ID: 1009504776

View in Genome Browser
Species Human (GRCh38)
Location 6:64463122-64463144
Sequence TGGATTTTTTTACTAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009504769_1009504776 5 Left 1009504769 6:64463094-64463116 CCGCCACCACGCCCGGCTATTTA 0: 7
1: 367
2: 17057
3: 56944
4: 68848
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504773_1009504776 -6 Left 1009504773 6:64463105-64463127 CCCGGCTATTTATTTTTTGGATT 0: 1
1: 3
2: 153
3: 2669
4: 5839
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504765_1009504776 30 Left 1009504765 6:64463069-64463091 CCCAAGCAGCTGGGACTACAGGT 0: 583
1: 17277
2: 102488
3: 246237
4: 346263
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504774_1009504776 -7 Left 1009504774 6:64463106-64463128 CCGGCTATTTATTTTTTGGATTT 0: 1
1: 5
2: 146
3: 2572
4: 4861
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504766_1009504776 29 Left 1009504766 6:64463070-64463092 CCAAGCAGCTGGGACTACAGGTG 0: 1087
1: 31141
2: 104881
3: 134318
4: 230253
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504770_1009504776 2 Left 1009504770 6:64463097-64463119 CCACCACGCCCGGCTATTTATTT 0: 10
1: 548
2: 22137
3: 88200
4: 188697
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504768_1009504776 6 Left 1009504768 6:64463093-64463115 CCCGCCACCACGCCCGGCTATTT 0: 321
1: 16490
2: 60070
3: 84991
4: 68699
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data
1009504771_1009504776 -1 Left 1009504771 6:64463100-64463122 CCACGCCCGGCTATTTATTTTTT 0: 5
1: 208
2: 3829
3: 20031
4: 79562
Right 1009504776 6:64463122-64463144 TGGATTTTTTTACTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009504776 Original CRISPR TGGATTTTTTTACTAGAGAT GGG Intronic
No off target data available for this crispr