ID: 1009504771

View in Genome Browser
Species Human (GRCh38)
Location 6:64463100-64463122
Sequence AAAAAATAAATAGCCGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103635
Summary {0: 5, 1: 208, 2: 3829, 3: 20031, 4: 79562}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504771_1009504776 -1 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504771_1009504779 23 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504779 6:64463146-64463168 TTTCACCGTGTTAGCCAGGATGG 0: 36207
1: 56771
2: 52842
3: 130583
4: 161287
1009504771_1009504775 -2 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504775 6:64463121-64463143 TTGGATTTTTTTACTAGAGATGG 0: 1
1: 28
2: 2637
3: 3484
4: 32528
1009504771_1009504777 0 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504777 6:64463123-64463145 GGATTTTTTTACTAGAGATGGGG 0: 1
1: 11
2: 996
3: 3609
4: 20704
1009504771_1009504778 19 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504778 6:64463142-64463164 GGGGTTTCACCGTGTTAGCCAGG 0: 28592
1: 58630
2: 110316
3: 159901
4: 157923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504771 Original CRISPR AAAAAATAAATAGCCGGGCG TGG (reversed) Intronic
Too many off-targets to display for this crispr