ID: 1009504765

View in Genome Browser
Species Human (GRCh38)
Location 6:64463069-64463091
Sequence ACCTGTAGTCCCAGCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712848
Summary {0: 583, 1: 17277, 2: 102488, 3: 246237, 4: 346263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504765_1009504767 -5 Left 1009504765 6:64463069-64463091 CCCAAGCAGCTGGGACTACAGGT 0: 583
1: 17277
2: 102488
3: 246237
4: 346263
Right 1009504767 6:64463087-64463109 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1009504765_1009504772 10 Left 1009504765 6:64463069-64463091 CCCAAGCAGCTGGGACTACAGGT 0: 583
1: 17277
2: 102488
3: 246237
4: 346263
Right 1009504772 6:64463102-64463124 ACGCCCGGCTATTTATTTTTTGG 0: 1
1: 0
2: 11
3: 70
4: 249
1009504765_1009504775 29 Left 1009504765 6:64463069-64463091 CCCAAGCAGCTGGGACTACAGGT 0: 583
1: 17277
2: 102488
3: 246237
4: 346263
Right 1009504775 6:64463121-64463143 TTGGATTTTTTTACTAGAGATGG 0: 1
1: 28
2: 2637
3: 3484
4: 32528
1009504765_1009504776 30 Left 1009504765 6:64463069-64463091 CCCAAGCAGCTGGGACTACAGGT 0: 583
1: 17277
2: 102488
3: 246237
4: 346263
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504765 Original CRISPR ACCTGTAGTCCCAGCTGCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr