24816092 ATTTTTTTATTTTAGAAATGAGG + Intronic
1106010382 13:25815025-25815047 ATTTTTTTTTTTTTGAAACAAGG - Intronic
1106175557 13:27327804-27327826 ATTTATTTATTTTTGAGATAGGG - Intergenic
1106694154 13:32152898-32152920 ATTTTCTTATTATTGAAATGTGG - Intronic
1106804533 13:33292592-33292614 ATTTTTTTTTTTTTGAAATGGGG - Intronic
1107177753 13:37419597-37419619 ATTTTGTCATTTGTGAAACATGG + Intergenic
1107640808 13:42441232-42441254 TTTTTGTTTTTGTAGAGATAAGG - Intergenic
1107981393 13:45737529-45737551 ATTTTATTATTATTCAAGTATGG + Intergenic
1108300714 13:49072185-49072207 ATTTTGTATATGTTGAAATATGG + Intronic
1108509352 13:51140985-51141007 ATTTTGTCCTAGCTGAAATATGG + Intergenic
1108914102 13:55587400-55587422 ATTTTGTTATTGTATCACTAGGG + Intergenic
1109208300 13:59505900-59505922 ATTTTGTTATTTTTTTAAGACGG + Intergenic
1109493378 13:63133142-63133164 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1109752224 13:66709323-66709345 ATTTAGTTATTGTTGAGACTAGG - Intronic
1109819581 13:67635568-67635590 ATTTTATTATTGTGTAAATGGGG + Intergenic
1109985844 13:69983759-69983781 ATTTATTTATTTTTGAAATAGGG - Intronic
1110098199 13:71559227-71559249 ATATTGTTATTTTTAAAATTTGG - Intronic
1110239562 13:73252128-73252150 ATTTTGTTTCTGCTGAAATTGGG - Intergenic
1110410918 13:75203278-75203300 ATTTTGTTTTTGTAGAGATGGGG + Intergenic
1110428184 13:75392811-75392833 TTTTTGTTTTTGTAGAGATAGGG + Intronic
1110451844 13:75645504-75645526 ATTTATTTATTTTTGAGATAGGG - Intronic
1110573983 13:77035540-77035562 ATTTTATTATTTTAGAGATAGGG - Intergenic
1110641782 13:77833100-77833122 ATTTTATCATTTTTGAAAAATGG + Intergenic
1110921448 13:81091774-81091796 TTGTTGTTATTGTTGAGATAGGG + Intergenic
1111057442 13:82969872-82969894 ATTTTATTATTGTTGTATTAGGG + Intergenic
1111153203 13:84286423-84286445 ATATTGTTATTGTTAAAATTGGG + Intergenic
1111257052 13:85684159-85684181 ATTTTTTTGTTGTTGAGACAGGG - Intergenic
1111259821 13:85722805-85722827 ATTTTGTCATTATAGAAATAAGG + Intergenic
1111343833 13:86923624-86923646 ATCTGTTTTTTGTTGAAATAAGG + Intergenic
1111401089 13:87735804-87735826 ATTTAGTTATTGGTAAAATCAGG + Intergenic
1111701854 13:91699929-91699951 ATTTTGTTTTTTTTCAGATATGG + Intronic
1111708955 13:91786465-91786487 ATTTTTTTATTTTTTAAAAAGGG + Intronic
1111794869 13:92905769-92905791 TTTTTGTTGTTGTTGAAAGCTGG - Intergenic
1111817089 13:93167653-93167675 ATTTTATTATTTTTGAGACAGGG - Intergenic
1111850300 13:93565031-93565053 ATTTTGACAATGTTGAAAAAGGG - Intronic
1111864483 13:93751696-93751718 ATTTTTTTTTTGTAGAAATGCGG + Intronic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1112279834 13:98053242-98053264 ATTTTGCTTTTTTTGAGATAGGG + Intergenic
1112290362 13:98140683-98140705 ATGTTGATAATGTTGAGATAAGG + Intergenic
1112413636 13:99186488-99186510 ATTTTGTCCTAGCTGAAATATGG - Intergenic
1112609612 13:100943583-100943605 ATTTTTTTATTGTAGAGACAGGG - Intergenic
1113459831 13:110473950-110473972 ATTTTTTTTTTGTAGAAATGGGG - Intronic
1113525651 13:110972560-110972582 ATTTTTTTATTGCTGATATGGGG + Intergenic
1113829648 13:113285430-113285452 ATTTTATTATTTTTGAGACAAGG + Intergenic
1113832715 13:113309271-113309293 ATTTTGTTTTTGTAGAGATGGGG + Intronic
1114052818 14:18936175-18936197 ATTTTGTCCTCGCTGAAATATGG + Intergenic
1114109740 14:19465750-19465772 ATTTTGTCCTCGCTGAAATATGG - Intergenic
1114189835 14:20432119-20432141 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1114279805 14:21181913-21181935 ATTTTTTTATTTTTTAATTATGG + Intergenic
1114335563 14:21685928-21685950 ATTTTTTTTTTGTAGAGATAAGG + Intergenic
1114451244 14:22827208-22827230 ATTTTGTCATAGCTGAAATATGG - Intronic
1114505256 14:23207091-23207113 ATTTTGTCCTAGCTGAAATATGG - Intronic
1114891004 14:26923048-26923070 ATTTTGATATTGCTGATAGAGGG + Intergenic
1114899511 14:27039213-27039235 ATTTTCTTATTGGGGAAATTTGG + Intergenic
1114953493 14:27787601-27787623 AAATTGCTGTTGTTGAAATAAGG - Intergenic
1115173969 14:30541110-30541132 TTTTAGTTACAGTTGAAATAAGG + Intergenic
1115206151 14:30907598-30907620 CTTTTTTTCTTTTTGAAATAGGG + Intronic
1115247511 14:31311255-31311277 ATTTTGTGTGTGTGGAAATAGGG - Intronic
1115296804 14:31837322-31837344 TTTTTGTTTTTTTTGAAACAGGG - Intronic
1115350231 14:32386271-32386293 ATTTTTTTATTTTTAAATTATGG + Intronic
1115372010 14:32626949-32626971 ACTTTGTTAATCTTGAAATTGGG + Intronic
1115464807 14:33703312-33703334 ATTTTTTTTTTGTAGAAATGGGG - Intronic
1115683446 14:35767777-35767799 TTTTTTTTATTGTTGAGACAGGG + Intronic
1115699726 14:35940107-35940129 ATTTTGACATTGTAGAAATGTGG - Intergenic
1115799188 14:36973048-36973070 ATTTTATTTTAGTAGAAATAGGG + Intronic
1115821634 14:37218916-37218938 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1115831003 14:37341088-37341110 ATTTTGTTGTTGTGCAAACATGG - Intronic
1116238825 14:42314559-42314581 ATTTTGTCATGGTTTAAATCAGG + Intergenic
1116263044 14:42655228-42655250 ATTTTGTCCTAGCTGAAATATGG + Intergenic
1116589897 14:46759242-46759264 ATTTTGCTATTTTTAAAATTGGG - Intergenic
1116635806 14:47393763-47393785 ATTTTCTTACTATTGAAAGATGG - Intronic
1116641431 14:47468662-47468684 GTTTTTTTTTTGTTTAAATAAGG + Intronic
1116875901 14:50111703-50111725 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1116887587 14:50236050-50236072 CTTTTGTTGTTGTTGAGATGGGG + Intergenic
1116995278 14:51317260-51317282 AGTTTCTTATAGTTCAAATATGG + Intergenic
1117177190 14:53156771-53156793 ATTTTATTATTTTAGAGATAGGG + Intergenic
1117344783 14:54821417-54821439 ATTTACTTATTTTTGAGATAGGG + Intergenic
1117506088 14:56404530-56404552 ATTTTTTTATTTTTAAATTATGG + Intergenic
1117559016 14:56917026-56917048 AATTTCTTTTTGTAGAAATAGGG + Intergenic
1117613256 14:57505630-57505652 ATTTTCTTATTGTTAAAATGCGG - Intergenic
1117671917 14:58116667-58116689 ATTTGTTTATTGTTGAGACAAGG - Intronic
1117809711 14:59533618-59533640 ATTATGATATTTTTGAATTATGG - Intronic
1117919761 14:60717076-60717098 ATTTATTTATTTTTGAGATAAGG + Intronic
1118073510 14:62271874-62271896 ATTTTGTTTTGTTTGAGATAGGG - Intergenic
1118101533 14:62610339-62610361 ATTTTTTTATTTTTAAATTATGG - Intergenic
1118203614 14:63700985-63701007 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1118238006 14:64028425-64028447 TTTTTATTTTTGTAGAAATAAGG + Intronic
1118431393 14:65722301-65722323 TTGTTGTTATTTTTGAGATAGGG + Intronic
1118671662 14:68134779-68134801 ATTTTTTTAATGTTGAATTTTGG + Intronic
1118701973 14:68442272-68442294 GTTTTCTTATTTATGAAATATGG + Intronic
1118750246 14:68802188-68802210 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1118756887 14:68851395-68851417 ATTTTGTTATCTCTGAAATCTGG + Intergenic
1118835717 14:69476388-69476410 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1118924571 14:70180269-70180291 ATTTTTTAAATGTTGAAATATGG + Intronic
1118943586 14:70361400-70361422 ATTTATTTATTTTTGAAACAGGG - Intronic
1119078218 14:71666048-71666070 ATTCTGTAGTTGTTGAAAAATGG - Intronic
1119102501 14:71893253-71893275 ATTTTGTCACTGATGAAATGAGG + Intergenic
1119256102 14:73198780-73198802 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1119332953 14:73809049-73809071 ATTTTTTTATTCCTTAAATATGG - Intergenic
1119467885 14:74873663-74873685 ATTTTGTTTTTTTAAAAATATGG - Intergenic
1119677763 14:76568812-76568834 TTTTTGTTGTTGTTGAGATAGGG - Intergenic
1119810579 14:77514618-77514640 ATTTTGTTATTTTTTAAAATGGG - Intronic
1120098421 14:80416067-80416089 TTGTTGTTATTGTTGTAATAAGG + Intergenic
1120506562 14:85359964-85359986 ATCTTATTAGTGTTGAAATGGGG - Intergenic
1120689698 14:87578791-87578813 TTTTTGTTGTTGTTGCTATAGGG - Intergenic
1120811223 14:88805590-88805612 CTTTTGTAATTTTTAAAATATGG - Intergenic
1121102007 14:91255819-91255841 ATTTATTTATTTTTGAAACAGGG + Intergenic
1121134095 14:91479372-91479394 ATTTTTTTGTTGTTGAGATAGGG + Intronic
1121258212 14:92547399-92547421 ATTTTATTATTATTGAGACAGGG + Intronic
1121297141 14:92837568-92837590 TTTTTGTTTTTTTTGAAACAGGG + Intronic
1121345098 14:93129770-93129792 ATTTATTTATTTTTGAGATAGGG + Intergenic
1121356814 14:93222734-93222756 ATTTTTTTTTTTTTGAAATAGGG - Intronic
1121364970 14:93300786-93300808 ATTTTTTTTTTGTAGAGATAGGG + Intronic
1121758182 14:96420684-96420706 ATTTTTTTATTTTTGAGACAGGG - Intronic
1122137120 14:99640289-99640311 ATTTATTTATTTTTGAGATAGGG + Intergenic
1122165595 14:99821189-99821211 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1122166586 14:99829443-99829465 ATTTTGTTATTTTTAAATTGTGG + Intronic
1122225040 14:100270861-100270883 ATTTTGTTTTTGTAGAGATGTGG - Intronic
1122574777 14:102734997-102735019 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1122708747 14:103639762-103639784 ATTTTATTATTTTTGAGACAGGG + Intronic
1122752024 14:103943521-103943543 TTTTTTTTTTTGTAGAAATAAGG + Intronic
1122869598 14:104631509-104631531 TTTTTGGTATTTTTGAAATGTGG + Intergenic
1122946103 14:105010662-105010684 ATTTTTTTAAGGTTTAAATAAGG - Exonic
1202830419 14_GL000009v2_random:22353-22375 AATTTGTTTTTATTCAAATATGG - Intergenic
1123465504 15:20511830-20511852 ATTTTGTAATTCCTGAAAGAAGG + Intergenic
1123485464 15:20732000-20732022 ATAGTTTTATTGTTGAAATCAGG + Intergenic
1123541950 15:21301048-21301070 ATAGTTTTATTGTTGAAATCAGG + Intergenic
1123652612 15:22489207-22489229 ATTTTGTAATTCCTGAAAGAAGG - Intergenic
1123743036 15:23298066-23298088 ATTTTGTAATTCCTGAAAGAAGG - Intergenic
1123928056 15:25138204-25138226 GTTTTCTCATTTTTGAAATAGGG - Intergenic
1123963252 15:25429512-25429534 ATTTTGTTTTTAGTGAAGTAGGG - Intronic
1124043602 15:26127295-26127317 TTTTTTTTTTTTTTGAAATAAGG + Intergenic
1124276225 15:28327809-28327831 ATTTTGTAATTCCTGAAAGAAGG + Intergenic
1124306473 15:28583798-28583820 ATTTTGTAATTCCTGAAAGAAGG - Intergenic
1124603958 15:31156930-31156952 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1124809679 15:32922987-32923009 TTTTTGTTGTTGTTGTAAGAAGG + Intronic
1124863210 15:33463155-33463177 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1124921320 15:34029506-34029528 TTTTTTTTTTTGTAGAAATAGGG - Intronic
1124969316 15:34469452-34469474 GTTTTGTTTTTGTAGAAACAGGG - Intergenic
1125168511 15:36739217-36739239 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1125186255 15:36933971-36933993 ATTTTATTAATGTTGAAAAGAGG - Intronic
1125467852 15:39972341-39972363 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1125554866 15:40575930-40575952 ATTTATTTATTGTAGAGATAAGG - Intergenic
1125668705 15:41453712-41453734 TTTTTGTTGTTGTTGAGAAAGGG - Intronic
1125669872 15:41463482-41463504 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1125791873 15:42373184-42373206 ATTTATTTATTTTTGAGATAGGG - Intronic
1126014743 15:44339822-44339844 ATTTTTTTATTTTTGTGATATGG + Intronic
1126234815 15:46371266-46371288 TTTTTGTTTTTTTTGAAATAGGG - Intergenic
1126280054 15:46937048-46937070 ATTTTGTCATTTTTAAAATCTGG - Intergenic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1126529124 15:49692170-49692192 ATTTTGTCATTTGGGAAATATGG - Intergenic
1126821858 15:52512211-52512233 ATATTGTTATAGTAGAAAAATGG + Intronic
1126866410 15:52941960-52941982 ATTTTCTTATTGTTCAATTATGG + Intergenic
1127392732 15:58520246-58520268 ATTTTGTTTGGGTTGAAACAAGG + Intronic
1127421705 15:58812685-58812707 TTTTTATTTTTGTAGAAATAAGG - Intronic
1127707742 15:61563794-61563816 CTTTTGATAATTTTGAAATAAGG - Intergenic
1127846012 15:62871643-62871665 ACTTTGTTATAGCAGAAATAGGG + Intergenic
1127856645 15:62959064-62959086 TTTTTGTTGTTGTTGAGATGGGG + Intergenic
1128027145 15:64447716-64447738 ATTTATTTATTTTTGAGATAGGG + Intronic
1128481337 15:68042268-68042290 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1128611666 15:69078775-69078797 TTTTTGTTGTTGTTGAGACAAGG + Intergenic
1128697343 15:69778075-69778097 ATTTTGTCATTGTTGAAAATTGG + Intergenic
1128770356 15:70277286-70277308 ACTTTGTGATTGTTGGAAAAAGG + Intergenic
1128924276 15:71640251-71640273 TTTTTTTTTTTGTAGAAATAGGG + Intronic
1128934529 15:71733979-71734001 TTGTTGTTATTGCTGAAATGGGG + Intronic
1128986019 15:72222118-72222140 AATTTGAGATAGTTGAAATAGGG - Intronic
1129012971 15:72439735-72439757 ATTTTTTTTTTGTTGAAAACTGG + Intergenic
1129513384 15:76141028-76141050 GTTTTGTTGTTGTTGAGACAGGG - Intronic
1129533238 15:76287338-76287360 ATTTATTTATTTTTGAGATAGGG + Intronic
1129651515 15:77494134-77494156 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1129767071 15:78176919-78176941 ATTTATTTATTTTTGAAACAGGG - Intronic
1129809398 15:78495670-78495692 TTTTTGTTATAGCAGAAATAAGG - Intronic
1129820375 15:78597422-78597444 ATTTTGTTGTTTTTGAGACAGGG - Intronic
1130271497 15:82452441-82452463 TTTTTGTAATTTTTAAAATATGG + Intergenic
1130289743 15:82588118-82588140 ATTTTTTTTTTGTAGAAACAGGG + Intronic
1130463838 15:84179781-84179803 TTTTTGTAATTTTTAAAATATGG + Intronic
1130488837 15:84415006-84415028 TTTTTGTAATTTTTAAAATATGG - Intergenic
1130500428 15:84493760-84493782 TTTTTGTAATTTTTAAAATATGG - Intergenic
1130782768 15:87060829-87060851 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1130929971 15:88418045-88418067 ATTTTGTGATTTTTGAAGTTGGG - Intergenic
1131041169 15:89268101-89268123 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1131142674 15:89990318-89990340 TTTTTGTTGTTGTTGAGATGGGG + Intergenic
1131236653 15:90702763-90702785 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
1131243549 15:90770129-90770151 ATTTTGTTACTGAAGAATTATGG - Intronic
1131615433 15:94012521-94012543 ATTTTGTTATTTTTGCTATTAGG + Intergenic
1131674795 15:94660956-94660978 ATCTTTTTATTTTAGAAATAAGG + Intergenic
1131901165 15:97089208-97089230 TTTTTTTTTTTTTTGAAATAAGG + Intergenic
1131951033 15:97682392-97682414 TTTTTTTTTTTGTAGAAATATGG + Intergenic
1132049441 15:98594922-98594944 GTTTTGTTGTTGTTTAAGTAAGG + Intergenic
1132189975 15:99845975-99845997 GTTTTGTTTTTGTAGAAAAAGGG + Intergenic
1202950269 15_KI270727v1_random:28190-28212 ATAGTTTTATTGTTGAAATCAGG + Intergenic
1133354006 16:5122771-5122793 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1133740286 16:8646233-8646255 ATTTTGTCATTTTAAAAATATGG + Exonic
1133751457 16:8729295-8729317 TTTTTGTTTTTGTTGAGACAGGG - Intronic
1133829205 16:9306134-9306156 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1133890292 16:9872855-9872877 GTTTTGTTTTTGTAGAGATAGGG - Intronic
1134420762 16:14086313-14086335 ACTTTGTTTCTGTTGGAATATGG + Intronic
1134440247 16:14295374-14295396 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1134491238 16:14696978-14697000 TTTTTGTTGTTTTTGAAACAGGG - Intergenic
1134496619 16:14736096-14736118 TTTTTGTTGTTTTTGAAACAGGG - Intronic
1134536478 16:15030588-15030610 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1135429203 16:22368075-22368097 ATTTTTTTATTTTTGAGACAGGG - Intronic
1135614568 16:23899857-23899879 ATTTATTTATTGTAGAGATAGGG + Intronic
1135701320 16:24634964-24634986 GTTTTGTTGTTGTTGAGACAGGG + Intergenic
1135778129 16:25275133-25275155 TTTTTGTTGTTGTTGAGATGAGG + Intergenic
1135808690 16:25567936-25567958 ATTTTTTTTTTCTTGAGATAAGG - Intergenic
1135881412 16:26261209-26261231 CTTTTTTTATTTTTGAAACAGGG - Intergenic
1135908202 16:26533442-26533464 TTTTTTTTATTGTTGAAAACTGG - Intergenic
1136042937 16:27594623-27594645 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1136181642 16:28556818-28556840 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1136372844 16:29847011-29847033 ATTTTGTTTTTGTAGAGATGAGG - Intronic
1136943767 16:34619985-34620007 ATTTTGGTAGTTTTGAAACACGG - Intergenic
1137285497 16:47012886-47012908 TTATTGTTATTGTTGAGACAGGG + Intergenic
1137289810 16:47044349-47044371 ATTTTTTTTTTGTAGAAACAGGG - Intergenic
1137393452 16:48100334-48100356 ATTTTCTTCTTTTTAAAATATGG - Intronic
1137665647 16:50247366-50247388 ATTTTTTTTTTCTTGAAACAGGG + Intronic
1137970987 16:52984675-52984697 ATTTTTTTTTTTTTGAGATAGGG - Intergenic
1138109091 16:54309016-54309038 ATTTTATTGTTTTTGAAACAGGG + Intergenic
1138417261 16:56878556-56878578 ATTTTCTCCTTGGTGAAATAGGG - Intronic
1138610340 16:58118482-58118504 GTTTTGTTTTTTTTGAGATAGGG - Intronic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1138716322 16:59027321-59027343 CTTGTGTTATTGCTGAAACATGG - Intergenic
1138791259 16:59906699-59906721 ATTTTGTTTTTTTAGAAATGAGG + Intergenic
1138819812 16:60245632-60245654 ATTTTTTTTTTTTTGAAACAAGG + Intergenic
1138825280 16:60311882-60311904 AATTTATTATTGTTGATATGAGG + Intergenic
1139062276 16:63266853-63266875 ATTGTTTTATTGTGGAAATCAGG - Intergenic
1139145976 16:64326134-64326156 ATTTTATTATTGTAGAGATGGGG - Intergenic
1139624298 16:68173082-68173104 ATTTTATTTTTGTAGAGATAGGG - Intronic
1139859590 16:70010199-70010221 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1140079078 16:71727417-71727439 ATTTTGATATTTTTCAAATATGG + Intergenic
1140157486 16:72447065-72447087 TTTTTTTTTTTTTTGAAATAAGG + Intergenic
1140352144 16:74272416-74272438 TTGTTGTTATTGTTGAGACAGGG - Intergenic
1140423196 16:74837703-74837725 ATGTTGTTATTTTTGAGACAGGG - Intergenic
1140451177 16:75071953-75071975 TTTTTATTATTTTTGAGATAAGG + Intronic
1140463895 16:75163616-75163638 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1140705571 16:77625643-77625665 ATTTTTTTTTTTTTGAAATGGGG - Intergenic
1141451026 16:84102307-84102329 ATTTTATTATTTTAGACATAGGG - Intronic
1141518783 16:84563853-84563875 ATTTTGTTAGTTTTGAGACAGGG - Intergenic
1141556742 16:84841513-84841535 GTTTTGGTATTGCTGAAATGGGG + Intronic
1142447540 16:90151135-90151157 ATTTCTTTCTTTTTGAAATAAGG - Intergenic
1142677696 17:1524565-1524587 ATTTTATTATTATAGAAATTGGG - Intronic
1142775256 17:2132797-2132819 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1143943614 17:10569333-10569355 GTCTTGATATTGATGAAATATGG + Intergenic
1143944220 17:10575606-10575628 TTTTTTTTTTTGTAGAAATAGGG - Intergenic
1143959829 17:10707365-10707387 ATTTATTTATTTTTGAGATAGGG - Intronic
1143972925 17:10808641-10808663 ATTTTGTTAATTTTTAAAAATGG + Intergenic
1143992876 17:10981574-10981596 ATTTTTTGATTGTTCAAAAAAGG - Intergenic
1144173816 17:12685291-12685313 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1144401969 17:14913522-14913544 AATTTGTTTTTGTTGAAAAATGG - Intergenic
1144418611 17:15074908-15074930 TTTTTATTATTTTTGAAATACGG - Intergenic
1144470109 17:15531824-15531846 CTTTTGTTGTTGTTGAAAACTGG + Intronic
1144472321 17:15555922-15555944 TTTTTGTTGTTGTTGAAATGGGG + Intronic
1144556002 17:16283459-16283481 ATCTTTTTTTTTTTGAAATAGGG - Intronic
1144926234 17:18811828-18811850 CTTTTGTTGTTGTTGAAAACTGG - Intergenic
1145017496 17:19408756-19408778 TTGTTGTTGTTGTTGAGATAGGG - Intergenic
1145113001 17:20181587-20181609 GTTTTGGTATTGATGCAATAAGG + Intronic
1145765191 17:27454202-27454224 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
1145874461 17:28306701-28306723 GTTTTGTTTTGTTTGAAATAGGG - Intergenic
1145948045 17:28792772-28792794 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1146018673 17:29254857-29254879 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1146102933 17:30003403-30003425 ATTTTATTTTTGTAGAAACAGGG + Intronic
1146123360 17:30213751-30213773 ATTTATTTATTTTTGAGATAGGG + Intronic
1146205238 17:30898694-30898716 ATTATCATATTGTTAAAATAGGG - Intronic
1146382688 17:32342529-32342551 ATTTTGTTAAAGTGAAAATATGG + Intronic
1146734261 17:35224030-35224052 ATTTTTTTTTTGTAGAAATGGGG + Intergenic
1146774345 17:35599131-35599153 ATATTGTGTTTGATGAAATAGGG + Intronic
1146804751 17:35856242-35856264 AGTATGTTATAGTTGAATTAAGG + Intronic
1146851278 17:36223775-36223797 ATTTATTTATTGTAGAGATAGGG - Intronic
1146867191 17:36347642-36347664 ATTTATTTATTGTAGAGATAAGG - Intronic
1147030975 17:37636139-37636161 ATTTTGTTGTTGTTGTGCTAAGG + Intronic
1147060814 17:37876514-37876536 ATTTTTTTTTTCTTGAGATAGGG - Intergenic
1147070064 17:37948251-37948273 ATTTATTTATTGTAGAGATAGGG - Intergenic
1147081585 17:38027771-38027793 ATTTATTTATTGTAGAGATAGGG - Intronic
1147097536 17:38151746-38151768 ATTTATTTATTGTAGAGATAGGG - Intergenic
1147097564 17:38151913-38151935 ATTTTTTTTTTTTTGAGATAAGG - Intergenic
1147344522 17:39780367-39780389 ATTTACTTATTTTTGAAACAGGG + Intronic
1147585802 17:41653472-41653494 TTTTTGTTATTTTTGAGATAGGG - Intergenic
1147683734 17:42274800-42274822 ATTTTGTTATCTTTCAATTAAGG - Intronic
1147775178 17:42895836-42895858 TTTTTTTTTTTTTTGAAATAGGG + Intergenic
1148009874 17:44469597-44469619 ATTTTGTCACTGTTGAAAATGGG - Intronic
1148168015 17:45497219-45497241 ATTTTGTTTTTTTTGAGACAGGG - Intergenic
1148280802 17:46345738-46345760 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148303030 17:46563673-46563695 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1148309242 17:46621291-46621313 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1148410159 17:47459302-47459324 ATTTTTTTTTTCTTGAGATAGGG - Intergenic
1148488754 17:48009507-48009529 ATTTATTTATTTTTGAAACAGGG + Intergenic
1148531052 17:48392547-48392569 ATATTTTTATTATTGAGATATGG - Intronic
1148661904 17:49340890-49340912 ATTTTGTTGTTGTGGAGACAGGG - Intronic
1148790673 17:50170885-50170907 ATTTTTTTTTTGTTGAGATGGGG - Intronic
1148871256 17:50659977-50659999 TTTTTGTTGTTGTTGAGAAAAGG - Intronic
1149775484 17:59353711-59353733 AATTTGTTATTTTGGAAATGAGG + Intronic
1149790694 17:59474471-59474493 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1149881741 17:60298948-60298970 ATTTTGTTTTTGTAGAGATAGGG - Intronic
1149898505 17:60450601-60450623 TTTTTTTTATTGTTTCAATAGGG - Intronic
1149970610 17:61214358-61214380 ATTTATTTATTTTTGAGATAGGG - Intronic
1150019298 17:61594590-61594612 ATTTTGTTTTTGTAGAGATGGGG + Intergenic
1150021416 17:61617932-61617954 ATTTTATGATTGATGAAATTTGG + Intergenic
1150079243 17:62221869-62221891 ATTTATTTATTGTAGAGATAGGG - Intergenic
1150090609 17:62321629-62321651 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1150180734 17:63118133-63118155 ATATTGTTATTTTTTAAAAAAGG - Intronic
1150257018 17:63755137-63755159 ATTTTTTTATTGTAGAGACAGGG + Intronic
1150360950 17:64533598-64533620 GTTTTGTTGTTGTTGAGACAGGG - Intronic
1150413253 17:64964721-64964743 ATTTATTTATTTATGAAATAGGG - Intergenic
1150724299 17:67638936-67638958 ATTTTTTTTTTGTAGAAATAGGG - Intronic
1150798562 17:68260492-68260514 ATTTATTTATTTTTGAAATAGGG + Intronic
1150883174 17:69054347-69054369 ATTTTGTTTTTGTAGAGACAGGG - Intronic
1150916118 17:69438755-69438777 ATTTTATTTTTGTAGAAATGGGG + Intronic
1151285967 17:73111446-73111468 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1151299486 17:73212416-73212438 ATTTTTTTATTCTAGAAAGAGGG - Intronic
1151408624 17:73905914-73905936 ATTTATTTATTTTTGAGATAGGG - Intergenic
1151493896 17:74448134-74448156 ATTTTTTTTTTGTAGAAACAAGG - Intronic
1151618547 17:75230936-75230958 ATTTTTTTTTTTTTGAGATATGG + Intronic
1151648394 17:75449804-75449826 ATTTTTTTTTTGTAGAGATAGGG - Intronic
1151738929 17:75965826-75965848 ATATTTTTATTTTTGAAAGACGG - Intronic
1151744476 17:76004522-76004544 ATTTTATTTTTGTAGAAATGGGG + Intronic
1151777697 17:76218466-76218488 ATTTTTTTATTGTAGAGATGAGG - Intronic
1151918267 17:77134764-77134786 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1152116782 17:78392928-78392950 ATTTTGTTATTTTTGAGAAGGGG + Intronic
1152390009 17:79998332-79998354 TTTTTGTTTTTTTTGAGATAGGG + Intronic
1152520748 17:80854884-80854906 ATTTATTTATTTTTGAGATAGGG - Intronic
1152667996 17:81582573-81582595 TTTTTGTTGTTGTAGAAATGAGG + Intronic
1153120976 18:1726469-1726491 ATTTTTATATTTGTGAAATATGG + Intergenic
1153133720 18:1888099-1888121 ATTTTGTTGATGTTGAAAGCTGG - Intergenic
1153171268 18:2318792-2318814 GTTTTGTTGTTGTTGAGATGGGG - Intergenic
1153182644 18:2452965-2452987 ATTTTTTTTTTGTAGAAATGAGG + Intergenic
1153469392 18:5427007-5427029 TTTTTGTTATTTTTGAGACAGGG + Intronic
1153484826 18:5586404-5586426 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1153538605 18:6130957-6130979 TTTTAGTTTTTGTTAAAATAGGG - Intronic
1153539924 18:6142742-6142764 ATTATTTTTTTGTAGAAATAAGG - Intronic
1153657841 18:7301208-7301230 ATTTTGTTGTTGTTGAAAACTGG + Intergenic
1153884484 18:9451211-9451233 TTTTTGTTGTTGTTGAGATGGGG - Intergenic
1153969501 18:10212745-10212767 GTTTTGTTTTTGTAGAGATAGGG - Intergenic
1154165282 18:12010134-12010156 ATCTTGATATTTTTAAAATAAGG + Intronic
1154195864 18:12266222-12266244 TTTTTGTTTTTTTTGATATAGGG - Intronic
1154281823 18:13010134-13010156 ATTTATTTATTTTTGAGATAGGG - Intronic
1155037635 18:22038610-22038632 TTTTTTTTTTTTTTGAAATATGG - Intergenic
1155225768 18:23727904-23727926 ATTTTATTTTTGTAGAGATAGGG + Intronic
1155304568 18:24466293-24466315 TTTTTTTTTTTGTAGAAATAGGG + Intronic
1155556649 18:27027270-27027292 TTGTTGTTAAAGTTGAAATAGGG + Intronic
1155598740 18:27518235-27518257 GTTTTATTATTGTTAAAATATGG + Intergenic
1155606077 18:27607157-27607179 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1155867284 18:30981612-30981634 ATTTTGTTGTTGTTGCAAATTGG - Intergenic
1155972726 18:32096736-32096758 TTTTTGTTTTTTTTGAAATAGGG + Intronic
1156030830 18:32710286-32710308 AGTTTGCAATTGTTGAAGTATGG + Intronic
1156032404 18:32727579-32727601 CTTTCATTATTGTTGAAGTAAGG + Intronic
1156093791 18:33504673-33504695 ATTGTATTATTGTGCAAATAGGG - Intergenic
1156115200 18:33779107-33779129 TTTTTGTTATTGTTGTTAGATGG - Intergenic
1156222227 18:35064189-35064211 ATTTTTTTTTTTTTGAAATGAGG - Intronic
1156236935 18:35214857-35214879 ATTTTGTTGTTGTCGAAAACTGG + Intergenic
1156266228 18:35490760-35490782 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1156437141 18:37144541-37144563 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1156814243 18:41290041-41290063 ATTTATTTATTTTTGAAACAGGG - Intergenic
1156858337 18:41808920-41808942 ATTTTTTTATTTTTGAGACAGGG + Intergenic
1156864973 18:41878596-41878618 ATTTATTTATTTTTGAGATAGGG - Intergenic
1156895759 18:42243740-42243762 ATTTTCTTATTTTACAAATAAGG + Intergenic
1156939693 18:42752425-42752447 ATTTTCTTATTTTTCAAATGAGG + Intronic
1157025236 18:43835162-43835184 TTTTTCTTTTTGTTGAAATGAGG + Intergenic
1157033891 18:43947629-43947651 ATTTTTTTATAGTAGAATTATGG - Intergenic
1157313722 18:46571461-46571483 ATTTGTTTATTTTTGAAACAGGG - Intronic
1157907448 18:51582301-51582323 ATATTTTTATTTTTGAAACAGGG + Intergenic
1157961296 18:52156361-52156383 ATTTCCTTATTGGTAAAATAAGG - Intergenic
1158121377 18:54051988-54052010 ATTTTGTTTTTGTAGATACAGGG + Intergenic
1158675813 18:59517165-59517187 ATTTTCTCATTTTTGAAAAATGG + Intronic
1158864775 18:61627761-61627783 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1158908687 18:62038756-62038778 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1158968440 18:62644023-62644045 ATTTTGTTTTTTTTGAGATGGGG - Intergenic
1159086105 18:63793671-63793693 ATTTTTTTGTTGTTGAGAAAGGG + Intronic
1159209670 18:65301215-65301237 ATATTGTTTTTGTAGAGATACGG - Intergenic
1159421242 18:68223014-68223036 ATTATGGTATTATTAAAATATGG - Intergenic
1159422534 18:68241875-68241897 ATTTTATTATTTTTGATATTTGG - Intergenic
1159727107 18:71975121-71975143 ATTTAATTATTAGTGAAATATGG - Intergenic
1159737091 18:72113470-72113492 ATTTTGTTGTTTTTGAGACAGGG - Intergenic
1159808644 18:72988493-72988515 ATATTGTCATTTTAGAAATATGG + Intergenic
1159932608 18:74329365-74329387 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1159985108 18:74832459-74832481 TTTTTGTTTTTTTTGAGATAGGG + Intronic
1160064664 18:75563684-75563706 ATTTATTTATTTTTGAAATGGGG + Intergenic
1160498788 18:79392136-79392158 TTTTTGTTGTTGTTGAGATGAGG - Intergenic
1160842645 19:1153145-1153167 GTTTTGTTATTTTTAAAACACGG - Intronic
1160924312 19:1535867-1535889 CTTTTGTTGTTGTTGAGACAGGG - Intergenic
1161092793 19:2370953-2370975 ATTTTTTTCTTTTTGAGATAGGG - Intergenic
1161274209 19:3406398-3406420 TTTTTTTTTTTGTAGAAATAGGG + Intronic
1161418659 19:4162968-4162990 CTATTATTATTTTTGAAATAGGG - Intronic
1161490999 19:4561452-4561474 ATTTTATTTTTTTTGAGATAGGG - Intergenic
1161526409 19:4758802-4758824 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1161533659 19:4805308-4805330 ATTTATTTATTTTTGAAACAAGG - Intergenic
1161646875 19:5458509-5458531 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
1161662754 19:5557336-5557358 ATTTTATTTTTGTTGAGACAGGG - Intergenic
1161893699 19:7063921-7063943 ATTTTGTTGTTGTTGAGAAGGGG + Intergenic
1161999448 19:7733973-7733995 ATTTATTTATTGTTGAGACAGGG - Intergenic
1162010210 19:7808689-7808711 TTTTTGTTTTTGTTGAGAGAGGG - Intergenic
1162066666 19:8129902-8129924 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1162493157 19:11007078-11007100 TTTTTGTTATTGTTGAGATGGGG - Intronic
1162530719 19:11234947-11234969 ATTTTTTTTTTTTTGAAACAGGG + Intronic
1162553587 19:11372661-11372683 TGTTTGTTTTTGTTGAGATAGGG + Intergenic
1162580180 19:11524815-11524837 ATTTTTTTATTTTTGAGATAGGG - Intronic
1162590161 19:11586240-11586262 ATTTATTTATTTATGAAATAGGG - Intronic
1162593612 19:11610017-11610039 ATTTTGTTTTTGTTGAAAAGTGG + Intronic
1162648515 19:12067305-12067327 ATTTTCTTATTTTTGAGACAGGG - Intronic
1162819475 19:13213855-13213877 ATTTTTTTTTTGTAGAGATATGG + Intronic
1162875557 19:13618544-13618566 TTGTTGTTGTTGTTGAGATAGGG - Intronic
1162903834 19:13811521-13811543 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1162919780 19:13893908-13893930 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1162943601 19:14028948-14028970 ATTTTTTTTTTGTAGAAACAGGG + Intronic
1163070021 19:14831913-14831935 ATTTATTCATTGTTGAGATAGGG + Intronic
1163100752 19:15094811-15094833 CTTTTGTTGTTGCTGAATTAAGG - Intergenic
1163147715 19:15392488-15392510 TTTTTTTTATTCTTGAAATAGGG - Intronic
1163161337 19:15466134-15466156 TTTTTGTTGTTGTTGAGATGAGG + Intergenic
1163172665 19:15543362-15543384 ATTTTTTTTTTGTAGAAATGGGG + Intronic
1163280029 19:16310346-16310368 ATTTTTTTTTTTTTTAAATAGGG + Intergenic
1163343195 19:16723203-16723225 TTTTTGCTGTTGTTGAGATAGGG + Intronic
1163780845 19:19247087-19247109 ATTTATTTATTTTTGAAACAGGG + Intronic
1164019190 19:21282389-21282411 ATTTTGTTATTCTTGAGTTATGG + Intronic
1164188608 19:22895081-22895103 ATTTATTTATTGTAGAAATGAGG + Intergenic
1164427886 19:28158818-28158840 ATTTATTTATTTTTGAGATAGGG + Intergenic
1164948960 19:32320062-32320084 ATTTTGTTTTTGTGGAGACAGGG + Intergenic
1165052421 19:33150440-33150462 ATTTTTTTATTTTTGAGACAGGG - Intronic
1165557310 19:36645219-36645241 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1165676157 19:37725697-37725719 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1165695787 19:37899917-37899939 TTTTGGTTATTGTTGAAGCAAGG - Intronic
1165755851 19:38292480-38292502 ATTTTGGTAGGGTTGAAATTAGG - Exonic
1165889527 19:39102312-39102334 TTTTTGTTGTTGTTTAGATATGG - Intronic
1165988212 19:39789156-39789178 ATTTTGTTATTTTTTGATTATGG - Intergenic
1166006372 19:39910173-39910195 ATTTATTTATTTTTGAGATAAGG - Intronic
1166023031 19:40050329-40050351 ATTTTGTAATTCTAGAAACATGG - Exonic
1166105409 19:40595725-40595747 ATTTATTTATTATTGAGATAGGG + Intronic
1166285060 19:41820594-41820616 ATTTTTTTGTTTTTGAGATAGGG - Intergenic
1166697738 19:44863296-44863318 TTTTTGTTTTTGTAGAGATAGGG - Intronic
1167030655 19:46957603-46957625 ATTTATTTATTTTTGAGATAGGG - Intronic
1167143707 19:47669958-47669980 ATTTTTTTATTTTTGAGACAGGG + Intronic
1167400817 19:49267471-49267493 TTTTTGTTATTATTGAAAACAGG + Intergenic
1167533701 19:50035282-50035304 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1167771488 19:51522782-51522804 TTTTTGTTATTGTTGAGAGAGGG - Intronic
1167988118 19:53335435-53335457 ATTTTTTTTTTGTAGAAATGGGG + Intronic
1168560579 19:57379362-57379384 ATTTTGTTGTTGCTGATGTAGGG + Exonic
1168646868 19:58064881-58064903 ACTTTGTTTTTTTTGAAACATGG - Intronic
1168662862 19:58181820-58181842 AATTTTTTAAAGTTGAAATATGG + Intergenic
1202642273 1_KI270706v1_random:105420-105442 AATTTGTTTTTATTCAAATATGG + Intergenic
925403842 2:3592553-3592575 ATTTTATTATTTTTGAAACAGGG + Intergenic
925496662 2:4457824-4457846 ATTTTCTTATTGTCAAAATAAGG + Intergenic
925732550 2:6930360-6930382 ATTTTTTTATTTTTCAATTATGG + Intronic
925739329 2:6992085-6992107 GTTTTGGTATTGTTGAAGAACGG + Intronic
926287628 2:11502392-11502414 TTTTTTTTTTTGTAGAAATAGGG + Intergenic
926554862 2:14345126-14345148 ATTGTTTTCTTGTTGAAACAGGG - Intergenic
926637653 2:15200069-15200091 ATTTTTTTATTGTAGAGATGGGG + Intronic
926782482 2:16486474-16486496 ATTTTGTTTGTGTTGTAAAAGGG - Intergenic
926820304 2:16844602-16844624 AGTTTGTCTTTGTTGAAATAAGG + Intergenic
926898993 2:17728753-17728775 ATTTTTTTTTTTTTGAAACAGGG + Intronic
927601185 2:24442999-24443021 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
927644309 2:24866608-24866630 ATTTTTTTGTTGTTGAAACCTGG - Intronic
927744104 2:25600089-25600111 ATTTATTTATTTTTGAGATAGGG - Intronic
927818454 2:26241920-26241942 ATTTTTTTTTTTTTGAGATATGG + Intronic
927834092 2:26377872-26377894 TTTTTGTTGTTGTTGAAAACTGG + Intronic
927948474 2:27151642-27151664 ATTTACTTATTGTTGAGACAGGG + Intronic
927975970 2:27338535-27338557 TTTTTGTTGTTTTTGAGATAGGG + Intronic
928039860 2:27864193-27864215 ATTTTTTTTTTGTAGAAATGGGG + Intronic
928113571 2:28528952-28528974 TTTTTTTTTTTTTTGAAATAGGG + Intronic
928137139 2:28696127-28696149 ATTTTTCTATTTTTGAAACAGGG - Intergenic
928153525 2:28854911-28854933 ATTTTGTTTGTTTTGAGATAGGG - Intronic
928546678 2:32335219-32335241 ATTTTTTTATTTTTGAGACAAGG + Intergenic
928649596 2:33390493-33390515 ATTTTTTTTTTTTTGAGATAGGG + Intronic
928796387 2:35026450-35026472 ATTTTGTAATTTTTTAAATCAGG - Intergenic
928895971 2:36263899-36263921 ATGAGGTTATTGTTGAAATCAGG - Intergenic
928989460 2:37217392-37217414 TTTTTGTTGTTGTTGAAATAGGG - Intronic
929488392 2:42374813-42374835 TTTTTGTTTTTCTTGACATAGGG - Intronic
929513456 2:42584688-42584710 TTTTTGTTGTTGTTAAAATGGGG - Intronic
929619802 2:43343032-43343054 ATTTATTTATTTTTGAAACAAGG + Intronic
929673906 2:43904684-43904706 TTTTTGTTTTTTTTGAGATAGGG - Intronic
929719020 2:44347322-44347344 TTTTTGTTGTTGTTGAGACAGGG - Intronic
929823417 2:45291342-45291364 ATTCTGTTATTGTTGTTTTAAGG - Intergenic
930116497 2:47722745-47722767 ATTTTTTTATTTTTGAGACAGGG - Intronic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930258729 2:49120609-49120631 ATTGTGCTCTAGTTGAAATAGGG + Intronic
930343884 2:50153394-50153416 ATTTTTTTTTTGTTGAAAAATGG + Intronic
930360681 2:50374635-50374657 ATTTTCTTTTTGATCAAATAAGG - Intronic
930456937 2:51617058-51617080 TTTTTTTTTTTTTTGAAATAAGG - Intergenic
930790104 2:55316541-55316563 ATTTAGTTTTTGTAGAAATAGGG - Intronic
930851794 2:55968996-55969018 ATTTTGTTCTTATATAAATATGG - Intergenic
930909169 2:56610195-56610217 ATTTTTTTGTTGTTGAAATATGG + Intergenic
930924007 2:56793771-56793793 ATTTTTTAATTTATGAAATATGG + Intergenic
931331977 2:61296251-61296273 ATTTATTTATTTTTGAGATAAGG - Intronic
931342198 2:61412714-61412736 ATTTTTTTATTGTAGAAAGGAGG - Intronic
931449833 2:62359406-62359428 ATTTTATTATTTTTGAGACAGGG + Intergenic
931607015 2:64062746-64062768 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
931885844 2:66616038-66616060 ATTTTGCTATTTTATAAATAGGG - Intergenic
932038598 2:68274307-68274329 ATTTTGTTTTTGTTTAATTAGGG + Intergenic
932067130 2:68576310-68576332 ATTTTATTATTTTAAAAATATGG + Intronic
932142685 2:69293706-69293728 TCTTTTTTATTTTTGAAATAGGG + Intergenic
932149948 2:69361805-69361827 ATTTTATTTTTGTAGAGATAGGG - Intronic
932326833 2:70868596-70868618 TTTTTGTTTTTCTTGAGATAGGG - Intergenic
933002739 2:76946594-76946616 ATTTTGTCATGGTTAAAATCAGG + Intronic
933278262 2:80304899-80304921 TTTTTTTTTTTTTTGAAATATGG - Intronic
933391445 2:81673968-81673990 ATCTTGGCATTGTTGAAATTGGG + Intergenic
933400345 2:81788602-81788624 TTTTTGTTTTTGTAGAAATAGGG - Intergenic
933586666 2:84186733-84186755 ATTTTGTTATTGTTATATCAAGG - Intergenic
934068150 2:88359122-88359144 ATTTATTTATTTATGAAATATGG - Intergenic
934184336 2:89658295-89658317 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
934294622 2:91732433-91732455 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
934776030 2:96938025-96938047 TTTTTGTTGTTGTTGAGACAAGG - Intronic
935004149 2:99054336-99054358 TTTTTGTATATGTTGAAATAAGG - Intronic
935238349 2:101156761-101156783 ATTTTGTTGTAGTTGAAAGATGG + Intronic
935238931 2:101161548-101161570 TTTTTGCTTTTTTTGAAATAGGG + Intronic
935464610 2:103381620-103381642 ATTTATTTATTTTTGAAATAGGG + Intergenic
935475046 2:103509138-103509160 ATTTTTTGATTTTTGAACTATGG + Intergenic
935793719 2:106618752-106618774 GTTTTATTATTATTCAAATACGG + Intergenic
935957966 2:108397609-108397631 AATTTGTTCTAGCTGAAATATGG - Intergenic
936407354 2:112217937-112217959 TTTTTGTTTTTGTAGAGATAGGG + Intronic
936691375 2:114893158-114893180 ATTTTGTGATCGTTTAAATTTGG - Intronic
936726519 2:115324438-115324460 ACTTTGATATTATGGAAATAGGG + Intronic
936740675 2:115503441-115503463 TTTTTGTTGTTGTTTCAATAGGG - Intronic
936810703 2:116397612-116397634 ATTTAGGTATTGTAGAAAGAAGG - Intergenic
936956439 2:118027146-118027168 ATTTATTTATTTTTGAAACAGGG - Intergenic
937145717 2:119642710-119642732 ATTTATTTATTGTAGAGATATGG + Intronic
937374039 2:121323093-121323115 ATTTTTTTCTTATTGAAGTAGGG + Intergenic
937482640 2:122278248-122278270 ATTTTGTTATATTAGCAATAAGG - Intergenic
937604986 2:123789106-123789128 TATTTGTTTTTGTTGAAAAATGG + Intergenic
937644708 2:124253641-124253663 TCTTTGTTCTTGTTTAAATAAGG - Intronic
937689393 2:124737592-124737614 ATTTGTTTCTTGTTGCAATAGGG + Intronic
937701906 2:124872164-124872186 ATTTTGTTCTTTTTGAAGCATGG + Intronic
937832362 2:126437729-126437751 ATTTTGTTTTTATTCAACTATGG + Intergenic
937914347 2:127091714-127091736 ATTTTTTTTTTGTAGAAATGGGG - Intronic
938035975 2:128035284-128035306 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
938294564 2:130169722-130169744 ATTTTTTTTTTGTAGAAATGAGG + Intronic
938470747 2:131558352-131558374 ATTTTGTCCTCGCTGAAATATGG + Intergenic
938548584 2:132358740-132358762 TTTTTGTATTTGGTGAAATATGG - Intergenic
939036507 2:137137903-137137925 ATATTCTTTTTTTTGAAATAGGG + Intronic
939050629 2:137303003-137303025 ATTTTATTATTTTTGAAACGAGG + Intronic
939163357 2:138614538-138614560 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
939194495 2:138955230-138955252 ATTTATTTATTTTTGCAATATGG + Intergenic
939244413 2:139604874-139604896 ATTTTATTAGTGTTTTAATAGGG + Intergenic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939504630 2:143030480-143030502 ATTTTTTTGTTTTTGAAACAAGG + Intronic
939638421 2:144610843-144610865 ATTTTGTCATTGTGCAAATAGGG + Intergenic
939765607 2:146245171-146245193 ATTTAGTTATTGTAGATATGCGG - Intergenic
939934303 2:148271085-148271107 TTATTTTTATTGTTAAAATATGG + Intronic
939967938 2:148628945-148628967 ATTTTTTTATTTTTTAATTATGG + Intergenic
940045195 2:149402309-149402331 AATTTGTAATTGTAAAAATATGG - Intronic
940077531 2:149759818-149759840 ATTTTGTTTGTGGTGAAAGATGG + Intergenic
940159780 2:150698882-150698904 ATATTTTTATTTTTAAAATATGG + Intergenic
940179952 2:150921025-150921047 ATATTGTTGTTATTGAAATATGG + Intergenic
940218579 2:151326822-151326844 ATTTTATTATTAGTGAAAAATGG - Intergenic
940322532 2:152392069-152392091 ATTTTCATATTGTTTAAATGAGG + Intronic
940658287 2:156515364-156515386 CTTTTTTTTTTTTTGAAATAGGG - Intronic
940796400 2:158084174-158084196 ATTTTTTTATTTTTTAATTATGG + Intronic
940968096 2:159862449-159862471 ATTTTTTTCTTTTTGAAATGGGG - Intronic
940988218 2:160071282-160071304 AATTTGTTCTAGCTGAAATATGG - Intergenic
941206269 2:162577090-162577112 ATTTTTTTTTTGTAGAAATTGGG + Intronic
941285044 2:163600997-163601019 ATGTTTTTATTGTGGATATAGGG - Intronic
941290661 2:163669386-163669408 ATTTTGTATTTGTTGAGACAGGG + Intronic
941352663 2:164455540-164455562 TTTTTTTTATTTTTGAAACAGGG - Intergenic
941424550 2:165325970-165325992 ATATTGTTCTTTTAGAAATAGGG + Intronic
941429350 2:165393713-165393735 ATTTATTTATTTTTGAGATAAGG + Intergenic
941495521 2:166197059-166197081 AATTTATTATTTTTTAAATATGG + Exonic
941551813 2:166926065-166926087 ATTTTTTTCTTTTTGAGATAGGG - Intronic
941834615 2:170002858-170002880 ATTTATTTATTTTTGAGATAGGG + Intronic
941887115 2:170539623-170539645 ATTTTTTTTTTTTTGAGATAGGG + Intronic
942006244 2:171702882-171702904 TTTTTGTTTTTGTAGAAATGGGG + Intronic
942029695 2:171947259-171947281 ATTTATTTATTTTTGAGATAGGG + Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
942065171 2:172263927-172263949 TTGTTGTTGTTGTTGAGATATGG - Intergenic
942070334 2:172310293-172310315 ATTTTTTTTTTGTAGAAACAGGG + Intergenic
942280821 2:174362297-174362319 TTTTTGTTTTTGTTGAGAAAAGG - Intronic
942389080 2:175473255-175473277 ATTTTCTCATCTTTGAAATAAGG + Intergenic
942752688 2:179305706-179305728 ATTTTTTTTTTGTAGAAACAGGG - Intergenic
942930449 2:181486321-181486343 ATTTTATTATTTCTGAAATCAGG - Intronic
943015252 2:182502504-182502526 ATTTTGGAGTTGTTGATATATGG - Intronic
943018868 2:182548585-182548607 ATTTTTTTCTTTTTTAAATAAGG + Intergenic
943020756 2:182570668-182570690 ATTTTCTTATTGTTTAAAATAGG + Intergenic
943338541 2:186648438-186648460 AGTTTGTGATTCTAGAAATAAGG + Intronic
943510733 2:188823667-188823689 ATTTTGTTAATGTAAATATATGG - Intergenic
943580512 2:189678106-189678128 ATTTTTTTATTTTTAAATTATGG + Intronic
943693787 2:190899319-190899341 ATTTTTTTAATGTTGTAATAGGG + Intronic
943721589 2:191208605-191208627 TTCTTGTTGTTGTTGAGATAGGG - Intergenic
943802316 2:192076747-192076769 ATTTTGATATTGTGGAACTCAGG + Intronic
943825687 2:192388485-192388507 AGTTTGTTACTGTTCAAAAAAGG - Intergenic
943938849 2:193963908-193963930 ATTTTGTAAGGGTTGAAATTTGG + Intergenic
944224123 2:197332828-197332850 ATTTATTTATTTTTGAGATAGGG - Intergenic
944558579 2:200912420-200912442 GTTTTGTTCTTTTTGAAATAGGG + Intronic
944795730 2:203183011-203183033 ATTTTGGTCTGATTGAAATAAGG + Intronic
945071771 2:205997277-205997299 ATTTTCCTATAGCTGAAATATGG + Exonic
945226700 2:207538450-207538472 CTTTTCTTAGAGTTGAAATAAGG + Intronic
945229372 2:207569260-207569282 ATTTTAATATTGTTGGAATTGGG + Intronic
945378203 2:209104926-209104948 AATTTGTAATTGTAAAAATACGG + Intergenic
945446931 2:209949832-209949854 TTTTTTTTATTTTTGAAACAGGG + Intronic
945489198 2:210434864-210434886 ATGTTGTTAATGTTAAAAAATGG - Intronic
945517598 2:210782289-210782311 AATTTGTGATTTTTAAAATAGGG - Intergenic
945552011 2:211231926-211231948 ATTTATTTATTTTTGAGATAGGG - Intergenic
945628581 2:212241248-212241270 ATTTTTTTATTTTTGAGACAGGG - Intronic
945878649 2:215304538-215304560 TTTTTGTTTTTTTTGATATAGGG - Intergenic
945953826 2:216066633-216066655 ATATTATTATTGTTGGAATTTGG - Intronic
946071384 2:217036999-217037021 ATTTTTTTTTTTTTAAAATATGG + Intergenic
946324168 2:218975235-218975257 ATTTTGCTTTTGTAGAGATAGGG - Intergenic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946719937 2:222593851-222593873 TTTTTGTTGTTGTTGAGACAGGG - Intronic
947029121 2:225772786-225772808 ATTTTAGTATTTTTTAAATATGG - Intergenic
948779993 2:240313443-240313465 ATTTTTTGATTTTTCAAATATGG + Intergenic
1169121163 20:3096713-3096735 TTTTTGTTATTGTGGAGACACGG + Intergenic
1169234045 20:3914478-3914500 ATTTTTTTTTTGTAGAGATAGGG + Intronic
1169362639 20:4964011-4964033 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1169416869 20:5424770-5424792 ATTATGTTATTTTTTAAATGCGG + Intergenic
1169708801 20:8538047-8538069 ATTTTGTTATTCATCAAAGAGGG - Intronic
1169953794 20:11078808-11078830 TTTTTTTTATTGTGGAAATGTGG + Intergenic
1170073251 20:12391614-12391636 ATTTTTTTTTTATTGAGATAGGG - Intergenic
1170088045 20:12558405-12558427 ATTTGTTTATTGATGAAATCAGG - Intergenic
1170105578 20:12751349-12751371 ATTTATTTATTTTTGAGATAGGG - Intergenic
1170238232 20:14132218-14132240 ATTTTTTTTTTGTTGAGACAGGG + Intronic
1170256700 20:14352416-14352438 ATTTTTTTCTTTTTTAAATATGG - Intronic
1170360354 20:15539635-15539657 ATTTTTTTCTTGTTAAAATATGG - Intronic
1170367297 20:15611712-15611734 CATTTGTTCTTGTGGAAATATGG + Intronic
1170564947 20:17594072-17594094 ATTTATTTATTTTTGAGATACGG - Intronic
1170595973 20:17806205-17806227 ATTTTTTTGTTGTTGAGATGGGG - Intergenic
1170751383 20:19149692-19149714 ATTTTTTTTTTGTAGAGATAAGG - Intergenic
1170923461 20:20701319-20701341 ATATTATTATTATTGAAATAAGG + Intronic
1170923915 20:20705211-20705233 TTTTTGTTGTTGTTGATACAGGG + Intronic
1171331559 20:24343663-24343685 ATTTTTTTTTTGTAGAGATAGGG + Intergenic
1171877410 20:30591241-30591263 TTTTTGTATTTGGTGAAATATGG - Intergenic
1171889375 20:30695604-30695626 AATTTGTTTTTATTCAAATACGG + Intergenic
1172038214 20:32025438-32025460 TTTTTGTTATTGTAGAAATAAGG + Intronic
1172074786 20:32287186-32287208 ATTTTATTTTTGTAGAAACAGGG + Intronic
1172074804 20:32287326-32287348 ATTTGTTTATTTTTGAGATAGGG + Intronic
1172251819 20:33485003-33485025 ATTTAGTTTTTGTAGAAACAGGG + Intergenic
1172348319 20:34222101-34222123 ATTTATTTATTTTTGAGATAGGG - Intronic
1172571010 20:35970720-35970742 ATTTTGTTGTTGTTGTTACAGGG + Intronic
1172641723 20:36444289-36444311 ATTTACTTATTTTTGAGATAGGG + Intronic
1172694771 20:36815053-36815075 GTTTTGTTTTTCTTGAGATAGGG - Intronic
1172727685 20:37058767-37058789 TTTTTTTTTTTGTTGAGATAGGG + Intronic
1172780364 20:37433162-37433184 AGTGTGTTATTCTTGAAAGATGG - Intergenic
1172925267 20:38528539-38528561 TTTTTGTTGTTGTTAGAATAGGG + Intronic
1172982800 20:38957100-38957122 ATTTTGTTGTTTTTGAGATAGGG - Intergenic
1173269758 20:41522337-41522359 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1173386022 20:42588526-42588548 ATTTTTTTGTCTTTGAAATATGG - Intronic
1173455776 20:43200034-43200056 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1173748166 20:45453945-45453967 GTTTTCTTATTGATAAAATATGG + Intergenic
1174024971 20:47566516-47566538 ATTTATTTATTTTTGAGATAGGG + Intronic
1174234133 20:49074040-49074062 ATTTATTTATTGTAGAGATAAGG - Intronic
1174239186 20:49119196-49119218 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1174341244 20:49897446-49897468 AATTTTTTTTTGTTGAAACAGGG - Intergenic
1174506214 20:51019337-51019359 ATTTTTTAATTGTAGAAACAGGG - Intronic
1174579100 20:51558333-51558355 ATTTTTTTATTTTTGAGACATGG - Intronic
1174867228 20:54149395-54149417 ATTTTGTTAAAGCTAAAATATGG - Intergenic
1175018017 20:55812632-55812654 ATTTTATTTTGGTGGAAATAAGG + Intergenic
1175324795 20:58116066-58116088 TTTTTGTTGTTGTTGTTATATGG - Intergenic
1175595371 20:60227131-60227153 ATTTTCTTTTTTTTGAAACAGGG + Intergenic
1176116784 20:63435379-63435401 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1176221492 20:63971107-63971129 CTTTTTTTATTCTTGAGATAGGG + Intronic
1176224875 20:63991249-63991271 ATTTTGTTTTTGTAGAGACAGGG - Intronic
1176525463 21:7863462-7863484 ATTTTTTTATTTTTTAATTATGG + Intergenic
1176587421 21:8601626-8601648 ATTTTCTTATAGTTGACATATGG - Intergenic
1176609605 21:8867191-8867213 AATTTGTTTTTATTCAAATATGG - Intergenic
1176729071 21:10472114-10472136 TTTTTGTTTTTGTAGAGATAGGG - Intergenic
1176851341 21:13918564-13918586 ATTTTGTGTTTTTTGAGATAGGG - Intergenic
1176929658 21:14793002-14793024 ATTTTTTTATTTATGAAGTAAGG + Intergenic
1176998985 21:15588711-15588733 ATTTTATTATTTTTGAGATAGGG + Intergenic
1177246921 21:18538240-18538262 ATTTTTTTGTTGTTGCAACAGGG + Intergenic
1177454287 21:21315974-21315996 AATTCCTTATTGTTTAAATAAGG - Intronic
1177469638 21:21543142-21543164 GTTTTCTTATTGTTTCAATATGG + Exonic
1177868747 21:26544938-26544960 TTTTTGTTTTTGTTGAGATAGGG - Intronic
1177983297 21:27942641-27942663 ATTTTGTTGTTGTTCATGTAGGG - Intergenic
1178073439 21:28993762-28993784 ATTCTGTGATTGTTGGAAAAAGG - Intergenic
1178080400 21:29058010-29058032 TTTTTGTTGTTGTTGTGATAAGG - Intronic
1178602005 21:34002510-34002532 ATTTTGTTAATTTTTAAATGTGG + Intergenic
1178619439 21:34161010-34161032 ATTTTTTTATTTTTTAAAAAGGG + Intergenic
1178643139 21:34362852-34362874 TTTTTATTTTTGTAGAAATAGGG - Intergenic
1178659483 21:34493475-34493497 ATTTTTTTATTTTTTAATTATGG + Intergenic
1179078850 21:38151292-38151314 CTTTTGTTGTTGTTGACAAAAGG + Intronic
1179284136 21:39962093-39962115 TTTTTGTAATTGTTGTAATAGGG + Intergenic
1180270252 22:10578623-10578645 ATTTTCTTATAGTTGACATATGG - Intergenic
1180359660 22:11876424-11876446 AATTTGTTTTTATTCAAATATGG - Intergenic
1180471292 22:15658549-15658571 ATTTTGTCCTCGCTGAAATATGG + Intergenic
1180817316 22:18799113-18799135 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1180938335 22:19640658-19640680 ATTTTATTTTTGTTGAGAGAGGG + Intergenic
1181133865 22:20750901-20750923 ATTTTGTTATTGTGGTAATAGGG - Intronic
1181203506 22:21233434-21233456 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1181981018 22:26766495-26766517 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
1182036140 22:27199816-27199838 ATTTTGTTTTTGTAGAAATGGGG + Intergenic
1182222716 22:28771723-28771745 ATTTTTTTGTTGTTGAGATAGGG + Intergenic
1182234243 22:28863127-28863149 ATTTTTTTATTTTTGAGACAGGG - Intergenic
1182297936 22:29320807-29320829 ATTTATTTATTTTTGAAACAGGG + Intergenic
1182317087 22:29455042-29455064 ATTTTTTTATTTTTGAGACAAGG + Intergenic
1182508345 22:30801799-30801821 TTTTTGTTGTTGTTGAAATGGGG - Intronic
1182563737 22:31182470-31182492 ATTTTGTTTTGGTAGAGATAGGG + Intronic
1183482193 22:38071335-38071357 GTTTTGTTTTTTTTGAGATAGGG - Intronic
1183712936 22:39516694-39516716 ATTTTTATTTTTTTGAAATAGGG - Exonic
1183783650 22:40016369-40016391 ATTTTTGTATTGTAGAGATAGGG + Intronic
1183790592 22:40065316-40065338 ATTTTGTTTTTGTGGAGGTAGGG + Intronic
1183876269 22:40784767-40784789 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1183977626 22:41522330-41522352 TTTTTGTTGTTGTTGAGATGGGG - Intronic
1184052120 22:42015044-42015066 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1184129092 22:42506795-42506817 ATTTTGTGATTGTTAAAATATGG + Intergenic
1184139039 22:42567110-42567132 ATTTTGTGATTGTTAAAATATGG + Intronic
1184206314 22:43005963-43005985 TTTTAGTTTTTGTTGAGATAGGG + Intronic
1185033038 22:48455265-48455287 CTTTTGTTTTTCTTGAAAAATGG - Intergenic
1185282299 22:49978399-49978421 ATTTTGTTTTTGTAGAATCAGGG + Intergenic
1185353174 22:50348883-50348905 TTTTTGTTTTTGTAGAGATAGGG - Intronic
1203223415 22_KI270731v1_random:61980-62002 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1203267415 22_KI270734v1_random:24840-24862 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
949139995 3:620430-620452 ATTTTCTTATAGTTGACATATGG + Intergenic
949271971 3:2227708-2227730 ATTATGTAACTGTAGAAATATGG + Intronic
950269346 3:11601171-11601193 GTTTTGTTATTTGTGAAACACGG - Intronic
950611175 3:14127587-14127609 ATTTTCTTATCGGTGAAATGGGG + Intronic
950684490 3:14606740-14606762 GTTTTGTTATCTGTGAAATAGGG + Intergenic
951079460 3:18435168-18435190 ATTCTGTTATTGTTATAATAAGG + Intronic
951089272 3:18553296-18553318 ATTTTTTTAATGTAGAATTATGG - Intergenic
951101743 3:18696070-18696092 TTTTTGCTAATGTTGAAATAAGG - Intergenic
951216939 3:20033904-20033926 ATTTGCTTATTTTAGAAATAAGG + Intergenic
951509473 3:23485519-23485541 TTTTTGTTTTTGTTTTAATAGGG - Intronic
951636302 3:24782184-24782206 ATTTTTTTATTTTTGAGACAGGG + Intergenic
951659454 3:25046458-25046480 ATTTTTTTATTTTTGAGACAGGG + Intergenic
951674775 3:25225475-25225497 ATTTATTTGGTGTTGAAATATGG - Intronic
951830807 3:26924785-26924807 ATATTTTTATTGATTAAATATGG - Intergenic
952007852 3:28862991-28863013 ATTTTCTTAATTGTGAAATAAGG - Intergenic
952120629 3:30239525-30239547 TTTTTGTTGTTGTTGAATAAGGG + Intergenic
952173668 3:30837728-30837750 TTTTTGTAACTGTGGAAATAAGG - Intronic
952370717 3:32720512-32720534 ATTTTATTTTTTTGGAAATAGGG + Intronic
952531240 3:34264099-34264121 ATTTATTTATTTTTGAGATAGGG + Intergenic
952611820 3:35219356-35219378 ATTTTGTTGTTGTTAAAAATTGG + Intergenic
952703053 3:36346509-36346531 GCTTTCTTATTGGTGAAATAAGG + Intergenic
952731430 3:36640550-36640572 TTTTTGTTTTTGCAGAAATAAGG - Intergenic
952732247 3:36650870-36650892 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
952770954 3:36999916-36999938 TTTTTGTTTTTGTAGAAATAGGG + Intronic
953045221 3:39288857-39288879 ATTTCCTTATTGTTAAAATCAGG + Intergenic
953191686 3:40693780-40693802 ATTTTTTTTTTGTAGAGATAGGG + Intergenic
953726936 3:45407992-45408014 TTTTTGTTATAGGTGGAATATGG - Intronic
953998622 3:47539052-47539074 TTGTTGTTGTTGTTGAGATAGGG - Intergenic
954066308 3:48109286-48109308 ATTTTATTTTTTTTGAAACAGGG - Intergenic
954398524 3:50306557-50306579 ATTTTGTTCTAGCTGAAATATGG + Intronic
954517857 3:51195940-51195962 TTTTTGTTTTTTTTGAAACAAGG + Intronic
954547125 3:51446452-51446474 ATTTTGTTTTTGTGGAGATGGGG - Intronic
954552098 3:51490422-51490444 TTTTTGTTGTTGTTGAGACAGGG - Intronic
954557154 3:51527016-51527038 ATTTTTTTCTTTTTGCAATAGGG + Intergenic
954561648 3:51561873-51561895 ATTTATTTATTGTTGAGACAAGG + Intronic
954642455 3:52109154-52109176 ATTGTGTCATTGTTCAAATAAGG - Intronic
955038881 3:55295111-55295133 ATTTTATTATTTTTGAGACAGGG - Intergenic
955296669 3:57741747-57741769 ATTTTTCTTTTGTAGAAATAGGG - Intergenic
955528532 3:59847656-59847678 ATTTTATTTTTGTTGAAAACTGG + Intronic
956122827 3:65983087-65983109 TTTTTGTTTTTGTTGAAATGGGG + Intronic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956336162 3:68166458-68166480 ATTTAGTTACTGTCTAAATAAGG - Intronic
956422826 3:69102311-69102333 CTTTTGTTGTTGTTGAGATGGGG + Intronic
956516699 3:70057207-70057229 ATTTTGTTATTGGGGAAAGGGGG + Intergenic
956538844 3:70310952-70310974 ATTTTCTTATTGGTAAATTAAGG + Intergenic
956630587 3:71312982-71313004 ATTTTATTATTTTTGAGACAGGG - Intronic
956695499 3:71915855-71915877 ATTTTTTTATTTTGGAAACAGGG + Intergenic
956770096 3:72518333-72518355 AGTTAGTCATTGTTGAAACAGGG - Intergenic
957057906 3:75458463-75458485 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
957269054 3:78004979-78005001 ATTTCAATATTGTTGAAATTAGG + Intergenic
957312064 3:78533395-78533417 ATTTTCTTAAAGTAGAAATATGG + Intergenic
957471346 3:80661410-80661432 ATTTTTTTATTTTTAAATTATGG - Intergenic
957494846 3:80979126-80979148 AATGTATTATTGTTAAAATATGG - Intergenic
957529059 3:81416602-81416624 TTTTTGTTTTTGTTTTAATAAGG - Intergenic
957559498 3:81803679-81803701 ATTTATTTATTTTTGAGATAAGG - Intergenic
957673998 3:83343245-83343267 TTTTTCTTATTGTTTAAATAGGG + Intergenic
957787810 3:84904715-84904737 GTTTTCTTATTTTTTAAATAGGG - Intergenic
957845834 3:85733740-85733762 ATTTATTTATTGTAGAAATGAGG - Intronic
957981195 3:87512581-87512603 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
958051435 3:88352583-88352605 ATTTATTTATTATTGAGATAGGG + Intergenic
958545176 3:95538891-95538913 ATTTGGTTATTATAAAAATAGGG + Intergenic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
958796892 3:98715830-98715852 ATTTTTTTATTTTTGAGACACGG + Intergenic
958852813 3:99349464-99349486 ATTTTTTTTTTGTAGAAATGAGG - Intergenic
959026593 3:101246923-101246945 TTTTTGTTGTTGTTGAGATGCGG - Intronic
959137269 3:102439202-102439224 ATTTTGTAAATGTTGAACTGTGG - Intronic
959337976 3:105090561-105090583 ATATTTTTATTGTTAAAACAGGG - Intergenic
959430126 3:106243803-106243825 ATGTTGTTATTGTTCACAGAAGG - Intergenic
959656921 3:108817625-108817647 ATTTTGTTATCATGGTAATACGG + Intergenic
960108838 3:113825885-113825907 ATTTTTTTATTTTTGAGATGGGG - Intergenic
960110649 3:113841460-113841482 ATTTTGTTTTAGTTGAGATGGGG + Intronic
960205190 3:114888244-114888266 ATTTTTTTTTTGTAGAAATGGGG - Intronic
960287396 3:115844968-115844990 ATTTTTTTATTTTTGAGACAGGG - Intronic
960332274 3:116376348-116376370 ATTTTGTTATTGTAATAAGAAGG - Intronic
960535270 3:118808643-118808665 ATTCTTTTATTGTTAGAATAGGG - Intergenic
960537782 3:118832269-118832291 AATTTGTTATTTTTGAAACAGGG - Intergenic
960643979 3:119857658-119857680 ATCTTGTTAATGTTGATATTTGG + Intronic
960730056 3:120717360-120717382 ATTGTGTTATTGTGGAAGAATGG - Intronic
960876834 3:122304849-122304871 ATTTTTTTTTTTTTGAGATAGGG - Intergenic
960927801 3:122813304-122813326 TTTTTGTTGTTTTTGAAATACGG + Intronic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961080784 3:124025490-124025512 ATCTTCTTGTTGTTGAAATGAGG + Intergenic
961126792 3:124425959-124425981 TTTTTGTCATGGTAGAAATAAGG - Intronic
961193899 3:124985378-124985400 ATATTGTTATTTTTTAAAAAAGG + Intronic
961350467 3:126298114-126298136 ATTTTTTTATTTTTTAATTATGG + Intergenic
961423196 3:126823871-126823893 TTTTTGTTTTTGTAGAGATAGGG - Intronic
961748793 3:129083240-129083262 ATTTTTTTTTTTTTGAAACAGGG - Intergenic
961890365 3:130125924-130125946 CTTTTGTTGTTGTCGAAACAGGG + Intergenic
961925449 3:130474833-130474855 AATTTGTTGTTGTTGAGATGGGG - Intronic
962326219 3:134434779-134434801 TTTTTGTTTTTGTAGAGATACGG + Intergenic
962544638 3:136420369-136420391 ATTTTGTTTTAATTGAGATAGGG + Intronic
962567457 3:136676620-136676642 ATTTTGTATTTGTGGAGATAGGG + Intronic
963084143 3:141421509-141421531 GTTTTGTTTTTGTTGATATAAGG + Intronic
963441135 3:145342087-145342109 AATTTATTATTGTGCAAATACGG - Intergenic
963444643 3:145388600-145388622 TTTTTGTTGTTGTTGAAAACTGG - Intergenic
964055323 3:152448965-152448987 ATTTAGTTTTTGTTCCAATATGG - Intronic
964058878 3:152496197-152496219 TTTTTGTTATTGTTGGTTTAGGG + Intergenic
964129373 3:153269445-153269467 ACTTTTTAGTTGTTGAAATATGG - Intergenic
964134172 3:153325880-153325902 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
964178053 3:153849761-153849783 ATTTTCTTAGTCTTAAAATAGGG - Intergenic
964519374 3:157546752-157546774 TTGTTGTTGTTGTTGAGATAGGG + Intronic
964580112 3:158224961-158224983 ATATTGTGATAGTAGAAATACGG + Intronic
964647709 3:158976064-158976086 AATTTTTTTTTGTGGAAATATGG + Intronic
964811887 3:160673787-160673809 AAATTTTAATTGTTGAAATATGG + Intergenic
965258626 3:166449775-166449797 CTTTTGTGTTTGTAGAAATATGG - Intergenic
965280540 3:166746627-166746649 ATTTTGTTGTTGTTAAAACAAGG + Intergenic
965419989 3:168446187-168446209 ATTTTTTCTTTGTTGAAATGGGG + Intergenic
965422018 3:168472333-168472355 TTTTTTTTTTTTTTGAAATAAGG + Intergenic
965720653 3:171657626-171657648 ATTTTGTTACTTTTTATATATGG - Intronic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
965947042 3:174255663-174255685 ATTTATTTATTTTTGAGATAGGG + Intronic
966186640 3:177233048-177233070 ATTTTTTTTTTTTTGAGATAGGG - Intergenic
966332973 3:178835989-178836011 ATTGTCTTATTCTTGAAATGGGG - Intronic
966602577 3:181789985-181790007 ATTTTCTTTTTGTAGAAACAGGG + Intergenic
966625280 3:182009068-182009090 TTGTTGTTGTTGTTGAAATATGG + Intergenic
966934563 3:184697487-184697509 ATTTTTTTATTTTTGAGACAGGG + Intergenic
966968612 3:185020767-185020789 TTGTTGTTGTTGTTAAAATAGGG - Intronic
967093350 3:186154088-186154110 GTTTTGTTGTTGTTGAGACAAGG - Intronic
967240406 3:187433089-187433111 ATTTTATTTTTGTAGAGATAAGG - Intergenic
967433437 3:189416390-189416412 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
967447950 3:189588898-189588920 ATTTTGTAAATGTGGAAACAAGG + Intergenic
967471005 3:189861893-189861915 ATTTTCTTATTTATAAAATAGGG + Intronic
967596905 3:191336516-191336538 ATTTTCTTATTATTGAATTTGGG + Intronic
967628301 3:191711899-191711921 ATTTATTTATTTTTGAAATGGGG - Intergenic
967773951 3:193365416-193365438 ATTTTGAGATTATTCAAATAAGG + Intronic
967783289 3:193462976-193462998 ATTTTTTTTTTTTTAAAATAGGG - Intronic
968130007 3:196187571-196187593 ATTTTATTTTTTTTGAAACAGGG + Intergenic
968214462 3:196876702-196876724 TTTTTTTTTTTGTAGAAATACGG - Intronic
1202736286 3_GL000221v1_random:1960-1982 AATTTGTTTTTATTCAAATATGG - Intergenic
968668732 4:1836209-1836231 ATTTATTTATTTTTGAAACAGGG - Intronic
968796157 4:2706197-2706219 TTTTTGTTTTTGTAGAAACAAGG - Intronic
969001774 4:3988470-3988492 TTTTTGTTGTTGTCGAAACAGGG + Intergenic
969287921 4:6218589-6218611 ATCTTGGAATTGATGAAATACGG + Intergenic
969326157 4:6445180-6445202 ATTTTGCTTTTGTTGAGACAGGG - Intronic
969812140 4:9656341-9656363 TTTTTGTTGTTGTCGAAACAGGG - Intergenic
970000946 4:11365529-11365551 ATTTTGTTTTTGTTTATAGAAGG + Intergenic
970023083 4:11591007-11591029 ATTTTCTTATTTTTGTAATAAGG - Intergenic
970060407 4:12027011-12027033 ATTTTTTTATTTTTGAGAAATGG + Intergenic
970151915 4:13098849-13098871 AATTTTTTATTGTTTAAATTGGG - Intergenic
970239881 4:13997697-13997719 ATATTCTTATTTTTGAAATGAGG + Intergenic
970986756 4:22167823-22167845 ATTCTGTCATTGTACAAATATGG - Intergenic
971084945 4:23263234-23263256 TTTTTCTTATTTTTGAAAAATGG - Intergenic
971120355 4:23697467-23697489 ATTTTCTTCTTGTTACAATATGG - Intergenic
971263814 4:25080656-25080678 TTTTTGTTATTGGTGAAATAAGG - Intergenic
971278723 4:25223159-25223181 ATTTATTTATTTTTGAGATAGGG - Intronic
971333850 4:25704703-25704725 AATTTGCTATGGTTTAAATATGG - Intergenic
971381057 4:26098076-26098098 ATTTTTTTGTTGTTGAAACTAGG - Intergenic
971407605 4:26336771-26336793 ATTTTGTTATTTTTGTTATCAGG - Intronic
971411887 4:26382546-26382568 ATTTTGTTGTGTTTGAGATAGGG + Intronic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
971685374 4:29759067-29759089 ATTTTTTTTTTCTTGACATAGGG - Intergenic
971691945 4:29848251-29848273 ATTTTGTTCATGGTGACATAGGG + Intergenic
971903280 4:32692018-32692040 TTTATGTTAGTGTTTAAATATGG - Intergenic
971908393 4:32759852-32759874 ATTTTTTTATTATTTAAATTTGG - Intergenic
972170995 4:36345038-36345060 ATTTTGTTATTAGCGAAATGAGG + Intronic
972355157 4:38273801-38273823 ATTTATTTATTTTTGAGATAGGG + Intergenic
972565907 4:40268766-40268788 ATTTTGTTGTTGTTGTTATATGG - Intergenic
972600293 4:40566059-40566081 TTTTTGTTGTTGTTGAGACAGGG - Intronic
972835893 4:42869455-42869477 ATTTTATAATTGTTAAAACAAGG + Intergenic
972853743 4:43081344-43081366 ATTTTGTCCTAGCTGAAATATGG - Intergenic
972896162 4:43622536-43622558 ATATTGTTACTTTTCAAATATGG + Intergenic
972932421 4:44089571-44089593 TTGTTGTTGTTGTTGAAATGAGG - Intergenic
972959604 4:44436696-44436718 CTTTGGTTATTGTTGAAATTAGG + Intronic
972983815 4:44739530-44739552 ATTTTTTTATTGTTGGTATTGGG - Intergenic
973559011 4:52115611-52115633 TTTTTGTTTTTTTTGAAACAGGG + Intergenic
973752623 4:54037344-54037366 ATTTATTTATTTTTGAGATAGGG - Intronic
973888889 4:55349534-55349556 ATTTTTTTTTTTTTTAAATAAGG + Intronic
973907283 4:55545534-55545556 ATTTTTTTATTTTTTAAAGAAGG + Intronic
974038543 4:56838314-56838336 ATTTTTTTTTTGTAGAAACAGGG - Intergenic
974184022 4:58422594-58422616 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
974381932 4:61152267-61152289 ATTTTCTTCATTTTGAAATAAGG + Intergenic
974392803 4:61294655-61294677 ATCTTATCATTGTTGAAATATGG + Intronic
974512647 4:62864925-62864947 ATTTTGTTATTGTAGGAAGAAGG - Intergenic
974550044 4:63360214-63360236 TTTTTGTTATTTTTAAAATATGG - Intergenic
974609437 4:64196535-64196557 ATTTTTTTGTTGTTGAAAGTTGG - Intergenic
974755947 4:66207854-66207876 TTTTTTTTATTATTTAAATATGG + Intergenic
975020971 4:69488179-69488201 ATTTTGTCAATGTAGAAATAAGG + Intronic
975066657 4:70074699-70074721 ATTTTGTGTTTGTTAAACTACGG - Intergenic
975138419 4:70896761-70896783 TTTTTGTTCTTGTGGAGATAGGG + Intergenic
975271039 4:72433833-72433855 ATTTTGTTATTTTTAAACTGTGG + Intronic
975362728 4:73490179-73490201 TTTTTTTTTTTTTTGAAATAAGG - Intronic
975582585 4:75920351-75920373 GTTTATTTATTGTTTAAATAAGG + Intronic
975655595 4:76638379-76638401 ATTTTTTTTTTGTTGAAACAGGG - Intronic
975659116 4:76670937-76670959 ATTTATTTATTTTTGAAACAGGG - Intronic
975710361 4:77155811-77155833 ATTTTGTTACTTGTGAAATATGG - Intergenic
975816719 4:78224702-78224724 ATTTATTTTTTGTTGAGATAGGG + Intronic
976129868 4:81872194-81872216 ATTTATTTATTTTTGAGATAGGG - Intronic
976261108 4:83145746-83145768 ATTTTTTTGTTGTTGAAACAGGG + Intergenic
976269732 4:83218802-83218824 ATTTTTTTTTTGTAGAGATAGGG + Intergenic
976284812 4:83361117-83361139 ATTTTTTTATTTTTGAGACAGGG - Intergenic
976318476 4:83684873-83684895 ATTTTTTTATTTTTAAATTACGG + Intergenic
976420960 4:84843405-84843427 ATTTTATTATTTTTGAGACAAGG + Intronic
976626264 4:87186484-87186506 TTTTTTTTTTTTTTGAAATAGGG + Intronic
976720109 4:88161001-88161023 ATTTTTTTTTTGTAGAGATAGGG - Intronic
976723100 4:88189005-88189027 TTTTTGTTGTTGTTTAAACATGG - Intronic
976785251 4:88812235-88812257 ATTTGGTAATTGATCAAATATGG - Intronic
976870007 4:89780267-89780289 ATTTTTTTATTTTTTAATTATGG - Intronic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
977076207 4:92454188-92454210 ATTTTGTCATTGTTTTAATGTGG - Intronic
977094629 4:92724699-92724721 ATTTTCTTATTTCTAAAATAAGG + Intronic
977465183 4:97375009-97375031 ATTTTATTATTGTATAAACAAGG + Intronic
977710084 4:100114823-100114845 CTTTTTTTTTTGTAGAAATAAGG + Intergenic
977720516 4:100235389-100235411 ATTTTGTCCTAGCTGAAATATGG - Intergenic
977809559 4:101345216-101345238 ATTTTGTTCTTTCTGAAAAAAGG + Intronic
977829151 4:101569930-101569952 ATTTTTTTATTTTTTAACTATGG - Intronic
978032117 4:103947978-103948000 ATTTTGTCTTAGCTGAAATATGG + Intergenic
978074029 4:104506889-104506911 ATCTTGCTCTTGTTGAAATGTGG + Intergenic
978356170 4:107877126-107877148 ATTTTTTTTTTTTAGAAATATGG - Intronic
978383789 4:108159635-108159657 ATTTTGTCATTGTTCACATCTGG - Intronic
978432018 4:108642723-108642745 GTTTTTTTATTGTAGAGATAGGG - Intergenic
978451341 4:108837428-108837450 ATTTAGTTGTTGTGGAAAGAAGG + Intronic
978577911 4:110204143-110204165 ATTTTCTTTTTGTAGAAACAGGG - Intergenic
978706231 4:111715119-111715141 ATTTATTTATTTTTGAAACAGGG - Intergenic
978706248 4:111715321-111715343 ATTTATTTATTTTTGAAACAGGG - Intergenic
978984592 4:114995868-114995890 GTTTTCTTATTCTTAAAATAGGG + Intronic
979008848 4:115340432-115340454 ATTTTGTCATTGTTGAATAAGGG - Intergenic
979024263 4:115548127-115548149 AATTTGTCCTAGTTGAAATACGG - Intergenic
979845708 4:125508994-125509016 ATTTGGTTATTTTTAAAATGTGG - Intergenic
979907006 4:126306733-126306755 AGTTTGTGAATGTTAAAATAGGG - Intergenic
980105796 4:128587194-128587216 ATGATGTGATTGTTCAAATAAGG + Intergenic
980116520 4:128684800-128684822 ATTTTGTTGTTGTTTGAATCAGG + Intergenic
980178571 4:129376319-129376341 TTTTTGTTATTGTTGAGACATGG - Intergenic
980297130 4:130935243-130935265 ATTTTGTTGTTGTTGTTCTAAGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980379569 4:131994305-131994327 ATATTGATTTTGTTCAAATAAGG - Intergenic
980471749 4:133262235-133262257 ATTTTGTCCTAGCTGAAATATGG - Intergenic
980706455 4:136502578-136502600 ATTTTCTTCTTATTTAAATAAGG - Intergenic
980728157 4:136791748-136791770 TTCTTTTTATTGTTCAAATATGG + Intergenic
980755779 4:137158286-137158308 ATTTTTTTTTTTTTGAGATAAGG + Intergenic
980902027 4:138914177-138914199 TTTTTGTTTTTGTAGAGATAGGG - Intergenic
981105241 4:140873682-140873704 ATTTTTTTATTTTTGAGACAGGG + Intronic
981292455 4:143091602-143091624 ATTTTGTCTTAGCTGAAATATGG + Intergenic
981354219 4:143768567-143768589 GTTTTCTTATAGTTGAAATCGGG + Intergenic
981536552 4:145806156-145806178 TTTTTTTTTTTTTTGAAATAGGG + Intronic
981625485 4:146749553-146749575 ATTTATTTATTTTTGAATTATGG + Intronic
982110422 4:152048247-152048269 GTTTTTTTCTGGTTGAAATATGG + Intergenic
982259575 4:153482769-153482791 ATTTTGTTTTTGTAGAGATGAGG + Intronic
982268781 4:153565502-153565524 TTTTTGTAATTTTTGTAATAAGG + Intronic
982472462 4:155809518-155809540 ATATTGTTATAGTTGAATCATGG + Intergenic
982534252 4:156588975-156588997 ATAGTGTTATTGTTTATATATGG + Intergenic
982698830 4:158635859-158635881 ATTTTGTTTTTGTAGAGATGGGG + Intronic
982731040 4:158955810-158955832 ATTTTAATATTCTTGAAATCAGG - Intronic
982841251 4:160189951-160189973 AATTTCCTATTGGTGAAATATGG + Intergenic
982982848 4:162163614-162163636 CTTTTGTGACTGTTAAAATAAGG - Exonic
983424728 4:167568761-167568783 ATTTTTTTTTTTTTTAAATAAGG - Intergenic
983497518 4:168460263-168460285 ATTTTGGTATAGTTGACATTAGG - Intronic
983546582 4:168971137-168971159 ATTTTTTTATTTTTTAATTATGG + Intronic
983728756 4:170966828-170966850 ATTTTGTTATATTTGATTTATGG - Intergenic
983763265 4:171441182-171441204 ATTCTGTTTTTTTAGAAATATGG + Intergenic
984417000 4:179474463-179474485 ATCTTGTTACTTTTTAAATAGGG - Intergenic
984467658 4:180121419-180121441 ATTTAATTATTCTTAAAATAAGG + Intergenic
984547149 4:181119991-181120013 ATTTCTATATTGTTGAAATGGGG + Intergenic
984688070 4:182694114-182694136 ATTTTTTTATTTTTGAGACAGGG + Intronic
984819094 4:183864399-183864421 ATTTATTTATTTTTGAAATGGGG + Intronic
984957956 4:185064597-185064619 ATTTTATTTTTGTAGAGATAGGG + Intergenic
985056363 4:186038871-186038893 TTGTTTTTATTTTTGAAATAGGG - Intergenic
985062306 4:186091621-186091643 ATTTTTTTCTTTTTTAAATAAGG + Intergenic
985181065 4:187263730-187263752 AATTTGTCAGTGTTGAAACATGG - Intergenic
985230129 4:187807070-187807092 ATTTTGTTATTGGTTATATGTGG + Intergenic
985433712 4:189906968-189906990 TTTTTTTTATTTTTGAAATGGGG + Intergenic
985533960 5:452586-452608 ATGTTTTTGTTGTTGAAAAATGG + Intronic
985973398 5:3394644-3394666 ACTTTGTTTTGGTTGAAAAAGGG + Intergenic
986191645 5:5501738-5501760 ATTTTGCTCTTGTTCAAATTTGG - Intergenic
986425314 5:7625583-7625605 CTTTTGTTTATGTAGAAATATGG - Intronic
986497626 5:8361525-8361547 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
986508587 5:8478803-8478825 AACTGTTTATTGTTGAAATAAGG + Intergenic
986588286 5:9341800-9341822 TTTACGTGATTGTTGAAATATGG + Intronic
986841975 5:11708051-11708073 ATTTTTTTTTTTTTGAGATAGGG + Intronic
986874467 5:12091304-12091326 ATTTTGGAATTGTTTCAATAAGG + Intergenic
986999229 5:13642347-13642369 ATTTTCTTATCTTTGAAATGGGG - Intergenic
987080847 5:14423937-14423959 TTTTTTTTTTTGCTGAAATAAGG + Intronic
987120980 5:14766217-14766239 ATTTTTTTTTTGTAGAGATAGGG - Intronic
987321669 5:16775900-16775922 ATTTTTTTATTTTTGAGATGGGG + Intronic
987427613 5:17791672-17791694 AGTTTTTTACTGTTGAAATGGGG + Intergenic
987615508 5:20268719-20268741 TTTTCGTTGTTGTTGAGATAGGG - Intronic
987642114 5:20626037-20626059 ATTTTGTTATGGTAGTCATATGG + Intergenic
987827667 5:23054651-23054673 ATTTTTTGGTTGTTCAAATAAGG + Intergenic
987886878 5:23824495-23824517 ATTTATTTATTGTAGATATAGGG + Intergenic
988448808 5:31318849-31318871 ATTCTGTTCTTGGTGAAATGCGG - Intronic
988576475 5:32430071-32430093 TTTTTTTTTTTTTTGAAATAGGG - Intronic
988783398 5:34543829-34543851 ATTTATTTATTGTTTAGATATGG - Intergenic
988821003 5:34885570-34885592 ATTTATTTATTGTAGAAATGGGG - Intronic
989060946 5:37411131-37411153 ATTTTTATTTTGTGGAAATAAGG + Intronic
989071039 5:37512227-37512249 ATTTTTTTTTTCTTGAAACAGGG + Intronic
989236212 5:39151294-39151316 ATTTATTTATTTTTGAGATAGGG + Intronic
990542631 5:56789602-56789624 ATTTTTTTATTTTTAAATTATGG - Intergenic
990605039 5:57400816-57400838 ATTTTTTTATTTTTTTAATACGG + Intergenic
990643191 5:57811988-57812010 ATTTAGTTATTTTTAAAATTTGG + Intergenic
990845526 5:60134329-60134351 ATTTTGTTTTTGTGGAGATGGGG - Intronic
991064147 5:62407973-62407995 ATTTATTTATTTTTGAGATAGGG + Intronic
991338955 5:65583943-65583965 AATTTGTTTTTGTAGAAACAGGG - Intronic
991354348 5:65752229-65752251 ATTTTTTTTTTTTTGAAACAGGG - Intronic
991521251 5:67499567-67499589 TTGTTGTTATTGCAGAAATATGG - Intergenic
992048423 5:72921339-72921361 ATTTTGTTATTGTTGTTAAAAGG - Intergenic
992130776 5:73690689-73690711 CTTTTGTTTTTGTTGAGATAGGG - Intronic
992227994 5:74637411-74637433 ATATGGTTAATGTTGAAATTGGG - Intronic
992291770 5:75286751-75286773 AATTTGTTCTAGCTGAAATATGG + Intergenic
992401355 5:76414645-76414667 ATTTTGTTTTTGTAGAAACAAGG - Intronic
992450561 5:76872238-76872260 ATTTATTTATTTTTGAGATAGGG - Intronic
992489156 5:77224420-77224442 AATTTGTTACTGTTGAAACTGGG - Intronic
992619562 5:78579189-78579211 ATTTTGCTATTGTTAAAGTCTGG + Intronic
992691739 5:79247487-79247509 TTTTAGTTGTTGTTGAAACAGGG + Intronic
992930463 5:81638327-81638349 ATTTTTTTATTTTTTAAATCAGG - Intronic
992988504 5:82258491-82258513 TTTTTTTTTTTTTTGAAATAAGG + Intronic
993323481 5:86504862-86504884 ATTTTCTCATTTTTCAAATAGGG - Intergenic
993731103 5:91423880-91423902 ATTTATTTATTTTTGAAATGGGG - Intergenic
993872599 5:93269727-93269749 ATTTTTTTTTTGTAGAAATGGGG + Intergenic
993999117 5:94756884-94756906 ACTTTTTTTTTGTGGAAATAAGG + Intronic
994024189 5:95062822-95062844 GTTTTGTTTTTTTTGAAATAGGG + Intronic
994062051 5:95489142-95489164 ATTTTTTTATTTTAGAAATGAGG - Intronic
994199225 5:96953299-96953321 ATTTTGTTAGTGTGAAAGTAAGG + Intronic
994293628 5:98061910-98061932 ATTTATTTATTTTTGAGATAAGG - Intergenic
994427789 5:99615798-99615820 AATTTGTTATTTTTAAAATGAGG + Intergenic
994434788 5:99712839-99712861 ATTTGTTTATGTTTGAAATAAGG + Intergenic
994447256 5:99892955-99892977 ATTTTGCTATTAATGCAATATGG - Intergenic
994665612 5:102701287-102701309 CTTTTGTTATTTTTGGAATTTGG + Intergenic
994675017 5:102810432-102810454 AACTTGTTTTTGCTGAAATATGG + Intronic
995319340 5:110814727-110814749 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
995405321 5:111788082-111788104 TTGTTGTTGTTGTTGAGATAGGG - Intronic
995413869 5:111887929-111887951 ATTTTGTAATTGCTGTAACAAGG - Intronic
995864222 5:116674051-116674073 ATTTTGGTATTGATAGAATATGG + Intergenic
995970150 5:117959054-117959076 TTGTTGTTATTGTTGAAAACTGG - Intergenic
996145137 5:119965551-119965573 ATTTTGTAGTGGTAGAAATAGGG + Intergenic
996182588 5:120437765-120437787 ATTTTGTTGTTATTGAGACAGGG - Intergenic
996260848 5:121466486-121466508 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
996281889 5:121739846-121739868 ATAATGTTATAGTTGAAATAGGG - Intergenic
996393002 5:122983608-122983630 TTTTTGTTGTTGTTGAAACAGGG + Intronic
996653475 5:125911948-125911970 ATTTCTTTATTGTTGATATTGGG + Intergenic
996946093 5:129069844-129069866 ATTTTAATATTGATGAAATTGGG + Intergenic
997118430 5:131150408-131150430 ATTTTGTTTTTGTAGAGACAGGG + Intergenic
997134866 5:131314411-131314433 TTTTTGTTGTTGTTGAGACAGGG + Intronic
997185483 5:131877635-131877657 CTTTTGTTTTTTTTGAAACAAGG - Intronic
997203595 5:132027512-132027534 CTTTTTTTTTTTTTGAAATAGGG + Intergenic
997238136 5:132287171-132287193 AATGTGCTATTGTTGCAATAAGG - Intronic
997430379 5:133834582-133834604 ATTTTGATATTTTTGATATTTGG - Intergenic
997478266 5:134162275-134162297 ATTTTGTTTTTGTAGAGATAAGG + Intronic
997532318 5:134589366-134589388 ATTTTTTTATTTTTGAGACAGGG + Intergenic
997908170 5:137841336-137841358 ATTTTTTTTTTGTAGAAACAGGG - Intergenic
997908505 5:137844574-137844596 TTTTTGTTTTTTTTGAAATGGGG - Intergenic
997935995 5:138111589-138111611 ATTTTTTTCTTTTTGATATAGGG - Intergenic
998020035 5:138761759-138761781 TTTTTGTTGTTGTTGATACAGGG + Intronic
998104300 5:139458489-139458511 TTTTTTTTTTTGTTGAGATAGGG - Intronic
998235432 5:140394720-140394742 TTTTTGTTGTTGTTGAGACAAGG + Intergenic
998255741 5:140586051-140586073 AATTTTTTTTTGTAGAAATAAGG - Intronic
998601005 5:143584906-143584928 ATTTTTTTATTTTTAAATTATGG + Intergenic
998793107 5:145787547-145787569 ATTTTTTTTTTTTTGACATAGGG + Intronic
998827852 5:146122651-146122673 GTTTTGTTCTTGGTGAAATGAGG - Intronic
999102077 5:149034157-149034179 ATTTTGCTATTTTTCATATATGG - Intronic
999161957 5:149508932-149508954 TTTTTGTTGTTGTTGAGACAGGG + Intronic
999289845 5:150417185-150417207 GTTTTGTTTTTGTAGAAATGGGG - Intergenic
999516295 5:152304936-152304958 ATTTTGTTGTTGTTGAACCCAGG + Intergenic
999620854 5:153471689-153471711 AATTTGTGATTGTTGTAATTAGG - Intergenic
999711631 5:154323363-154323385 ATTTTTTTTTTTTTGAAATGGGG - Intronic
1000075785 5:157784124-157784146 CTTTTTTTGTTGTTGAAATAGGG - Intergenic
1000098405 5:157991491-157991513 ATTTATTTATTTTTGAGATAGGG + Intergenic
1000143574 5:158430576-158430598 ATTTTGTTTTTGTTTTAAAAAGG - Intergenic
1000493430 5:161945878-161945900 ATTTTTTTCTTGTTGTAACAGGG + Intergenic
1000502982 5:162075978-162076000 TTTTTTTTTTTCTTGAAATAGGG - Intronic
1000855150 5:166388751-166388773 GTTATGTTATTATTAAAATAAGG - Intergenic
1001504206 5:172264085-172264107 CTTTTGTTTTTTTTGAAACAGGG + Intronic
1001767873 5:174268006-174268028 ATTTTTTTATTTTTAAATTATGG - Intergenic
1001770125 5:174288955-174288977 CTTTTTTCTTTGTTGAAATATGG + Intergenic
1001802602 5:174557197-174557219 ATTTTTTTTTTTTTGAAACAGGG + Intergenic
1002150585 5:177226488-177226510 ATTTATTTATTTTTGAAATGGGG + Intronic
1002866905 6:1129866-1129888 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1003211672 6:4073851-4073873 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1003258769 6:4497072-4497094 TTTTTGTTCTTGTTGAGTTAGGG + Intergenic
1003543074 6:7035198-7035220 ATTTTTTTATTTTTGAGACAGGG - Intergenic
1004035886 6:11922894-11922916 ATTTTGCAATTTTTGAAAAATGG + Intergenic
1004237363 6:13886187-13886209 AATTTGTTTTTGTAGAAATGGGG + Intergenic
1004242865 6:13943291-13943313 TTTTTCTTTTTGTAGAAATAGGG + Intronic
1004444796 6:15687929-15687951 ATTTTAACATTGTTGAAATCAGG - Intergenic
1004541729 6:16556962-16556984 TTTTTGTTGTTATTTAAATATGG - Intronic
1004956385 6:20732281-20732303 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1005326198 6:24703049-24703071 ATTTTATTTTTGTAGAAACAAGG + Exonic
1005464477 6:26099199-26099221 GTTTTGTTGTTGTTGAGACAGGG + Intergenic
1005658191 6:27965622-27965644 GTTTTCTTATTGTTGAACTTTGG - Intergenic
1005722802 6:28619513-28619535 GTTTTGTTATTTTTGAGACAAGG + Intergenic
1005750234 6:28875441-28875463 AATGTGCTATTGTTGCAATAAGG - Intergenic
1005880324 6:30053071-30053093 TTTTTTTTATTTTTGAGATAGGG + Intergenic
1006061746 6:31425876-31425898 ATTTTTTTATTTTTCAATTATGG + Intergenic
1006224886 6:32528934-32528956 ATTTTTTTCTTTTTGAGATAGGG - Intronic
1006359872 6:33581373-33581395 TTTTTGTTGTTGTTGAGACAAGG - Intergenic
1006498616 6:34442436-34442458 ATTTTGTTTTTTTTGAGATAGGG + Intergenic
1006528824 6:34632073-34632095 ACTTTTTTGTTGTTTAAATATGG - Intronic
1006653730 6:35572333-35572355 AATTTATTATGGTTGAGATAGGG + Intergenic
1006855400 6:37129555-37129577 ATTTTTTTTTTGTAGAAATGAGG - Intergenic
1006958547 6:37901609-37901631 TTTTTGTTGTTATTGAAACATGG - Intronic
1007310592 6:40942968-40942990 ATTTTTTTATTTTTTAATTATGG - Intergenic
1007557211 6:42776352-42776374 ATTTTTTTATTTTTGAGACAGGG + Intronic
1007606572 6:43122134-43122156 TTTTTTTTCTTTTTGAAATAGGG - Intronic
1007636092 6:43300641-43300663 TTTTTATTATTTTTGAGATAAGG + Intronic
1007754195 6:44088253-44088275 TTGTTGTTGTTGTTGAGATAGGG + Intergenic
1007837696 6:44687027-44687049 ATTTTTTTATTTTTAAATTATGG + Intergenic
1008027100 6:46650686-46650708 ATTTAGTTTTTGTAGAAATGAGG + Intronic
1008670882 6:53767587-53767609 ATTTTACTATTGTTAAACTAAGG + Intergenic
1008810529 6:55492365-55492387 TTTTTGTTGTTGTTGGAAGAGGG + Intronic
1008811885 6:55512180-55512202 GTTTTTTTAGTGTTGAAAGATGG - Intronic
1008945699 6:57094487-57094509 TTTTTGTTAGTGGTGCAATAGGG + Intronic
1009280733 6:61747934-61747956 ATTTTGATATTATTTGAATAGGG + Intronic
1009299109 6:61992306-61992328 ATTTTCTTATGATTGAAAAATGG - Intronic
1009357672 6:62771596-62771618 ATTTTATTTTTGTAGAAACAGGG - Intergenic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1009597759 6:65757541-65757563 ATTTTTTTATTTTTAAATTATGG + Intergenic
1009607956 6:65897822-65897844 TTTTTGTTGTTTTTAAAATAGGG + Intergenic
1009609133 6:65916137-65916159 ATTTTTTTTTTTTAGAAATATGG - Intergenic
1009692170 6:67049420-67049442 TATTTGTTATTGATTAAATATGG - Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010291477 6:74142826-74142848 AGTTTGTTATTGTTTAGATGGGG + Intergenic
1010429511 6:75762891-75762913 ATTTTTTTTTTGTAGAGATAGGG + Intronic
1010657689 6:78531456-78531478 ATTTCATTATAGTTCAAATAAGG + Intergenic
1010758134 6:79691145-79691167 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1010815120 6:80349058-80349080 ATTTTCTTATTTTTGCAATATGG - Intergenic
1010875550 6:81100716-81100738 ATTTTATTTTTTTTGAGATAGGG - Intergenic
1010950807 6:82034881-82034903 CTGTTGTTGTTGTTGAGATAGGG + Intergenic
1010967873 6:82233363-82233385 CTTTTGTTATTTTTGAGATAGGG - Intronic
1011094574 6:83645672-83645694 ATTTTTTTTTTGTAGACATAGGG - Intronic
1011419671 6:87157691-87157713 ATTTATTTATTTTTGAGATATGG + Intronic
1011472109 6:87718256-87718278 ATTTCCTTATCTTTGAAATAGGG + Intergenic
1011528242 6:88290157-88290179 ATTTTTTTATTTTTGAGACAGGG - Intergenic
1011581794 6:88876354-88876376 TTTTTTTTGTTGTTGAGATAGGG - Intronic
1011646729 6:89465854-89465876 ATTTATTTATTTTTGAGATAGGG - Intronic
1011892654 6:92186126-92186148 GTTTTCTTATTTATGAAATAGGG + Intergenic
1012161551 6:95890872-95890894 ATTTTATTTTTGTAGAAACAGGG + Intergenic
1012213145 6:96549327-96549349 ATTTTGTTTCTATGGAAATAAGG - Intronic
1012260317 6:97081016-97081038 ATTTTGTTATTATTGAGTTATGG + Intronic
1012322767 6:97871428-97871450 TTTTAGTTATTCCTGAAATAAGG - Intergenic
1012324710 6:97902106-97902128 ATTGTGTTTTTGTAGAAAGAAGG + Intergenic
1012629531 6:101446403-101446425 ATTTTATTATCGTCGTAATAAGG - Intronic
1012829042 6:104183440-104183462 ATTTAGTTATTATTTCAATAAGG - Intergenic
1012906355 6:105070769-105070791 ATTTTATTTTTCTTGAGATAAGG - Intronic
1013072126 6:106738935-106738957 ATTTATTTATTTTTAAAATATGG + Intergenic
1013089650 6:106888545-106888567 GTTTTGTTATTGTTCAAATCAGG - Intergenic
1013127252 6:107196312-107196334 ACTTTGATATTGTCCAAATATGG + Intronic
1013433159 6:110074120-110074142 ATTTTATTTTTCTTGAAAAAAGG - Intergenic
1013434303 6:110086740-110086762 GTTTTGTTTTTGTAGAAACAAGG + Intergenic
1013544735 6:111145003-111145025 AATTAGTTTTTGTAGAAATAGGG + Intronic
1013568262 6:111391980-111392002 ATTTTGTTGTTGTTGAGACAAGG - Intronic
1013848610 6:114485815-114485837 TTTTTGTTATTTTGGAAATGGGG + Intergenic
1013905705 6:115215781-115215803 ATTTGTCTATTGTTGAAATTGGG - Intergenic
1013930838 6:115530655-115530677 ATTCTTTTATTGTTTAATTATGG + Intergenic
1014133298 6:117859583-117859605 ATTTTGTCCTAGCTGAAATATGG - Intergenic
1014186417 6:118439417-118439439 TTTTTTTTTTTGTAGAAATAGGG + Intergenic
1014242831 6:119036645-119036667 TTTTTGTTGTTGTTGAAGTATGG - Intronic
1014307173 6:119757450-119757472 AATTTGTTATTGTTTAGATGCGG + Intergenic
1014524696 6:122488604-122488626 ATTTTTTTTTTGTAGAAATGGGG + Intronic
1014713613 6:124838646-124838668 ATTTTCTTATTTTATAAATATGG - Intergenic
1014953116 6:127582834-127582856 ATTTTGTAATTATTGAGACATGG + Intronic
1014981644 6:127952515-127952537 ATTTATTTATTTTTGAGATATGG - Intergenic
1015235991 6:130971854-130971876 TATTTTTTAATGTTGAAATATGG - Intronic
1015329118 6:131956482-131956504 CTTTTTTTCTTTTTGAAATAGGG + Intergenic
1015568640 6:134599568-134599590 ATTTTGTTTTTATTGCAATAAGG - Intergenic
1015767081 6:136730169-136730191 TTTTTGTTTTTGTAGAAACAAGG + Intronic
1015776014 6:136814875-136814897 ATTTAATTAATTTTGAAATAGGG - Intergenic
1015786973 6:136928335-136928357 ATTTATTTATTTTTGAGATAAGG - Intergenic
1016512255 6:144856448-144856470 ATTTTAATATTTTTGAAAAATGG - Intergenic
1016632978 6:146253419-146253441 ATTTTATTGTTGATGAAAAATGG + Intronic
1016670242 6:146696398-146696420 ATTTTGAATTGGTTGAAATAAGG + Intronic
1016677289 6:146786074-146786096 TTTTTGTTATTGTTTAAGTCTGG - Intronic
1016865006 6:148757474-148757496 ATGATGTGATTTTTGAAATAGGG + Intronic
1016888373 6:148980895-148980917 ATTTTTTTTTTGTAGAAATGAGG + Intronic
1016921449 6:149298598-149298620 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1017267647 6:152468780-152468802 ATTTTTATTTTTTTGAAATAGGG + Intronic
1017414902 6:154209476-154209498 ATTTTTTTTTTGTGGAGATAGGG - Intronic
1017463320 6:154671669-154671691 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1017492382 6:154955858-154955880 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1017505974 6:155068922-155068944 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1017550775 6:155504791-155504813 GTTTTTTTATTTATGAAATATGG + Intergenic
1017781760 6:157720891-157720913 TTTTTGTTTTTGTAGAAACAAGG - Intronic
1018187769 6:161282022-161282044 ATTTTGTTTTTGTAGAGACAAGG + Intergenic
1018329689 6:162713981-162714003 ATTTTATTTTTATTGAATTACGG - Intronic
1018355354 6:163009140-163009162 ATTTTGTTGTTGTTGTCACATGG - Intronic
