ID: 1009504769

View in Genome Browser
Species Human (GRCh38)
Location 6:64463094-64463116
Sequence TAAATAGCCGGGCGTGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143223
Summary {0: 7, 1: 367, 2: 17057, 3: 56944, 4: 68848}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504769_1009504779 29 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504779 6:64463146-64463168 TTTCACCGTGTTAGCCAGGATGG 0: 36207
1: 56771
2: 52842
3: 130583
4: 161287
1009504769_1009504776 5 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504769_1009504778 25 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504778 6:64463142-64463164 GGGGTTTCACCGTGTTAGCCAGG 0: 28592
1: 58630
2: 110316
3: 159901
4: 157923
1009504769_1009504775 4 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504775 6:64463121-64463143 TTGGATTTTTTTACTAGAGATGG 0: 1
1: 28
2: 2637
3: 3484
4: 32528
1009504769_1009504777 6 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504777 6:64463123-64463145 GGATTTTTTTACTAGAGATGGGG 0: 1
1: 11
2: 996
3: 3609
4: 20704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504769 Original CRISPR TAAATAGCCGGGCGTGGTGG CGG (reversed) Intronic
Too many off-targets to display for this crispr