ID: 1009511159

View in Genome Browser
Species Human (GRCh38)
Location 6:64551495-64551517
Sequence GAGGGGTCTCTTCAGTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 9, 3: 47, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009511159_1009511164 21 Left 1009511159 6:64551495-64551517 CCAATCAACTGAAGAGACCCCTC 0: 1
1: 0
2: 9
3: 47
4: 255
Right 1009511164 6:64551539-64551561 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009511159 Original CRISPR GAGGGGTCTCTTCAGTTGAT TGG (reversed) Intronic
900290427 1:1921412-1921434 GAGGGGTCTTCTCTGTTGAAGGG + Intergenic
900813311 1:4824756-4824778 GGGGTGTCTATTCAGTTGGTTGG + Intergenic
900875482 1:5339724-5339746 GAGGTGTCTCTACAGGTGACTGG + Intergenic
900944734 1:5823591-5823613 GAGGGGTCCATTCAGATGGTTGG - Intergenic
902541789 1:17160916-17160938 GAGGAGTCCATTCAGTTGGTTGG + Intergenic
902739262 1:18423453-18423475 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
904456375 1:30650602-30650624 GAGGGGTCTCTGCTGCTGATGGG - Intergenic
905316966 1:37088678-37088700 GGGGGTTCTCTTCAGCTGAGGGG + Intergenic
908092534 1:60701129-60701151 GAGGGGTCCATTCAGATGGTTGG + Intergenic
908326893 1:63031843-63031865 GAGGGGTCCATTCAGATGCTTGG + Intergenic
908662064 1:66447615-66447637 GAGGGGTCCATTGAGTTGGTTGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909474189 1:76063479-76063501 GAGGGGTGTATTCAATTGGTCGG + Intergenic
909760207 1:79276982-79277004 GAGGGGTCCATTCAATTGGTTGG - Intergenic
911646110 1:100338552-100338574 GAGGGGTCCATTCAGTTTGTTGG + Intergenic
912346233 1:108965769-108965791 GATGGGCCTATTCAGTTGGTTGG - Intergenic
912388596 1:109285766-109285788 AAGGGGTCCATTCAGTTGGTTGG - Intergenic
913281059 1:117185474-117185496 GAGGGGTCCATTCAGGTGGTTGG - Intronic
913486351 1:119335387-119335409 CAGGTGTCTTATCAGTTGATTGG + Intergenic
917150858 1:171943275-171943297 GAGGGGTCTATTCAAATGGTTGG - Intronic
917458420 1:175205724-175205746 GAGGGGTCTGTTCAGATGACTGG + Intergenic
917530961 1:175834659-175834681 AGGGGGTCTGTTCAGTTGGTAGG - Intergenic
919358741 1:196562458-196562480 GAGGGGTCCATTCAGATGATTGG + Intronic
920940014 1:210473427-210473449 GAGGGGTCCATTCAGTTGATTGG + Intronic
922892118 1:229070101-229070123 GAGGGGTTGCTTTATTTGATTGG + Intergenic
923067119 1:230528126-230528148 AAGGAGTCCATTCAGTTGATTGG + Intergenic
924573171 1:245256595-245256617 GAGAGGTCCATTCAGTTGGTTGG - Intronic
924924554 1:248666264-248666286 GGGGGATCCATTCAGTTGATTGG + Intergenic
924938287 1:248790736-248790758 GAGGGGTCTGTTCAGTTGGTTGG + Intergenic
1063282362 10:4644388-4644410 GAGGGGTCTATTCAGATGGCTGG - Intergenic
1064951617 10:20857353-20857375 GATAGTTGTCTTCAGTTGATGGG - Intronic
1065265443 10:23970720-23970742 GAGGGGTCTATTCAGTTGGTTGG - Intronic
1065490276 10:26275589-26275611 GAGGGGTATCCTCAGTTAAATGG - Intronic
1065493891 10:26309511-26309533 CAGGGGTCTATTCAGATGGTTGG + Intergenic
1065888682 10:30101700-30101722 GAGGGGTCCATTCAGGTGGTTGG + Intronic
1067395353 10:45911494-45911516 GAGGGGTTCATTCAGTTGGTTGG - Intergenic
1067399158 10:45955326-45955348 GAGGGGCCCATTCAGTTGGTTGG - Intergenic
1067703065 10:48587545-48587567 GAGGAGTCTCTGGAGCTGATGGG + Intronic
1067863673 10:49880615-49880637 GAGGGGTTCATTCAGTTGGTTGG - Intronic
1068112028 10:52691008-52691030 GAGGGATCTGTTCAATTGGTTGG + Intergenic
1069410893 10:68152369-68152391 GAGGGGTCCATTCAGATGGTAGG + Intronic
1071198873 10:83194448-83194470 GGGGGGTCCATTCAGTTGGTTGG - Intergenic
1071721514 10:88151374-88151396 AAGGGGTCTCAACAGTTGAAGGG - Intergenic
1071976590 10:90962165-90962187 GAGCGGTGTCTTGAGTTGATAGG + Intergenic
1072764004 10:98081348-98081370 GAGGGGGCTCTCAAGTTGTTGGG + Intergenic
1076430189 10:130396384-130396406 TGGGGGTCTGTTCAGTTGGTTGG - Intergenic
1076709863 10:132326850-132326872 GAGGGGTCCATTCAGCTGGTTGG + Intronic
1080045296 11:27801546-27801568 GAGGGGTCCATTCAGATGGTTGG + Intergenic
1080163665 11:29210803-29210825 GAGGGGTCCATTCAGCTGGTTGG + Intergenic
1080959082 11:37136792-37136814 CAGGGCTCTTTTCAGTTGGTAGG - Intergenic
1083032016 11:59601574-59601596 GATGGTTTTCTGCAGTTGATAGG - Intronic
1084025430 11:66445521-66445543 GAGGGGTCTATTTAGATGGTTGG - Intronic
1084198128 11:67537625-67537647 GAGGGGTCCATTCTGTTGAGAGG - Intergenic
1084635807 11:70391785-70391807 GAAGGGTCTATTCAGTTGGTTGG - Intergenic
1084877406 11:72143238-72143260 GAGGTGTCCATTCAGTTGTTTGG - Intergenic
1084882565 11:72182041-72182063 GAGGTGTCCATTCAGTTGTTTGG - Intergenic
1085269915 11:75264160-75264182 GAGGGGTCCCTTGGGTTGAGTGG + Exonic
1085619630 11:78028063-78028085 GAGGGGTCCATTCAGATGGTTGG + Intronic
1086294431 11:85348989-85349011 GAGGAGTCCATTCAGTTGGTTGG - Intronic
1087256767 11:95964695-95964717 AAGGGGTCCATTCAGTCGATTGG + Intergenic
1087931746 11:103986224-103986246 GACGGGTCTCTGAAGTTCATGGG + Intronic
1087994026 11:104781309-104781331 GAGGGATCCATTCAGTTGGTTGG + Intergenic
1088054012 11:105553434-105553456 GAGGGGTCCATTCAGTTGTCTGG + Intergenic
1089839905 11:121407342-121407364 AGGGGGTCTGTTCAGTTGGTTGG - Intergenic
1091365675 11:135018008-135018030 GAAGTGTCTATTCAGTTGTTTGG - Intergenic
1092677573 12:10939070-10939092 GAAAGATCTCTTCGGTTGATCGG - Exonic
1092895598 12:13007358-13007380 GAGGGGTCCATTCAGTCGAGTGG - Intergenic
1094133522 12:27100209-27100231 GAGGGGTCCATTCAGGTGGTTGG - Intergenic
1094183667 12:27618246-27618268 GAGGGGTCCATTCAGGTGGTTGG - Intronic
1094212376 12:27905986-27906008 GAGGGGTCCATCCAGTTGTTTGG + Intergenic
1094446206 12:30533370-30533392 GGGGGGTCTGTTCAGCTGGTCGG - Intergenic
1095180457 12:39142248-39142270 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1098291680 12:68962585-68962607 GAGGAGTCTGTTCAGATGGTTGG - Intronic