1018885364 6:167930814-167930836 ATTTTATTATAGGTGAAATAAGG + Intronic
1019795663 7:3046251-3046273 ATTTTATTATTTTTGAAACAGGG + Intergenic
1020181878 7:5928977-5928999 GTTTTTTTATTCTTGAAACATGG - Intronic
1020184688 7:5949983-5950005 TTTTTTTTCTTGTTGAGATAGGG - Intronic
1020225884 7:6279633-6279655 ATTTATTTATTTTTGAAACAGGG + Intergenic
1020268974 7:6580907-6580929 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1020298228 7:6774761-6774783 TTTTTTTTCTTGTTGAGATAGGG + Intronic
1020301057 7:6795964-6795986 GTTTTTTTATTCTTGAAACATGG + Intronic
1020301327 7:6797844-6797866 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1020340645 7:7105906-7105928 ATTTTGTCCTAGTTGAAATATGG + Intergenic
1020364507 7:7366316-7366338 ATTTTATTATTTCTGAAATTGGG - Intronic
1020377964 7:7509135-7509157 ATTTTGTTTTTTTTGAGACAGGG + Intronic
1020398108 7:7740981-7741003 CTTCTGTTAATGTTGAAATTAGG + Intronic
1020913590 7:14164175-14164197 ATTTTCTTACTGTTTACATATGG + Intronic
1020954612 7:14725557-14725579 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1021203030 7:17746645-17746667 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1021226382 7:18032477-18032499 TTTTTGTTATTGTTCAGATAAGG + Intergenic
1021277129 7:18665402-18665424 ATTTTGCTATTGTTTAAGTTAGG + Intronic
1021327054 7:19285600-19285622 TGTTTGTAATTGATGAAATATGG - Intergenic
1021437125 7:20631477-20631499 TTTGTGTTATTGGTGAAATCAGG + Intronic
1021454960 7:20819922-20819944 ATTTATTTATTTTTGAGATAGGG + Intergenic
1021461787 7:20896083-20896105 ATTTTTTTTTTTTTGACATAAGG + Intergenic
1021715433 7:23457454-23457476 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1021845043 7:24756352-24756374 TCTTTGTTATTGTTGAGAGAGGG - Intronic
1021959147 7:25854969-25854991 ATTTTTTTATTTTTAAAAAAGGG + Intergenic
1022139027 7:27476095-27476117 GTTTTGTTTTTTTTGAGATAGGG - Intergenic
1022367074 7:29731709-29731731 ATTTAATTCTTGTTAAAATATGG + Intergenic
1022566568 7:31409015-31409037 ATTTTATTATTGTTGTTGTATGG + Intergenic
1022573195 7:31473138-31473160 ATTTTCTTATTTTTGTAATGGGG - Intergenic
1022852024 7:34273544-34273566 ATTTTGTCACTGTTTTAATAGGG - Intergenic
1022950404 7:35332807-35332829 TTTTTTTTTTTTTTGAAATAAGG + Intergenic
1022994887 7:35744942-35744964 ATCTTAGAATTGTTGAAATATGG - Intergenic
1022994889 7:35744981-35745003 ATTTTGATATTTCTGAAATTGGG + Intergenic
1023246623 7:38211778-38211800 ATTTTCTTACTGATGAAAAAGGG - Intronic
1023322924 7:39019082-39019104 TTTTTGTTATTGTTGTTATTTGG + Intronic
1023378480 7:39582203-39582225 TTGTTGTCATTGTTGAGATAGGG + Intronic
1024289285 7:47789729-47789751 ATATTGTTATTTTTGAATGATGG - Intronic
1024436113 7:49356636-49356658 GTATTTTTATTGTTGAAATCTGG + Intergenic
1024743297 7:52378306-52378328 AGTTTGTCATTGTTGACATTTGG - Intergenic
1024808074 7:53171612-53171634 ATTATGTTTTTGTAGAAACATGG - Intergenic
1025082043 7:55992299-55992321 TTTTTGTTGTTGTTGAGATGGGG - Intronic
1025768514 7:64481876-64481898 ATTTTGGTTTTGGTGAATTATGG - Intergenic
1025769202 7:64488413-64488435 ATTTTGGTTTTGGTGAATTATGG - Intergenic
1025772124 7:64519315-64519337 ATTTTTTTATTTTTTAATTATGG - Intergenic
1025867324 7:65395916-65395938 ATTTATTTATTTTTGAGATAGGG + Intronic
1026060362 7:67020205-67020227 TTTTTGTTTTTGTGGAAACAGGG - Intronic
1026074241 7:67151811-67151833 TTGTTGTTGTTGTTGAGATAGGG + Intronic
1026244634 7:68608122-68608144 ATTTTGGTATGATTGAAATTAGG + Intergenic
1026684127 7:72493781-72493803 ATTGTGTTATTGCTGAGATAAGG + Intergenic
1026709949 7:72729006-72729028 ATTTTGTGATTTTTTAAAAATGG - Intronic
1027216083 7:76184967-76184989 TTTATTTTATTTTTGAAATAAGG + Intergenic
1027217067 7:76190595-76190617 GTTTTGTTTTTGTAGAAATGAGG - Intergenic
1027230996 7:76272387-76272409 ATTTTTTTTTTGTAGAGATAGGG - Intronic
1027415210 7:77967178-77967200 ATTTTTTTATTTTTGAGACAGGG + Intergenic
1027578329 7:79960030-79960052 GCTTTGTAATTTTTGAAATAGGG - Intergenic
1027686706 7:81287498-81287520 TTTTTTTTATTATTGAAACAAGG + Intergenic
1027799514 7:82734081-82734103 ATTTATTTATTTTTGAGATAGGG + Intergenic
1027858989 7:83551289-83551311 ATTTTGTTATTTTTCCAACATGG - Intronic
1027979056 7:85193831-85193853 TTGTTGTTATTGTTGAAAGATGG - Intergenic
1028004322 7:85543093-85543115 TTTTGTTTATTGTTGATATATGG + Intergenic
1028338885 7:89693705-89693727 ATTTTCTTTTTGTAGAAATGAGG - Intergenic
1028393661 7:90343952-90343974 ATTTTTTTAGTTTTGAAAAATGG + Intronic
1028394084 7:90348209-90348231 ATTTTCTTTTTTTTGAAACAGGG - Intronic
1028540226 7:91935024-91935046 ATTTTGATATGGTCAAAATATGG - Intergenic
1028756341 7:94439067-94439089 AATTTTTCATAGTTGAAATATGG + Intergenic
1028821154 7:95213494-95213516 ATTTTGTTTTAGTAGAAACAAGG + Intronic
1029253965 7:99256460-99256482 ATTTTATTTTTTTTGAGATAGGG - Intergenic
1029505661 7:100962409-100962431 TTTTTTTTATTGTTGAGATAGGG - Intronic
1029856327 7:103520702-103520724 AATTTCTTAATGTTGATATACGG + Intronic
1030052486 7:105551033-105551055 ATTTTTTTATTTTTGAGATAGGG + Intronic
1030564936 7:111141874-111141896 ATTTTGTTTTTGTAGAGACAGGG + Intronic
1030683553 7:112458769-112458791 ATTTTGTCATTGATCAAATTTGG + Intronic
1030745995 7:113167120-113167142 ATTTTGTTATTATTTAGGTATGG + Intergenic
1030870893 7:114755076-114755098 ATTTTATTTATTTTGAAATATGG + Intergenic
1030970152 7:116046141-116046163 TTTGGGTTAATGTTGAAATAAGG + Intronic
1031040283 7:116831989-116832011 TTTTTTTTATTTTTGAAACAGGG - Intronic
1031823271 7:126530984-126531006 TTTTTATTATTGTAGAGATAGGG + Intronic
1031825087 7:126554584-126554606 ATTTTAGTTTTTTTGAAATAGGG - Intronic
1031860495 7:126974513-126974535 ATTTTCTCATTTTTGAAATCTGG - Intronic
1031894846 7:127337067-127337089 TTGTTGTTATTGTTGAGACAGGG + Intergenic
1031994033 7:128216817-128216839 TTTTTGTTGTTGTTGATACAGGG - Intergenic
1032059580 7:128713298-128713320 TTTTTTTTCTTTTTGAAATAAGG - Intronic
1032140930 7:129329184-129329206 ATTTTGTTTTGTTTGAGATAGGG + Intronic
1032255421 7:130293271-130293293 ATTTGGTTATTTCAGAAATATGG + Intronic
1032357998 7:131228068-131228090 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1032358048 7:131228421-131228443 ATTTTTTAAATGTTGACATAAGG - Intronic
1032360972 7:131254349-131254371 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1032447266 7:131995121-131995143 TGTTTGTTTTTGTAGAAATAGGG - Intergenic
1032450381 7:132025402-132025424 ATTTTGTTATTTTTTAGAGATGG + Intergenic
1032566343 7:132950648-132950670 AATTTGTTATTTTTTAAAGAAGG + Intronic
1032605977 7:133354212-133354234 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1033028049 7:137796069-137796091 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1033064302 7:138138897-138138919 ATCTAGTTATAGTTTAAATATGG - Intergenic
1033104462 7:138507925-138507947 ATTTTTTTTTTTTTGAGATAGGG - Intronic
1033346625 7:140530215-140530237 ATTTTGTTGTTGTTGAGACAGGG - Intronic
1033475043 7:141683932-141683954 ATTTTTTTATTTTTTAAACAGGG + Intronic
1033733492 7:144200389-144200411 ATTTTTTTCTTTTTGAGATAGGG + Intergenic
1033749558 7:144350584-144350606 ATTTTTTTCTTTTTGAGATAGGG - Intergenic
1033794299 7:144829641-144829663 ATTTTCTCATTATTAAAATAGGG - Intronic
1033819707 7:145119926-145119948 ATTTTGTTCTTGTTTAATTGTGG + Intergenic
1033862633 7:145646146-145646168 TATTTGTTGTTGTTTAAATAAGG + Intergenic
1034254635 7:149717830-149717852 TTTTTGTTTTTCTTGAAACAGGG + Intronic
1034668194 7:152836578-152836600 CTTTTTTTTTTTTTGAAATAGGG - Intronic
1034915995 7:155039475-155039497 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1035216050 7:157367945-157367967 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1035345446 7:158194078-158194100 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1036066144 8:5383803-5383825 TTTTTGTTGCTGTTGAGATAGGG + Intergenic
1036115355 8:5953844-5953866 GTTTTGTTATTGCTAAAATTGGG - Intergenic
1036118814 8:5991924-5991946 ATTTTTTTATTTTTGAGATAGGG + Intergenic
1036235657 8:7037273-7037295 ATTTTTTTTTTTTTGAGATAGGG + Intergenic
1036375459 8:8195601-8195623 TTTTTGTTGTTGTCGAAACAGGG - Intergenic
1036444692 8:8811312-8811334 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1036493738 8:9250917-9250939 ATTTTGGTATTTTTTAGATACGG - Intergenic
1036565456 8:9934273-9934295 CTGTTGTTGTTGTAGAAATAGGG - Intergenic
1036720297 8:11168127-11168149 ATTTTGTTGCTGTTGAAAATGGG - Intronic
1036801245 8:11794354-11794376 ATTTTTTTATTTTTGAGACAAGG - Intergenic
1036854073 8:12227548-12227570 TTTTTGTTGTTGTCGAAACAGGG + Intergenic
1036875446 8:12470046-12470068 TTTTTGTTGTTGTCGAAACAGGG + Intergenic
1037024275 8:14013232-14013254 GTTTTGTTGTTGTAAAAATAAGG - Intergenic
1037409115 8:18575966-18575988 ATCTTGTTTTTGATAAAATATGG - Intronic
1037873511 8:22523142-22523164 TTTTTGTTTTTCTTGAGATATGG + Intronic
1038058159 8:23881803-23881825 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1038381896 8:27103372-27103394 ATTTATTTATTTTTGAGATAGGG - Intergenic
1038398358 8:27263795-27263817 TTTTTGTTGTTGTTGAGATGGGG - Intergenic
1038653632 8:29428621-29428643 TTTTTTTTGTTGTTGAAATGGGG + Intergenic
1038702043 8:29857818-29857840 ATTTTGTTTTTGTAGAGACAGGG - Intergenic
1038783728 8:30591475-30591497 ATTTTTTTACTGTAGAAACAGGG - Intronic
1039043921 8:33433302-33433324 ATTTAGTTTTTGTAGAGATAAGG - Intronic
1039068205 8:33627615-33627637 ATTTATTTATTTTTGAGATAGGG - Intergenic
1039091108 8:33830682-33830704 AGTTAGTTATTTTTGAGATAGGG - Intergenic
1039239999 8:35545894-35545916 CTTTATTTATTTTTGAAATAGGG + Intronic
1039345448 8:36699209-36699231 ATTTTTTTATTTTAGCAATATGG + Intergenic
1039505375 8:38048264-38048286 ATTTTTTTTTTTTTGAAACAGGG - Intronic
1039525054 8:38207272-38207294 ATTTTATTTTTGTAGAAACAGGG + Intronic
1039904909 8:41779423-41779445 ATTTTTTTTTTATTGAAATGAGG + Intronic
1040495899 8:47965461-47965483 ATTTTGTTGTTGTTGAGATGGGG - Intronic
1040676809 8:49760039-49760061 TTTTTTTTTTTTTTGAAATATGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041019661 8:53626040-53626062 ATTTTGTTTTTGTAGAGATGGGG - Intergenic
1041069003 8:54108164-54108186 TTTTTGTTTTTGTAGAAACAAGG - Intergenic
1041170522 8:55137579-55137601 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1041235348 8:55796120-55796142 ATTTTGCTTTTCTTGAAAAATGG - Exonic
1041351863 8:56955011-56955033 TTTTTGTTTTTGTTGAGACAAGG - Intergenic
1041359757 8:57040711-57040733 CTTTTTTTATTTTTGAGATAGGG - Intergenic
1041800394 8:61791702-61791724 ATTTTTTTATTTTTGAGACAAGG - Intergenic
1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG + Intergenic
1041863256 8:62538181-62538203 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1042067331 8:64892541-64892563 CTTTTGTTTTTGTAGAGATAAGG + Intergenic
1042109976 8:65370609-65370631 TTTTTGTTTTTGTTGAGACAGGG - Intergenic
1042123941 8:65518142-65518164 TTGTTGTTGTTGTTGAAATCTGG - Intergenic
1042388598 8:68206027-68206049 AGCTTGTGATTGTTGAATTATGG + Intronic
1042697100 8:71566814-71566836 ACTTTGTTTCTTTTGAAATATGG + Intronic
1042897306 8:73685313-73685335 ATTTTTTTATTTTTAAATTATGG - Intronic
1042957359 8:74265760-74265782 GTTTTGTTGTTGTTGAAGTGTGG - Intronic
1043125715 8:76391778-76391800 ATTTATTTATTTTTGTAATATGG - Intergenic
1043156524 8:76788019-76788041 ATTTTCTTATTTATAAAATAAGG - Intronic
1043219248 8:77637776-77637798 ATTGAGTTAATGATGAAATAAGG + Intergenic
1043290288 8:78590985-78591007 ATTTTGTAATAGTGGAAAAAGGG + Intronic
1043321526 8:78992958-78992980 TTTTTGTTGTTGTTGAGATATGG - Intergenic
1043386636 8:79755484-79755506 TTTTTGTTATGGATGAAACATGG - Intergenic
1043539196 8:81240255-81240277 ATTTTGTAAATGAAGAAATAAGG - Intergenic
1043580305 8:81704530-81704552 TTTTTTTTTTTTTTGAAATAGGG - Intronic
1043610187 8:82053529-82053551 ATTTTTCTATTTTTGTAATAAGG + Intergenic
1043723699 8:83581489-83581511 ATTATCTTATTGTAGAAATGAGG - Intergenic
1043763236 8:84096274-84096296 AAGTTGCCATTGTTGAAATAGGG + Intergenic
1043937047 8:86154634-86154656 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1044059430 8:87616086-87616108 ATTCTGTTATTATTATAATATGG - Intergenic
1044325840 8:90856487-90856509 TTTTTGTTATTGTTTAAAGAAGG - Intronic
1044674400 8:94715339-94715361 ATTTCTTTTTTTTTGAAATAGGG - Intergenic
1044823018 8:96170463-96170485 ATTTGGTATTTGTTTAAATATGG + Intergenic
1044947454 8:97403037-97403059 ATTTTTTTATTTTTTTAATATGG + Intergenic
1044996711 8:97844267-97844289 TTTTTGTTGTTGTTGAGATGGGG + Intronic
1045106404 8:98896966-98896988 ATTTTTTTATTTTTGAGACAGGG - Intronic
1045163834 8:99580675-99580697 AATTTTTTTTTGTTGAAATGGGG - Intronic
1045784572 8:105905159-105905181 ATTTTGTTATTATTGAGAAGAGG - Intergenic
1045815916 8:106275755-106275777 ATGTTGTTCTTGTTGAATTCAGG + Intronic
1045878780 8:107014051-107014073 ATTTATTTATTTTTGAAACAGGG - Intergenic
1046126275 8:109912909-109912931 ATTTATTTATTTTTGAGATAGGG + Intergenic
1046165258 8:110425443-110425465 ATTTTCTTATTGGTAAATTAAGG - Intergenic
1046418896 8:113952910-113952932 TTTTTGTTGTTGTTGAGATAGGG + Intergenic
1046476786 8:114755778-114755800 TTTTTATTATTGTAGAGATAGGG + Intergenic
1046535614 8:115505235-115505257 ATTTTGTTATATTTCAAACATGG - Intronic
1046671478 8:117061568-117061590 ATTTTGGTATTATTTAAAGATGG - Intronic
1046747731 8:117894209-117894231 TTTTTGTTGTTGTTGAGATGAGG + Intronic
1046935507 8:119881896-119881918 ATTTATTTATTTTTGAGATAGGG + Intronic
1047284671 8:123477469-123477491 ATTTTTTTTTTCTTGAAACAGGG + Intergenic
1047288133 8:123506049-123506071 TTATTGTTTTTGTAGAAATAGGG - Intronic
1047429553 8:124779246-124779268 TTTTTGTTTTTTTTGAGATAGGG - Intergenic
1047671326 8:127150250-127150272 ATTTTCTTATCTTGGAAATATGG - Intergenic
1047875685 8:129135035-129135057 ATTTTCTTATTTTTGAAATGGGG + Intergenic
1048058900 8:130896977-130896999 GTTTTGCTATTGTTCAAATGAGG + Intronic
1048675811 8:136778502-136778524 ATTTTATTATTGAAGTAATACGG + Intergenic
1049132527 8:140860479-140860501 ATTTTGTTTTTGTTGAGACAGGG + Intronic
1050360174 9:4822643-4822665 ATTTTATTTTTGTAGAGATAGGG - Intronic
