ID: 1009504766

View in Genome Browser
Species Human (GRCh38)
Location 6:64463070-64463092
Sequence CACCTGTAGTCCCAGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501680
Summary {0: 1087, 1: 31141, 2: 104881, 3: 134318, 4: 230253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504766_1009504775 28 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504775 6:64463121-64463143 TTGGATTTTTTTACTAGAGATGG 0: 1
1: 28
2: 2637
3: 3484
4: 32528
1009504766_1009504772 9 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504772 6:64463102-64463124 ACGCCCGGCTATTTATTTTTTGG 0: 1
1: 0
2: 11
3: 70
4: 249
1009504766_1009504767 -6 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504767 6:64463087-64463109 CAGGTGCCCGCCACCACGCCCGG 0: 3715
1: 23283
2: 55735
3: 78440
4: 119144
1009504766_1009504777 30 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504777 6:64463123-64463145 GGATTTTTTTACTAGAGATGGGG 0: 1
1: 11
2: 996
3: 3609
4: 20704
1009504766_1009504776 29 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504766 Original CRISPR CACCTGTAGTCCCAGCTGCT TGG (reversed) Intronic
Too many off-targets to display for this crispr