1098584473 12:72139769-72139791 GAGGGGTCCATTCGGTTGGTTGG - Intronic
1100207222 12:92363798-92363820 GAGGGGTCTGTGCAGCTGCTGGG + Intergenic
1101088392 12:101259485-101259507 AGGGGGTCTGTTCAGTTGGTTGG + Intergenic
1101110948 12:101485328-101485350 GTGGGTTTTGTTCAGTTGATAGG - Intronic
1101517144 12:105447115-105447137 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1101713023 12:107286397-107286419 GAGGGGTCCATTCAGATGTTTGG - Intergenic
1102197771 12:111036566-111036588 GAGGGGTTTGTTCAGGTGATGGG + Intronic
1104694050 12:130850058-130850080 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1106019466 13:25900694-25900716 AGGGGGTCTGTTCAGTTGCTTGG + Intronic
1107117500 13:36762743-36762765 GAGGGGTTCATTCAGTTGGTTGG + Intergenic
1108872375 13:55003427-55003449 GAGGGGTCCATTCAGTTGGCTGG - Intergenic
1108939987 13:55940902-55940924 GAGGGATCCATTCAGTTGATTGG - Intergenic
1109434068 13:62275190-62275212 GAGGGGTCCATTCAGTTGGTTGG + Intergenic
1109967718 13:69723547-69723569 GAGGGGTCTATTCATATCATTGG - Intronic
1111895953 13:94141609-94141631 GAGGGGTCCGTTCAGTTGGTGGG + Intronic
1112140112 13:96631950-96631972 GATTGGGCTCTTCCGTTGATTGG + Intronic
1112261326 13:97880783-97880805 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1113150065 13:107253421-107253443 GAGGGGTCTCCCCAGGAGATGGG - Intronic
1113918657 13:113890830-113890852 GAGGGGTCTGTTCAGTCAGTTGG - Intergenic
1113971871 13:114197493-114197515 GAGGGGTCTGTTCAGTTGGCTGG + Intergenic
1115904318 14:38189933-38189955 AAGGGGTCCATTCAGATGATTGG - Intergenic
1116138258 14:40955289-40955311 GAAGGGTCTGTTCAGTTCCTTGG + Intergenic
1118380445 14:65213642-65213664 GAGGGGTCCATTCAGATGGTTGG + Intergenic
1118479174 14:66145948-66145970 GAGAGGTCTGTTAATTTGATGGG - Intergenic
1120357753 14:83456274-83456296 AAGGGGTCCATTCAGTTGGTTGG - Intergenic
1120622299 14:86778844-86778866 GAGGGGTCCATTCAGATGGTTGG + Intergenic
1120732155 14:88015948-88015970 GAGGGGTCTTTTCAGTCAGTTGG - Intergenic
1122647294 14:103203652-103203674 GGGAGGTCTGTTCAGTTGCTTGG - Intergenic
1124075732 15:26442834-26442856 GAGGGGTCCATTCAGATGACTGG + Intergenic
1124603399 15:31152483-31152505 GAGGGGTCCATTCAGATGGTTGG - Intronic
1124898695 15:33801773-33801795 GAGGGGTCTATTCCGTTACTTGG + Intronic
1124958334 15:34374950-34374972 GATAGGTCTATTCAGTTGATTGG - Intergenic
1127398371 15:58561924-58561946 GAGGGGTCCATTCAGATGGTTGG + Intronic
1128615938 15:69109831-69109853 GAAGGGTCTCTGCATTAGATGGG - Intergenic
1130916139 15:88306220-88306242 CAGGGGCATCTTCAGCTGATGGG + Intergenic
1131209052 15:90477603-90477625 GAAGGATCTTTTAAGTTGATGGG + Intronic
1133000046 16:2845717-2845739 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1133872633 16:9703524-9703546 GCGGGGTCTGTTTAGTTGGTTGG - Intergenic
1134002122 16:10791023-10791045 GAGGGGTCCATTCAGTTGGTTGG + Intronic
1134783770 16:16922624-16922646 TAGGGTTCTCTCCACTTGATGGG + Intergenic
1134800658 16:17081553-17081575 GAGGGATCTGTTCAGATGGTTGG + Intergenic
1134866292 16:17610364-17610386 GAGGGGTCTCTTCAGGTGGTTGG - Intergenic
1136289603 16:29263560-29263582 GAGGGTTCCATTCAGTTGGTTGG + Intergenic
1138564476 16:57822964-57822986 GAGGGGTTTATTCAGATGGTTGG - Intronic
1138898466 16:61239701-61239723 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG + Intergenic
1141719600 16:85748893-85748915 GAGTGGTCCATTCAGATGATTGG + Intronic
1141781119 16:86162106-86162128 GAGGGGCCCATTCAGTTGGTTGG + Intergenic
1142095337 16:88236540-88236562 GAGGGTTCCATTCAGTTGGTTGG + Intergenic
1145024440 17:19457347-19457369 GAGGGGTCTGTACAGATGTTTGG + Intergenic
1145031866 17:19510552-19510574 GAGGGGTCCGTTCCGTTGTTTGG + Intronic
1146592063 17:34135971-34135993 GAGGGCTCCATTCAGTTGGTGGG - Intronic
1152150209 17:78594746-78594768 GAGAGGTCCATTCAGATGATGGG - Intergenic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1152818738 17:82424788-82424810 CAGGCGTTTCTTCTGTTGATGGG + Intronic
1152980182 18:268949-268971 CGGGGGTCTGTTCAGTTGTTGGG - Intergenic
1153444252 18:5154570-5154592 AAGGGGTCTGGTCAGTTGGTTGG - Intronic
1153837585 18:8977779-8977801 GAGGGGTCCATTCATTTGGTTGG + Intergenic
1153963577 18:10160615-10160637 GAGGGGTCCATTCAGGTGATGGG + Intergenic
1154345627 18:13541488-13541510 GAGTGGTCTCCTCAGGTGGTGGG + Intronic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1155565611 18:27131202-27131224 GAGGGGTCTATTTAGTCGGTGGG - Intronic
1155583561 18:27339475-27339497 TAGGGTTCTCATCAGTTGAAAGG - Intergenic
1155669346 18:28349922-28349944 GAGGGATCTCTTCAGTTGGTTGG + Intergenic
1156813582 18:41281335-41281357 GAGGGATCTGTTCAGTTGGAGGG + Intergenic
1158167398 18:54555751-54555773 GAGAGGTCTATTCAGATGGTTGG + Intergenic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1160557691 18:79736567-79736589 GAGGTGACTCTGCAGTTGGTGGG + Intronic
1162210095 19:9084333-9084355 GAGGGGTCCCTTCAGATGGATGG - Intergenic
1163088153 19:14998094-14998116 GAGGGGTCCATTCAGATGGTTGG - Intronic
1163747758 19:19058177-19058199 GAGGGGTCTCTTCCATAGCTTGG + Exonic
1164625835 19:29727346-29727368 AGGGGGTCTGTTCAGTTGGTTGG - Intergenic
1164687381 19:30176444-30176466 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1164736201 19:30543340-30543362 GAGTGGTCCCCTCAGTAGATGGG + Intronic
1164873533 19:31667194-31667216 AAGGTGTCTATTCAGTTCATTGG - Intergenic
1164966984 19:32493749-32493771 GAGGGGTCCATTCAGGTGGTTGG + Intergenic
1165265072 19:34655121-34655143 GAGGGGTCCATTCAGATGGTTGG - Intronic
1165692070 19:37871377-37871399 GAGGGGTCCATTCAGTTGTTTGG + Intergenic
1166512617 19:43419735-43419757 GAGGGGACCCTTCAGATGGTTGG + Intergenic
