ID: 1009504773

View in Genome Browser
Species Human (GRCh38)
Location 6:64463105-64463127
Sequence AATCCAAAAAATAAATAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8665
Summary {0: 1, 1: 3, 2: 153, 3: 2669, 4: 5839}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504773_1009504776 -6 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504773_1009504777 -5 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504777 6:64463123-64463145 GGATTTTTTTACTAGAGATGGGG 0: 1
1: 11
2: 996
3: 3609
4: 20704
1009504773_1009504775 -7 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504775 6:64463121-64463143 TTGGATTTTTTTACTAGAGATGG 0: 1
1: 28
2: 2637
3: 3484
4: 32528
1009504773_1009504778 14 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504778 6:64463142-64463164 GGGGTTTCACCGTGTTAGCCAGG 0: 28592
1: 58630
2: 110316
3: 159901
4: 157923
1009504773_1009504779 18 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504779 6:64463146-64463168 TTTCACCGTGTTAGCCAGGATGG 0: 36207
1: 56771
2: 52842
3: 130583
4: 161287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504773 Original CRISPR AATCCAAAAAATAAATAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr