ID: 1009514724

View in Genome Browser
Species Human (GRCh38)
Location 6:64600654-64600676
Sequence TAGGGGCACTGGTAGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009514724_1009514735 16 Left 1009514724 6:64600654-64600676 CCAGCATACTACCAGTGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1009514735 6:64600693-64600715 ACATTTTCCACTGAATGGCCGGG 0: 1
1: 0
2: 2
3: 10
4: 170
1009514724_1009514736 17 Left 1009514724 6:64600654-64600676 CCAGCATACTACCAGTGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1009514736 6:64600694-64600716 CATTTTCCACTGAATGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 159
1009514724_1009514733 11 Left 1009514724 6:64600654-64600676 CCAGCATACTACCAGTGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1009514733 6:64600688-64600710 ATGTTACATTTTCCACTGAATGG 0: 1
1: 0
2: 2
3: 14
4: 286
1009514724_1009514734 15 Left 1009514724 6:64600654-64600676 CCAGCATACTACCAGTGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1009514734 6:64600692-64600714 TACATTTTCCACTGAATGGCCGG No data
1009514724_1009514738 29 Left 1009514724 6:64600654-64600676 CCAGCATACTACCAGTGCCCCTA 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1009514738 6:64600706-64600728 AATGGCCGGGGCTAATATGATGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009514724 Original CRISPR TAGGGGCACTGGTAGTATGC TGG (reversed) Intronic
902748390 1:18488905-18488927 TGGGGGAACTGGGAGTATGCTGG + Intergenic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
910429418 1:87146597-87146619 TAGGGCCAGTGGTAGTATTGGGG + Intronic
918316035 1:183323429-183323451 TAGGGTCACTTGAAGTATGGTGG - Intronic
919246736 1:194997012-194997034 TCGGGGAACTGGCAGTATCCAGG + Intergenic
1071036780 10:81257617-81257639 TTGAGGCCCTGGTTGTATGCCGG + Intergenic
1072458913 10:95601894-95601916 TAGGGACACTGGTATGAGGCTGG - Intergenic
1077781551 11:5335444-5335466 TAGGGGCACTGGGAGGAAGTAGG + Intronic
1084858545 11:72003863-72003885 TAGAGGCACTGGCAGGATGGGGG - Intronic
1091545198 12:1496995-1497017 ACTGGGCACTGGTAGAATGCAGG - Intergenic
1109965624 13:69690640-69690662 TAGGGGCACAGGTAAAATCCTGG - Intergenic
1112337358 13:98526088-98526110 GAGGAGCATTGGCAGTATGCTGG + Intronic
1113228113 13:108180978-108181000 TGGGGGCATAGTTAGTATGCGGG - Intergenic
1113372961 13:109739293-109739315 TAGGGGCACTGATAGAAGGTAGG + Intergenic
1113582711 13:111440213-111440235 AAGGGCAACTGGTAGTGTGCAGG - Intergenic
1115766135 14:36625267-36625289 CAGGGGCACTGAAAGTAGGCAGG + Intergenic
1127587227 15:60390038-60390060 TAGGGGGACTGGGACTATGTAGG - Intronic
1133275931 16:4638515-4638537 GTGGGGGACTGGTAGTAGGCAGG + Intronic
1140893133 16:79302071-79302093 TAGTGGCACTGGAGGGATGCAGG - Intergenic
1142738680 17:1917778-1917800 TAGGGACAGTGGCAGTAGGCAGG + Intergenic
1142738688 17:1917806-1917828 TAGGGACAGTGGCAGTAGGCGGG + Intergenic
1142738696 17:1917834-1917856 TAGGGACAGTGGCAGTAGGCGGG + Intergenic
1142738716 17:1917924-1917946 TAGGGACAGTGGCAGTAGGCAGG + Intergenic
1142738724 17:1917952-1917974 TAGGGACAGTGGCAGTAGGCGGG + Intergenic
1142738741 17:1918042-1918064 TAGGGACAGTGGCAGTAGGCAGG + Intergenic
1142738749 17:1918070-1918092 TAGGGACAGTGGCAGTAGGCGGG + Intergenic
1142738756 17:1918098-1918120 TAGGGACAGTGGCAGTAGGCAGG + Intergenic
1142738777 17:1918188-1918210 TAGGGACAGTGGCAGTAGGCAGG + Intergenic
1142738785 17:1918216-1918238 TAGGGACAGTGGCAGTAGGCGGG + Intergenic
1146699228 17:34940156-34940178 GAGGGGCACTGGGAATATGTGGG - Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1152175953 17:78787553-78787575 TAGGGGCACTGTTCGTGTGCTGG + Intronic
1157108061 18:44793367-44793389 GAGGGGCACTGGCAATATGCCGG - Intronic
1165481138 19:36064984-36065006 GAGGGGAACTGGTAGGAAGCAGG + Intronic
928704512 2:33933461-33933483 TTGGGGCTCTGGAAATATGCTGG + Intergenic
931008708 2:57882406-57882428 TATGGGCACTGGGAGTAGGGTGG - Intergenic
938131202 2:128716918-128716940 CAAGGGCACTGCTAGGATGCTGG - Intergenic
945796856 2:214375312-214375334 AATGGGCAATGGTAGTATTCTGG + Intronic
949012750 2:241690672-241690694 TAGGGGAAATGGTGGGATGCTGG + Intergenic
1169911074 20:10647886-10647908 AAGGGGCAGTGGTAGTAAGTGGG + Intronic
1172978956 20:38926794-38926816 TAGGCGCCCTGGTAGAAGGCGGG - Exonic
1179313346 21:40216757-40216779 TGGGGGCACTGGTTGGCTGCGGG - Intronic
1184903260 22:47461142-47461164 TAGGGGCACTGGCTGCCTGCTGG - Intergenic
954109070 3:48424276-48424298 CAGGGGCCCTGGTGGTATGCGGG - Exonic
956401186 3:68881857-68881879 TAGAGGCACTGCTAGGTTGCTGG - Intronic
956505077 3:69929299-69929321 CAGGAGCACTGGTAGCATGTGGG + Intronic
956942617 3:74181184-74181206 TAGGTACACTGGTATTATGAGGG - Intergenic
958803352 3:98781565-98781587 CAGGGGCTCTGGTGGTATGCTGG + Intronic
959878703 3:111417649-111417671 TAGGGGAACTGGTAGGAATCAGG + Intronic
965354428 3:167656243-167656265 TAGGGGAACTTGTAGTATTAGGG - Intergenic
970641456 4:18070791-18070813 TAAGGGCACTGGAAGTATGTTGG - Intergenic
977587136 4:98786318-98786340 TCAGGGCACTGGCGGTATGCAGG - Intergenic
981035960 4:140169156-140169178 TAGGGGCAGGGGTAGTATCAGGG - Intergenic
986062774 5:4207501-4207523 TGGGGGCAGTTGTAGTAGGCCGG - Intergenic
989647878 5:43655661-43655683 TAAGGGCACTAGTTGTATACAGG - Intronic
994622011 5:102174956-102174978 TAGGGTCACAGGTAGTATATTGG + Intergenic
997211796 5:132081211-132081233 AAGGGGCACTGGTGGGAAGCTGG + Intergenic
1001746349 5:174095541-174095563 TAGGGGCACTGCTTGAATTCAGG + Intronic
1003047141 6:2744276-2744298 TAGGGGCATTGGGAGACTGCTGG + Intronic
1004419823 6:15459034-15459056 TAGGGGCATTGGCAGAAGGCTGG + Intronic
1004945407 6:20607018-20607040 TAAGGTCACTGGTAGTAAGCAGG + Intronic
1005370045 6:25123006-25123028 TAGGAGAACTGGGAGAATGCTGG + Intergenic
1009514724 6:64600654-64600676 TAGGGGCACTGGTAGTATGCTGG - Intronic
1013357859 6:109362524-109362546 TAAGGGAACTGGCAGGATGCTGG + Intergenic
1014832232 6:126116217-126116239 TTGGGGCAATGGGAGTGTGCTGG + Intergenic
1016924065 6:149324130-149324152 TAGGAGCACTGGTACTAGGCCGG - Intronic
1035725897 8:1824540-1824562 TAGGGGGACAGGTAGGGTGCGGG - Intronic
1042926366 8:73972108-73972130 TAGGGGCTGTGGCAGTACGCGGG - Intronic
1043649913 8:82578617-82578639 TGGTGGCACTGGCAGTAGGCAGG - Intergenic
1048627195 8:136198143-136198165 TAGGAGCACTGGTAATAAACTGG - Intergenic
1056271884 9:84954964-84954986 TAGGGGCTCTGGCACTGTGCTGG - Intronic
1057267929 9:93631090-93631112 TAGGGGCAGAGGGAGGATGCGGG + Intronic
1057745265 9:97746080-97746102 TTGGGGCACAGTTGGTATGCGGG - Intergenic
1061885870 9:133590897-133590919 AAAGGGCAATGGTAGTATCCAGG - Intergenic
1062085622 9:134646564-134646586 TAGGGGCACTTGTATTCTCCTGG - Intronic
1191122325 X:56919493-56919515 TAGGTCCACTGGTAGTCTGATGG + Intergenic
1197165244 X:123369954-123369976 TAAGGTCACTGGTAGAATGTAGG - Intronic
1200019120 X:153187558-153187580 GAGGGGCACTGGGAGGATCCAGG + Intergenic