1167201124 19:48066244-48066266 GAGAGGTCTATTCAGATGGTTGG + Intronic
1168536227 19:57172562-57172584 GAGGGGTCCATTCAGTTGGCTGG - Intergenic
1168637166 19:58005280-58005302 GAGGGGTCTATTCATATGGTTGG - Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928604717 2:32935179-32935201 AAGGGGTCCATTCAGTTGGTTGG - Intergenic
929278551 2:40052260-40052282 CAGGGGTCTCCTCAGTTCCTTGG + Intergenic
935414070 2:102796770-102796792 GAGGAGTCACTTCAGTTAAATGG - Intronic
935521264 2:104107882-104107904 CTGGGGTCTGTTCAGTTGGTGGG + Intergenic
936481179 2:112886267-112886289 GAGGGGTCCATTCAGATGGTTGG - Intergenic
937951577 2:127391964-127391986 GAGGGGTCTATTCAGGTGGTTGG + Intergenic
942097731 2:172549178-172549200 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
943309232 2:186306476-186306498 GAGGGGTCCATTCAGATGGTTGG - Intergenic
943378813 2:187117443-187117465 GCGGGGTCTCTGCAATTCATAGG + Intergenic
946783924 2:223222302-223222324 AAGGGGTCTGTTCAGTTCGTTGG + Intergenic
947226891 2:227849279-227849301 GAGGGGTCCATTCAGATGGTTGG - Intergenic
947267486 2:228299672-228299694 GAGGGGTCCATTCAGTTGGCTGG + Intergenic
947996296 2:234530538-234530560 GAGGGGTCGATTCAGATGGTTGG - Intergenic
948091102 2:235296424-235296446 GAGGGGTCCGCTCAGATGATTGG + Intergenic
948433896 2:237939148-237939170 GAGGGGTCTCTTCAGTCAGTTGG + Intergenic
948633127 2:239314826-239314848 GAGGGGTCCATTCAGATGGTTGG - Intronic
1171974471 20:31585613-31585635 GAGGGGTCCGTTCAGATGGTTGG - Intergenic
1174143413 20:48433069-48433091 GAGGGGTCCATTCAGTTGCTTGG - Intergenic
1177173776 21:17682074-17682096 GAGGGGTCCATTCTGTTGGTTGG + Intergenic
1178516710 21:33254141-33254163 GAGGGATCCATTCAGTTGGTTGG - Intronic
1178570613 21:33732406-33732428 GAGGGGTCCATTCAGATGGTGGG + Intronic
1179417540 21:41210215-41210237 GAAGGGTCTGTTCAGTTGGTGGG - Intronic
1180873259 22:19159970-19159992 GGGGGATCTTTTCAGTTGGTGGG - Intergenic
1181329243 22:22076336-22076358 GAGGGGTCTGTTCAGATGGATGG + Intergenic
1181746047 22:24955600-24955622 GAAGGGTCTCTGCAGGTGAGGGG + Intronic
1182896084 22:33860644-33860666 GAGGGGGCTCTTCTGAGGATGGG + Intronic
1183873010 22:40754741-40754763 AAGGGGTCCATTCAGTTAATTGG - Intergenic
1184439496 22:44500197-44500219 AGGGGGTCTGTTCAGTTGGTTGG - Intergenic
949227918 3:1715714-1715736 AAGGGGTTTGCTCAGTTGATTGG - Intergenic
950504379 3:13385204-13385226 GAGTGGTGTCTCCAGTTGATGGG - Intronic
951662700 3:25087286-25087308 GAGGAGTCCATTCAATTGATTGG + Intergenic
952128381 3:30330775-30330797 GAGAGGTCTCTTGTGTTGAATGG - Intergenic
954160258 3:48716781-48716803 GAGGGGTCTCCCCAGGTCATTGG - Intronic
954606628 3:51915809-51915831 GAGGGGTCCATTCAGGTGGTTGG - Intergenic
955142878 3:56287036-56287058 GAGGGGTCTCTTAAGTGTTTCGG - Intronic
956102368 3:65781952-65781974 GAGGGGTCTCCTGAGCAGATTGG + Intronic
957165073 3:76662169-76662191 AAGGGGTCCCTTCAGTTGGTTGG + Intronic
957571052 3:81947747-81947769 CAGGGGTCCCTTCAGTTGATGGG + Intergenic
959252220 3:103963713-103963735 GAGGGAGCTCTTCAATTGCTAGG - Intergenic
961957422 3:130818459-130818481 GAGGGGTCCATTCAGATGGTTGG - Intergenic
963226533 3:142868305-142868327 GAGGGGTCCATTCAGTTGGTTGG - Intronic
964219528 3:154327556-154327578 GACGGGTCCATTCAGTTGGTTGG - Intergenic
964575959 3:158168892-158168914 AGGGGGTCTGTTCAGTTGTTTGG - Intronic
965091664 3:164170675-164170697 GAGGGGTCTATTCAGATGAGTGG + Intergenic
965959491 3:174412008-174412030 GAGGAGTTTATTCAGTTGGTTGG - Intergenic
966754287 3:183353977-183353999 GAAGGGTCCATTCAGTTGGTTGG - Intronic
968981478 4:3852356-3852378 GAGGGGTCTGCTCAGATGGTTGG - Intergenic
972302634 4:37799392-37799414 GAGGGGTACATTCAGTTGGTTGG - Intergenic
973336612 4:48962898-48962920 GAGAGGTCCCTTCAGATGAATGG + Intergenic
973801907 4:54486855-54486877 GAGGAGTGGCTTCATTTGATTGG + Intergenic
974488128 4:62529982-62530004 GAGGGGTCCATTCAGTTAGTTGG + Intergenic
974633908 4:64533529-64533551 GAGGAGTCTATTCAGTTGGTTGG + Intergenic
974674657 4:65074233-65074255 GAGAGGTCCGTTCAGTTGGTGGG + Intergenic
975059900 4:69984797-69984819 GAGGGATCCATTCAGTTGGTTGG + Intergenic
977341960 4:95770409-95770431 GTGTTGTCTCTTCAGTTCATTGG - Intergenic
978112326 4:104977690-104977712 GAGGGGTCTCTGCGGGTGGTGGG - Intergenic
978551182 4:109928925-109928947 GAGGGGTCTATTCAGTTGGTTGG + Intronic
980521604 4:133943387-133943409 GAGGGGTCTATTCAGTCAGTTGG + Intergenic
980643903 4:135616844-135616866 AATGGCTCTCATCAGTTGATAGG - Intergenic
981091902 4:140740962-140740984 GAGAGGTCCATTCAGTTGGTTGG - Intronic
981740974 4:148001245-148001267 GAGGGCTCTGTTCTGTTCATTGG + Intronic
982009559 4:151093492-151093514 GAGGAGTCCGTTCAGTTGGTTGG + Intergenic
982773136 4:159416376-159416398 GTGAGGTCTATTCAGTTGGTTGG - Intergenic
983024403 4:162715390-162715412 GATGGGTCTATTCAGATGGTTGG - Intergenic
985482946 5:128828-128850 AGGGGGTCTGTTCAGTTGGTGGG - Intergenic
986509901 5:8493091-8493113 GAGGGGTTCATTCAATTGATTGG + Intergenic
988637746 5:33005419-33005441 AAGGGGTCCATTCAGATGATTGG - Intergenic
988679711 5:33473075-33473097 GAGGGGTCCATTCAGTTGATTGG - Intergenic
991202096 5:64006510-64006532 AAAAGGTCTCTTCAGTTGGTTGG - Intergenic
991615560 5:68493713-68493735 AAGGGGTCTATTCAGTTGGCTGG - Intergenic
991931818 5:71760529-71760551 GAGGGGTCTATTCTGTCCATTGG + Intergenic
992065427 5:73103442-73103464 GGGGGATCTATTCAGTTGGTTGG - Intergenic
992283007 5:75201653-75201675 GAGGGGTCCATTCAGATGATTGG - Intronic
994044711 5:95295060-95295082 GAGGGATCCATTCAGTTGGTTGG - Intergenic
995285665 5:110385623-110385645 GAGGGGTCCATTCAGATGGTTGG - Intronic
998621381 5:143797920-143797942 GTGGGTTCTTTTCACTTGATAGG - Intergenic
999483162 5:151967303-151967325 GAGGGGTTCATTCAGTTGATTGG + Intergenic
1000471595 5:161649111-161649133 GAGGCGTCTATTCAGGTGCTCGG + Intronic
1000718891 5:164681152-164681174 GAGGGGTCCATTCAGTTGGATGG + Intergenic
1001256611 5:170188170-170188192 GCGGAGCCTCTTCAGGTGATGGG + Intergenic
1001273474 5:170333079-170333101 GAGGGGTCCATTCAGATGGTTGG + Intergenic
1002281513 5:178132762-178132784 GCAGGGTCTCTTCAGTTAATAGG - Intronic
1002689283 5:181038967-181038989 GAGGGGCCTCTGCAGGTGACAGG - Intergenic
1003321322 6:5054599-5054621 GAGGGATCCATTCAGTTGGTTGG - Intergenic
1003431669 6:6044077-6044099 GGGGGGTCTCTTCATTTGTTGGG - Intergenic
1004995127 6:21183875-21183897 GAGGGGTGCATTCAGTTGGTTGG - Intronic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1011901815 6:92307912-92307934 GTGTTGTCTCTTCAGTTGGTTGG - Intergenic
1012181915 6:96164773-96164795 GAGGGATCCATTCAGTTGGTTGG + Intronic
1012227187 6:96717792-96717814 GAGGGGTCTATTCAGTTGGTTGG - Intergenic
1012573827 6:100765249-100765271 GAGGGGTCCATTCAGATGGTTGG - Intronic
1013284379 6:108668213-108668235 GAGCGGTCTGCTCAGTTGACAGG + Intronic
1013419243 6:109951125-109951147 GAGGGGTCTATTCAGATGGTTGG + Intergenic
1015704178 6:136069132-136069154 GAGGGATCAATTCAGTTGGTTGG + Intronic
1015986613 6:138890984-138891006 GAGGAGTCCATTCAGTCGATTGG - Intronic
1016490764 6:144598873-144598895 GAGGGATCCATTCAGTTGGTTGG + Intronic
1016699323 6:147035782-147035804 GAGGGGTCTATTCAGTCAGTTGG + Intergenic
1017358823 6:153542225-153542247 AGGGGGTCTGTTCAGTTGGTAGG - Intergenic
1018912729 6:168112233-168112255 GAGGGGTCTGTTCAGTTCCTGGG + Intergenic
1018987121 6:168646309-168646331 CAGTGGTCTCTTCTCTTGATCGG + Intronic
1020169421 7:5833441-5833463 GGGTGGTCTCAGCAGTTGATCGG + Intergenic
1020248879 7:6451330-6451352 GAGGGGTCTCTTGAGCTGTGTGG - Intronic
1021819220 7:24479824-24479846 GAAGGGTCTCTTGAGGTGGTGGG - Intergenic
1023392478 7:39723525-39723547 GAGGGGGTCCATCAGTTGATTGG - Intergenic
1024305456 7:47925527-47925549 GAGGGGTCCATTCAGTAGGTTGG - Intronic
1026520256 7:71111265-71111287 GAGGGGTCGATTCAGATGGTTGG + Intergenic
1027167424 7:75845228-75845250 GAGGAGTCCATTCTGTTGATGGG + Intronic
1027521487 7:79215029-79215051 AGGGGGTCTATTCAATTGATTGG - Intronic
1027616632 7:80431963-80431985 GAGGAGTCTGTTCAGTTGGTTGG + Intronic
1028689602 7:93636735-93636757 GAGGGGCCTGTTCAATTGGTTGG + Intronic
1030185331 7:106755996-106756018 GAGGGGTCCATACAGTTGGTTGG + Intergenic
1031810475 7:126361503-126361525 AGGGGGTCTATTCAGTTGGTTGG + Intergenic
1032101529 7:128983026-128983048 GAGGGACCTATTCAGTTGGTGGG - Intronic
1032356612 7:131216928-131216950 AGGGGGTCTCCTCAGTTCATGGG - Intronic
1033527665 7:142232503-142232525 CAGGGATCTTTTCACTTGATTGG + Intergenic
1033942866 7:146677505-146677527 GAGGGGTCTATTCAGATGACTGG + Intronic