1050472012 9:6003100-6003122 ATATTGTTACTGTTAAAAAATGG - Intronic
1050543810 9:6692682-6692704 ATTTTGTCTTAGCTGAAATATGG - Intergenic
1050550357 9:6743918-6743940 TTTTTTTTTTTTTTGAAATAAGG + Intronic
1050950559 9:11585940-11585962 ATTTTGGTTTTGTTGAAAACTGG - Intergenic
1050989362 9:12129058-12129080 ATTTTGATATGGATTAAATAAGG + Intergenic
1051100838 9:13519172-13519194 ATTTTGTTGTTTTTGGAATGAGG + Intergenic
1051288565 9:15521913-15521935 ATTTTGTTTGTTTTGAAACAGGG - Intergenic
1051294432 9:15580706-15580728 ATTTTTTTATTTTTAAATTATGG - Intronic
1051462667 9:17339979-17340001 ATTTTATTTTTGTAGAAACAGGG - Intronic
1051470402 9:17433632-17433654 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1051565988 9:18498790-18498812 ATTTTCTTATTTGTAAAATAAGG + Intronic
1051654777 9:19368975-19368997 ATTTTATTTTTGTAGAGATAGGG - Intronic
1051705013 9:19868986-19869008 TTTTTGTTGTTGTTGAGACATGG + Intergenic
1051735057 9:20189471-20189493 TTTTTGTTATTGTTGGTTTATGG + Intergenic
1051939544 9:22489022-22489044 ATTTTTTTATTTGTGAAATAAGG + Intergenic
1052233427 9:26182527-26182549 TTTTTTTTTTTTTTGAAATAAGG - Intergenic
1052388834 9:27854875-27854897 ATTTATTTATTTTTGAAATGGGG + Intergenic
1052670348 9:31549174-31549196 TTTTTTTTTTTTTTGAAATACGG - Intergenic
1052876074 9:33565469-33565491 ATTTTGTGTTTTTTGAGATATGG + Intronic
1053098649 9:35350974-35350996 ATTTTGTGAAAGTTCAAATAAGG + Intronic
1053162570 9:35823836-35823858 ATTTTATTTTTGTAGAGATAGGG + Intronic
1053354676 9:37435712-37435734 ATTTTATCATTATTGTAATAGGG - Intronic
1053509633 9:38676892-38676914 TTGTTGTTATTGTTGAGATAGGG + Intergenic
1053673966 9:40402746-40402768 AGATTGGTGTTGTTGAAATAAGG - Intergenic
1053752249 9:41268536-41268558 TTTTTGTATTTGGTGAAATATGG + Intergenic
1053923767 9:43029112-43029134 AGATTGATGTTGTTGAAATAAGG - Intergenic
1054257775 9:62832868-62832890 TTTTTGTATTTGGTGAAATATGG + Intergenic
1054360082 9:64104356-64104378 AATTTGTTTTTATTCAAATATGG - Intergenic
1054385068 9:64542812-64542834 AGATTGGTGTTGTTGAAATAAGG - Intergenic
1054510661 9:65973544-65973566 AGATTGGTGTTGTTGAAATAAGG + Intergenic
1054702123 9:68423391-68423413 ATTTTTTTATTTTTGGATTATGG + Intronic
1054794998 9:69292989-69293011 ATTTTATTATCTTTGAAATGAGG - Intergenic
1055009122 9:71544267-71544289 ATTTATTTATTTTTGAAACAGGG - Intergenic
1055034035 9:71798986-71799008 TTTTTGTTGTTGTTGAGATGGGG - Intronic
1055259564 9:74417212-74417234 ATTTTATTGTTTTTCAAATAAGG - Intergenic
1055293956 9:74814939-74814961 ATTTATTTATTTTTGAGATAGGG - Intronic
1055489875 9:76794043-76794065 TTTTTTTTATTGTTTTAATAAGG + Intronic
1055637421 9:78292702-78292724 ATTTTTTTTTTGTAGAGATAGGG - Intergenic
1055723491 9:79201608-79201630 ATTTAGTAATTCTTGAAAGAGGG + Intergenic
1055777253 9:79779622-79779644 ATTTTTTTATAGTGCAAATAGGG - Intergenic
1055824703 9:80309390-80309412 ATTTTGTTCTAGCTGAATTATGG - Intergenic
1055845697 9:80559936-80559958 ATTTTTTTTCTGCTGAAATAAGG - Intergenic
1055852285 9:80646132-80646154 GTTTTCTTATTTTTGAAACAAGG - Intergenic
1055947086 9:81701359-81701381 GTTTTGTTTTTGTAGACATAGGG + Intergenic
1055949348 9:81716329-81716351 CTTTTGTTGTTGTTGAGACAGGG + Intergenic
1055987582 9:82067394-82067416 ATTTTGATATTGTTGTTTTAAGG + Intergenic
1056057254 9:82839137-82839159 ATATTTTTTTTTTTGAAATAAGG - Intergenic
1056121721 9:83494730-83494752 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1056313570 9:85367416-85367438 ATTTTGATATTCTTGAAGTCTGG - Intergenic
1056350811 9:85746869-85746891 ATTTTGTTTTTTTTGAGACAGGG + Intergenic
1056594790 9:87998216-87998238 TTTTTTTTTTTGTTTAAATATGG + Intergenic
1056878735 9:90367072-90367094 ATTTTGTTCTATTTTAAATATGG + Intergenic
1056900191 9:90591996-90592018 GTTTTCTCCTTGTTGAAATAGGG + Intergenic
1056911470 9:90704742-90704764 ATTTTTTTATTTGTAAAATAAGG - Intergenic
1056939979 9:90946754-90946776 ATTTTTTTTTTGTAGAGATAGGG - Intergenic
1057113172 9:92493760-92493782 ATTTTATAATTTTTAAAATATGG - Intronic
1057344963 9:94241658-94241680 ATTTATTTATTTTTGAGATAGGG - Intergenic
1057373755 9:94498882-94498904 TTTTTTTTTTTGTAGAAATAGGG - Intergenic
1057533343 9:95874870-95874892 TTTTGGTTATTGTGGCAATAGGG + Intergenic
1057632385 9:96730704-96730726 TTTTTTTTGTTGTTGAAACAGGG + Intergenic
1057831649 9:98411740-98411762 ATTTATTTGTTGTTGAGATAGGG + Intronic
1057923282 9:99117549-99117571 TTTTTATTATTTTTAAAATACGG + Intronic
1057940965 9:99283991-99284013 ATTTTTTTTTTTTTTAAATAAGG + Intergenic
1058396594 9:104560664-104560686 ATTTTTTTATTTTTAAATTATGG - Intergenic
1058548321 9:106085307-106085329 ATTTTGTTAGTCTTGCAGTAAGG + Intergenic
1058795703 9:108496364-108496386 ATTTTGTATTTGCTGAAATTGGG + Intergenic
1058847398 9:108974810-108974832 ATTTTCTTATTTTTGAGATGGGG - Intronic
1058890093 9:109354204-109354226 TTTTTGTTGTTGTTGAGATGGGG + Intergenic
1059047635 9:110886799-110886821 AATTTATTATTTTTTAAATAAGG - Intronic
1059131310 9:111753038-111753060 CTTTTTTTATTGTTGAGACAGGG - Intronic
1059183928 9:112247257-112247279 ATTTATTTATTATTGAAACAGGG - Intronic
1059476064 9:114548686-114548708 TTGTTGTTGTTGTTGAGATAGGG - Intergenic
1059481419 9:114593669-114593691 TTTTTGTTTTTGTAGAGATAGGG + Intronic
1059597571 9:115739220-115739242 CATTTGTTTTTGTTAAAATAGGG + Intergenic
1060319480 9:122543204-122543226 TTTTTGTTATTGTTTAGACAGGG + Intergenic
1060458072 9:123819528-123819550 ATTTTTTTATTTTTGAGACAGGG + Intronic
1060504496 9:124187719-124187741 ATTTTCTTATTTTTGAGACAGGG + Intergenic
1060954240 9:127626827-127626849 ATTTTGTTATTTTAGAGACAAGG + Intronic
1061076841 9:128346693-128346715 ATTTTGTTTTTTTTGAGACAGGG - Intronic
1061145406 9:128795055-128795077 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1061175178 9:128991169-128991191 TTTTTTTTTTTTTTGAAATAGGG + Intronic
1061176015 9:128997665-128997687 TTTTTGTTGTTGTTGAGATAGGG + Intronic
1061497747 9:130985283-130985305 ACTTTGTTATTGTTGAGACAGGG + Intergenic
1061638523 9:131931236-131931258 ATTTATTTATTTTTGAGATAAGG - Intronic
1061720885 9:132550686-132550708 ATTTTTTTTTTGTAGAAACAGGG + Intronic
1061764422 9:132872638-132872660 ATTTTTTTTTTTTTGAGATAGGG + Intronic
1061965444 9:134011361-134011383 ATTTTGTTTTTGTAGATACAGGG - Intergenic
1062310782 9:135935471-135935493 TTTTTGTTGTTGTTGAGATGGGG - Intronic
1062506443 9:136879970-136879992 ATTTTTTTATTTTTGAGACAGGG + Intronic
1202800988 9_KI270719v1_random:175475-175497 TTTTTGTATTTGGTGAAATATGG - Intergenic
1203694537 Un_GL000214v1:85033-85055 AATTTGTTTTTATTCAAATATGG + Intergenic
1203705015 Un_KI270742v1:32399-32421 AATTTGTTTTTATTCAAATATGG - Intergenic
1203558991 Un_KI270744v1:33412-33434 AATTTGTTTTTATTCAAATATGG + Intergenic
1203585181 Un_KI270746v1:61960-61982 TTTTTGTTTTTGTAGAGATAGGG + Intergenic
1203617381 Un_KI270749v1:79808-79830 ATTTTCTTATAGTTGACATATGG - Intergenic
1203641736 Un_KI270751v1:19030-19052 AATTTGTTTTTATTCAAATATGG - Intergenic
1185835605 X:3344210-3344232 ATTTTATTATTTTTTAATTATGG - Intronic
1185862108 X:3589275-3589297 ATTTATTTATTTTTGAGATAGGG - Intergenic
1185972409 X:4680130-4680152 ATTTTTTATTTGTAGAAATAGGG + Intergenic
1186242006 X:7578809-7578831 ATTTTGCCATGGTTAAAATAGGG + Intergenic
1186410972 X:9344112-9344134 TTTTTTTTTTTGTTGAGATAGGG - Intergenic
1186688677 X:11952027-11952049 ATTTATTTATTTTTGAAACAGGG - Intergenic
1186821679 X:13294750-13294772 ATTTATTTATTTTTGAGATAGGG + Intergenic
1186831481 X:13394744-13394766 AGTTTATTATTATTCAAATATGG + Intergenic
1186853698 X:13605398-13605420 ATTTTTTTTTTGTAGAAATGGGG - Intronic
1186894316 X:13990740-13990762 TTTTTGTTTTTGTTGAGACAGGG + Intergenic
1186944553 X:14551081-14551103 ATTTTGTAATCTGTGAAATAGGG - Intronic
1187188792 X:17013188-17013210 AGTTTGTTGTTGTTGGAAGAGGG - Intronic
1187322212 X:18250097-18250119 ATTTTTTTTTTGTTGAAAACTGG - Intronic
1187544588 X:20235756-20235778 ATTTTGGTTTTTTTAAAATATGG - Intronic
1187601353 X:20834548-20834570 ATATAGTAATTCTTGAAATAGGG + Intergenic
1187753247 X:22490834-22490856 TTTTTGTTGTTGTTGCAATGGGG + Intergenic
1187909166 X:24094503-24094525 TTTTTTTTTTTTTTGAAATAGGG + Intergenic
1187924459 X:24237397-24237419 TTTTTTTTTTTGTTAAAATAAGG + Intergenic
1187943835 X:24407544-24407566 ATTTTTTTAATGTTGATAAATGG - Intergenic
1188126173 X:26372479-26372501 ATTTTTGTATTGCTGAAATTAGG - Intergenic
1188188059 X:27140459-27140481 ATTTTGTTGTTGTAGAGACAGGG + Intergenic
1188227717 X:27621983-27622005 TTGTTGTTGTTGTTGAGATAAGG - Intronic
1188357994 X:29216194-29216216 TTTTTGTTTTTGTTGAGACAGGG + Intronic
1188376229 X:29432044-29432066 ATTTTTTTATTGTTGTCCTATGG - Intronic
1188377764 X:29453828-29453850 AATGTTTTATAGTTGAAATATGG - Intronic
1188409158 X:29850134-29850156 ATTTTCTTCTTCTTCAAATAAGG + Intronic
1189312636 X:40030732-40030754 ATTTTATTTTTTTTGAGATAGGG - Intergenic
1189313883 X:40039988-40040010 TTTTTGTTGTTGTTGAGATGGGG + Intergenic
1189529382 X:41863627-41863649 ATTTTGTTATTTTCTAAATGTGG + Intronic
1189625864 X:42895933-42895955 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1189699346 X:43700807-43700829 TTTTTGTTATTTTTAAAATCAGG - Intronic
1189797502 X:44659475-44659497 ATTTTGGTATAGTACAAATAGGG - Intergenic
1189807785 X:44752650-44752672 ATTTTGTTTTTTTTGAGATCAGG - Intergenic
1189823859 X:44897743-44897765 TTTTTGTTTTTTTTGAGATAGGG + Intronic
1190042364 X:47081552-47081574 GTTTTGTTTTTGTTGAGACAGGG + Intronic
1190547911 X:51548909-51548931 ATTTTTTTATTGCTTATATATGG + Intergenic
1190631701 X:52393475-52393497 ATTTTTTTATTTTTAAATTATGG + Intergenic
1190742247 X:53297005-53297027 ATTTTTTTTTTTTTGAGATAAGG + Intronic
1190830661 X:54056438-54056460 ATTTTGCTTTTGTAGAAACAGGG + Intergenic
1191697934 X:64008379-64008401 ATTTTGTTTTTTTTGAGATGGGG + Intergenic
1191911800 X:66159818-66159840 ATTTTGTTATTTGTAAAATCAGG - Intergenic
1192105063 X:68307447-68307469 TTTTTTTTTTTGTTGACATAGGG - Intronic
1193007036 X:76631443-76631465 AATTTGTAATTGCAGAAATATGG - Intergenic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1193671688 X:84395432-84395454 ATTTTGCTATTAGTGAAATGCGG + Intronic
1193716186 X:84937075-84937097 ATTTTGTTTTTGTTGAGATGGGG - Intergenic
1194000098 X:88417716-88417738 ATTTTGTTATTCTTGGCATTTGG + Intergenic
1194075330 X:89384939-89384961 ATTTTTTTATTTTTAAATTATGG + Intergenic
1194075512 X:89386945-89386967 ATTTATTTATTGTTGAGACAGGG + Intergenic
1194113174 X:89863131-89863153 TTTTTGTTATTTTTGCATTAAGG + Intergenic
1194125977 X:90017291-90017313 ATTTTTTTATTTTTAAATTATGG - Intergenic
1194319035 X:92420202-92420224 TTTTTGTTATAGTTGTCATATGG + Intronic
1194533986 X:95083815-95083837 ATTTTGTCCTAGCTGAAATAAGG - Intergenic
1194649334 X:96497190-96497212 TTTTTGTTGTTGTTGTAAGAAGG - Intergenic
1195137934 X:101929892-101929914 GTTTTGACATTTTTGAAATAAGG - Intronic
1195312012 X:103640862-103640884 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1195315698 X:103675438-103675460 TTCTGGTTATTGTAGAAATAAGG - Intergenic
1195336992 X:103865122-103865144 ATTTTGTTAATGTTTATAAAAGG + Intergenic
1195400227 X:104453644-104453666 TTTTTTTTTTTGTTGAGATAGGG + Intergenic
1195526502 X:105896665-105896687 ATTTTTTTTTTGTAGAGATAGGG - Intronic
1195657015 X:107341428-107341450 ATTTTATTATTGTGGAAGAAGGG + Intergenic
1195713635 X:107796706-107796728 ATTTACTTATTTTTGAAATAGGG - Intergenic
1196069063 X:111499296-111499318 ATTTTATTTTTGTAGAGATAGGG + Intergenic
1196133254 X:112180467-112180489 ATTTTGCATTTTTTGAAATAAGG + Intergenic
1196328529 X:114438387-114438409 ATTTCCTTATTTTTGAATTATGG + Intergenic
1196385913 X:115150551-115150573 AATTTTTTGTTGTTGAGATAAGG + Intronic
1196398619 X:115291100-115291122 AGTTAGTTATTTTTGAGATAAGG + Intronic
1196627553 X:117893909-117893931 ATTTCCTTATTGTTAAAATTTGG + Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1196851740 X:119944656-119944678 ATTTTTTTATTTTTGAGACAAGG + Intergenic
1197145062 X:123162726-123162748 ATTTTTTTATTTTTTAATTATGG + Intergenic
1197225512 X:123952424-123952446 GTTTTGTTTTTGTAGAAACAGGG - Intergenic
1197441828 X:126500813-126500835 ATTTTGTAATTGAAAAAATATGG - Intergenic
1197483586 X:127018681-127018703 ATTTTGTTATTATTTTACTAAGG + Intergenic
1198035111 X:132794398-132794420 ATTTATTTATTTTTGAAATAGGG + Intronic
1198055533 X:132991178-132991200 TTTTTGTTATAGTTCAGATAAGG - Intergenic
1198083877 X:133264963-133264985 TTGTTGTTGTTGTTGAGATACGG - Intergenic
1198133179 X:133720032-133720054 ATTTTTTTATTTTTAAATTATGG - Intronic
1198592297 X:138197740-138197762 TTTTTTTTATTTTTGAGATAGGG + Intergenic
1198855182 X:141008084-141008106 ATTTTGTCATTGACTAAATATGG + Intergenic
1198907509 X:141579285-141579307 ATTTTGTCATTGACTAAATATGG - Intergenic
1199155468 X:144541936-144541958 ATTTTCTTGTTTTTGAAATCTGG - Intergenic
1199199104 X:145066511-145066533 ATATTGTTTTTGTGGAGATAAGG - Intergenic
1199377421 X:147130225-147130247 ATTTTGTCCTAGCTGAAATATGG + Intergenic
1199481916 X:148307265-148307287 TTTTTGTTTTTGTAGAAATGAGG - Intergenic
1200332121 X:155309298-155309320 ATTTTTTTATTTTTGAGACAGGG - Intronic
1200439727 Y:3197388-3197410 TTTTTTTTACTGTTAAAATAAGG + Intergenic
1200465859 Y:3518187-3518209 TTTTTGTTATTTTTGCATTAAGG + Intergenic
1200627170 Y:5533353-5533375 TTTTTGTTATAGTTGTCATATGG + Intronic
1200730929 Y:6739099-6739121 ATTTTTTTATTTTTAAATTATGG + Intergenic
1200731114 Y:6741106-6741128 ATTTATTTATTGTTGAGACATGG + Intergenic
1200785413 Y:7256339-7256361 TTTTTTTTTTTTTTGAAATAGGG - Intergenic
1200972536 Y:9169307-9169329 ATTTTGTTAACGCTGAAAAAGGG + Intergenic
1200977089 Y:9224388-9224410 ATTTTGTTGGTGTTGAAAAGAGG - Intergenic
1201282051 Y:12350747-12350769 TTTTTTTTTTTGTAGAAATAGGG + Intergenic
1201362569 Y:13168912-13168934 ATTTTGTCCTAGCTGAAATACGG + Intergenic
1201727680 Y:17171336-17171358 GTTTTGTTAACATTGAAATATGG + Intergenic
1202138484 Y:21694944-21694966 ATTTTGTTAACGCTGAAAAAGGG - Intergenic
1202371362 Y:24198836-24198858 TTTTTGTAATTTTTAAAATATGG - Intergenic
1202499423 Y:25471279-25471301 TTTTTGTAATTTTTAAAATATGG + Intergenic