1035183317 7:157106625-157106647 GAGGGGTCCATTTAGTTGACTGG + Intergenic
1036423109 8:8616428-8616450 GAGGGGTCCACTCAGATGATTGG - Intergenic
1037554635 8:20010234-20010256 GAGGGGTCCATTCAGATGACTGG + Intergenic
1037806065 8:22058467-22058489 GCGGGGTCTCTTCAGAGGGTGGG + Intronic
1038401017 8:27284545-27284567 ATGGGGTCTCTCCAGGTGATGGG + Intergenic
1038861886 8:31396722-31396744 GAGGAGTCTCTTCAGTCCAATGG + Intergenic
1039220102 8:35320826-35320848 GAAGGGTCCATTCAGTTGATTGG + Intronic
1039736502 8:40338294-40338316 GAGGGGTCCATTCAGTTGGCTGG + Intergenic
1040361046 8:46664774-46664796 GAGGGGTCCATTCAGATGGTTGG - Intergenic
1040450787 8:47544090-47544112 GAGGGTTCTGTTCAGTTGGTTGG + Intronic
1042395443 8:68286288-68286310 GAGCTGTCTCTTCTGTTGCTAGG + Intergenic
1042979012 8:74505057-74505079 GAGGGGTCCATTCAGTTAGTTGG - Intergenic
1043765286 8:84123277-84123299 AAGGGGTCTATTCAGTTGGTTGG - Intergenic
1044031384 8:87241944-87241966 GAGGGGTCTATTCAGTTGGCTGG - Intronic
1045079329 8:98606775-98606797 TATGGGTCTCTTCATTTGACTGG + Intronic
1047197678 8:122736195-122736217 GAGGGATGTCTTCAGCTTATAGG - Intergenic
1047353925 8:124102238-124102260 GAGGAGTCTATTCAGATGGTTGG + Intronic
1047390069 8:124443369-124443391 GAGAAGTCTCTTCAGTTAGTAGG + Intergenic
1048288349 8:133160431-133160453 GAGGGGTCTCATCATATGACAGG + Intergenic
1050952476 9:11615655-11615677 GAGGGGTCCATTCAGGTGGTTGG - Intergenic
1050989836 9:12136812-12136834 GATGGGTCCATTCAGTTGGTTGG - Intergenic
1055108743 9:72538998-72539020 AAGGGGTCCATTCAGTTGATTGG + Intronic
1056723018 9:89087697-89087719 GAGAGGTCAGTTCAGTTGGTTGG - Intronic
1056955994 9:91081709-91081731 GAGGGGTCCATTCAGTTGGTAGG + Intergenic
1058826029 9:108776812-108776834 GGGGGGTCCATTCAGTTGGTTGG - Intergenic
1185817376 X:3168834-3168856 GAGGGGTCCATTCAGATGATTGG + Intergenic
1185975902 X:4719792-4719814 ACGGGGTCTATTCAGTTGATTGG - Intergenic
1188120763 X:26304652-26304674 AAGGGGTCCATTCAGTTGACTGG - Intergenic
1188877037 X:35442677-35442699 GAGGGGTCCATTCAGGTGGTTGG + Intergenic
1188926099 X:36045516-36045538 AAGGGGGCTCTTCAGTTAACAGG + Intronic
1189188101 X:39071260-39071282 GAGAGGTCTATTCAGATGGTTGG + Intergenic
1189748285 X:44192904-44192926 GAGGGGTCCATTCAGATGGTTGG - Intronic
1191638783 X:63408092-63408114 GAGGGGTCCATTCAGTTGGATGG - Intergenic
1192731996 X:73809772-73809794 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1195578443 X:106475813-106475835 AGGGGGTCTGTTCAGTTAATGGG - Intergenic
1196075082 X:111567545-111567567 GAGGGGTCCATTCAGTTGGTTGG - Intergenic
1198967555 X:142244087-142244109 AAGGGGACTATTCTGTTGATGGG - Intergenic
1199651753 X:149951861-149951883 GAGGGGTCCATTCAGGTGGTTGG + Intergenic
1200299760 X:154961670-154961692 AAGGGGTCTCTTCAGTCGTTTGG - Intronic
1200611539 Y:5331315-5331337 GAGGGGTCCATTTAGATGATTGG - Intronic