ID: 1009519496

View in Genome Browser
Species Human (GRCh38)
Location 6:64663757-64663779
Sequence TGCTGCCATCTTGGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 348}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009519496_1009519501 -1 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519501 6:64663779-64663801 AAGCCTCTTGCACTCTGACCTGG 0: 1
1: 7
2: 58
3: 257
4: 309
1009519496_1009519505 8 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519505 6:64663788-64663810 GCACTCTGACCTGGGGTTCTTGG 0: 1
1: 10
2: 299
3: 174
4: 231
1009519496_1009519508 25 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519508 6:64663805-64663827 TCTTGGCCTCAAGGATTCCAAGG 0: 4
1: 242
2: 204
3: 74
4: 241
1009519496_1009519506 16 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519506 6:64663796-64663818 ACCTGGGGTTCTTGGCCTCAAGG 0: 225
1: 116
2: 39
3: 37
4: 247
1009519496_1009519503 1 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519503 6:64663781-64663803 GCCTCTTGCACTCTGACCTGGGG No data
1009519496_1009519502 0 Left 1009519496 6:64663757-64663779 CCAGAGCCCCCAAGATGGCAGCA 0: 1
1: 0
2: 6
3: 75
4: 348
Right 1009519502 6:64663780-64663802 AGCCTCTTGCACTCTGACCTGGG 0: 1
1: 7
2: 56
3: 266
4: 641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009519496 Original CRISPR TGCTGCCATCTTGGGGGCTC TGG (reversed) Intronic
900172000 1:1273818-1273840 AGCGGCCATCTTGGAGGCTGAGG - Exonic
900382490 1:2391792-2391814 TCGCGCCATCTTGGGGGCCCTGG + Intronic
901688875 1:10959802-10959824 TGCTGCCAACATGGGCTCTCTGG - Intronic
903337614 1:22635464-22635486 CCCTGCAATCTTGGGGGCCCGGG - Intergenic
905877979 1:41445565-41445587 TGGTGCCATCTAGAGGGGTCAGG - Intergenic
906507468 1:46390844-46390866 CGCCACCATCTTGGGAGCTCTGG - Intergenic
906690520 1:47789820-47789842 TGCTGCCTTCTTGGAACCTCAGG + Intronic
907504900 1:54911031-54911053 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907506020 1:54918816-54918838 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907914263 1:58854097-58854119 TGCTGCCATCCTGGGGCATCAGG + Intergenic
909137740 1:71822573-71822595 TGATGCCATAATGAGGGCTCAGG - Intronic
909628375 1:77744761-77744783 AGCTGCCATCTACTGGGCTCAGG - Intronic
910116616 1:83738847-83738869 CGCCACCATCTTGGGAGCTCTGG - Intergenic
910456526 1:87403461-87403483 TACTGCCCTCTTGGGGAGTCTGG + Intergenic
910590567 1:88924987-88925009 CGCCGCCATCTTGGGAGCTCTGG + Intergenic
912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG + Intergenic
912384003 1:109262418-109262440 TGCTGCCACCCTGGGTGCCCTGG - Exonic
915316786 1:155033295-155033317 TGCTGCCATGTTTGGGGCTGGGG - Intronic
915767230 1:158374634-158374656 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
916147090 1:161749795-161749817 CGCGGCCATGTTGGAGGCTCCGG + Exonic
917500747 1:175582976-175582998 TGCTGGCATCTCGGGGGTTGGGG - Intronic
919701737 1:200638292-200638314 TGCTGCCACCTGGGGAGCACAGG + Intronic
920639793 1:207741177-207741199 CGCCACCATCTTGGGAGCTCTGG - Intergenic
922007876 1:221550696-221550718 CGCCACCATCTTGGGAGCTCTGG - Intergenic
922219040 1:223543907-223543929 TGCTGGCACCTTGGGGGCGAGGG - Intronic
922356552 1:224782049-224782071 TGCTGCCATTTTGAGGACACAGG - Intergenic
922850093 1:228725400-228725422 TGCTGCAATCCTGGGGGCTGTGG + Intergenic
922876361 1:228942852-228942874 TGCCACCATGTTGGGAGCTCTGG + Intergenic
922997203 1:229973506-229973528 TGCAGCCTTCCTGGGGTCTCCGG - Intergenic
1064022923 10:11823743-11823765 TGGGGCTATCCTGGGGGCTCAGG + Intronic
1064553935 10:16529405-16529427 GGTTGGCAGCTTGGGGGCTCAGG - Intergenic
1068204469 10:53831328-53831350 TCCTGCCATCTTGGTGGTTTTGG - Exonic
1071130595 10:82388754-82388776 TGATGCCATCTTGGGGACACAGG - Intronic
1071326666 10:84525393-84525415 TGCCACCATCTTGAGAGCTCTGG - Intergenic
1071327357 10:84530333-84530355 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1071557048 10:86612400-86612422 TGCCACCATGTTGGGAGCTCTGG + Intergenic
1072731675 10:97850512-97850534 CGCGGACAGCTTGGGGGCTCAGG - Intronic
1074270862 10:111952152-111952174 TGCTTCTCTCTTGGGAGCTCTGG + Intergenic
1075290770 10:121228692-121228714 TGCAGACATCTTGGGGGCCCAGG - Intergenic
1075769016 10:124917435-124917457 CGCTTCCATCTTGGGCGCTCCGG + Intergenic
1076168668 10:128302461-128302483 TGCAGCTATGTTGGGGGCACTGG - Intergenic
1076478162 10:130766952-130766974 TGCTGCCATCCTGTGGGATTTGG - Intergenic
1076946033 10:133651196-133651218 CGCCACCATCTTGGGCGCTCTGG + Intergenic
1077583856 11:3435425-3435447 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1077844786 11:6013013-6013035 TTCTGCGCTCTTGGGGGCTCAGG - Intergenic
1077888260 11:6401819-6401841 TGCTGCCTTCTTGGGGGGGAGGG + Intronic
1078143670 11:8709012-8709034 TGCAGCCTGCATGGGGGCTCCGG - Intronic
1078422554 11:11224315-11224337 GGCTGACATCCTGGGGGCTGTGG - Intergenic
1078841146 11:15076344-15076366 AGCTGCCATCTGGGGGACCCTGG - Intronic
1079373426 11:19871418-19871440 TGCCTCAATCCTGGGGGCTCTGG - Intronic
1079591889 11:22192507-22192529 TGCTGGCACCTTGGAGTCTCGGG + Intergenic
1079601683 11:22317600-22317622 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1079731823 11:23942759-23942781 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1079908018 11:26273269-26273291 TGCTGAACTCATGGGGGCTCTGG - Intergenic
1081237081 11:40659058-40659080 TGCTGCACTCTTGGGGGCCCAGG + Intronic
1081623302 11:44631934-44631956 TGCTGCCCTCTCCGGAGCTCTGG - Intergenic
1081669777 11:44936619-44936641 TGCTGCCATCTTGTGGCCATTGG - Intronic
1083292077 11:61695998-61696020 GGCTGCCGTCTTTGGGCCTCTGG - Intronic
1084304435 11:68272226-68272248 CGCTGCCGTCTTGGGGTCCCGGG + Intergenic
1084569103 11:69948997-69949019 TGCTGCCAGTGGGGGGGCTCTGG - Intergenic
1084831678 11:71774614-71774636 TGCTGCCAAATTGGGAGCCCAGG - Intergenic
1087992286 11:104759004-104759026 TGCTGCCACCCTGGGGTCTGAGG + Intergenic
1088400996 11:109422639-109422661 TACTGCCAAGTTGGGGGCACAGG + Intronic
1088879868 11:113964848-113964870 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1089734248 11:120538816-120538838 TGATGCCAGGCTGGGGGCTCAGG + Intronic
1089998679 11:122933929-122933951 TGTTGCCAACTTGGGGGATGAGG - Intronic
1090277152 11:125428331-125428353 TGCTACCATCTGGGGGACACTGG + Intronic
1090415090 11:126535068-126535090 TGGTGGCCTTTTGGGGGCTCTGG + Intronic
1093106604 12:15095121-15095143 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1093281718 12:17203803-17203825 CCCTGCCCTCTTGGGGGCCCAGG + Intergenic
1094742261 12:33303308-33303330 CGCTGCCGTCTTGGGGTCTATGG - Intergenic
1094820301 12:34219225-34219247 TGCTGCGTGCTTCGGGGCTCCGG + Intergenic
1095552537 12:43459529-43459551 TGCCACCATCTTGGGAGCTCTGG + Intronic
1096153531 12:49329497-49329519 TGCTGCCAGCCTGGAGGCCCAGG + Intronic
1096214057 12:49789661-49789683 TGATGCCATTTTGGGGGATGGGG + Intergenic
1096351168 12:50902498-50902520 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1097267677 12:57755363-57755385 TGCTGCCACCGCCGGGGCTCCGG - Exonic
1097377698 12:58859016-58859038 TGCCACCATGTTGGGAGCTCTGG - Intergenic
1097840906 12:64320299-64320321 TGCCTTCATCTTGGGAGCTCTGG + Intronic
1098076122 12:66733519-66733541 GGCAGCCATCTTGGGGCCTGAGG + Intronic
1100702740 12:97165151-97165173 TGCTGCCACGTGGTGGGCTCTGG + Intergenic
1101577854 12:106014365-106014387 TGCTGGCATCTAGGAGGCTGAGG + Intergenic
1101780661 12:107832169-107832191 TGCTGCCAGGTAGGGTGCTCTGG - Intergenic
1102459138 12:113089464-113089486 CTCTGCCTTCTTGGGGGCCCAGG - Intronic
1102483046 12:113237099-113237121 TGCTGACATCTTGCCAGCTCGGG + Intronic
1102563417 12:113778953-113778975 TCCTGCCCCCATGGGGGCTCCGG + Intergenic
1104384838 12:128341717-128341739 TGCAGCCATTTTGGGGGATGAGG + Intronic
1106579344 13:31004060-31004082 GACTGCCATCTTCAGGGCTCAGG - Intergenic
1107156373 13:37172075-37172097 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1108000195 13:45898609-45898631 TGCTGCAATCTTGAGGACCCAGG - Intergenic
1109854130 13:68106873-68106895 TGCTGCCACCATGAGTGCTCTGG + Intergenic
1109936966 13:69299618-69299640 TCCTGCCAACCTGGGGCCTCAGG + Intergenic
1110439258 13:75508530-75508552 TGCTGCCATCATTGGGACACTGG + Intergenic
1110663415 13:78086160-78086182 TGATGCCATCTTTGGGGGGCAGG + Intergenic
1110846196 13:80192769-80192791 TGCCTCCATCTTGGGAGCTCTGG + Intergenic
1110987018 13:81984103-81984125 TGCCTCCATCTTGGAAGCTCTGG - Intergenic
1111021504 13:82458045-82458067 TACCACCATCTTGGGAGCTCTGG + Intergenic
1111174723 13:84579768-84579790 TACCACCATCTTGGGAGCTCTGG - Intergenic
1111709711 13:91795999-91796021 CGCCACCATCTTGGGAGCTCTGG - Intronic
1111910209 13:94302736-94302758 CGTGGCCATCTTGGGAGCTCTGG - Intronic
1113955655 13:114098960-114098982 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1113955670 13:114098998-114099020 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1113955685 13:114099036-114099058 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1113955700 13:114099074-114099096 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1113955715 13:114099112-114099134 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1113955730 13:114099150-114099172 TGCTGTGGTCTGGGGGGCTCGGG - Intronic
1114384887 14:22244142-22244164 TGCCACCATCTTAGGAGCTCTGG + Intergenic
1114483999 14:23052441-23052463 TGCTGCCGCCTTGTGGGCCCTGG + Intronic
1115674014 14:35648680-35648702 TGGTCCCATTTTGGGGGCTGAGG + Intronic
1116740391 14:48747061-48747083 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG + Intronic
1117725779 14:58672224-58672246 TTCTGACTTCTTGGAGGCTCTGG + Intergenic
1118731787 14:68671905-68671927 TGCTGCCTTCTTGGGGTCAGTGG + Intronic
1118798571 14:69167947-69167969 TGCTGGCATCTAGTGGGTTCAGG + Intergenic
1119089874 14:71771854-71771876 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1120397450 14:83985944-83985966 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1122001065 14:98653871-98653893 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1122651040 14:103227259-103227281 TGCTGCAGCCCTGGGGGCTCTGG - Intergenic
1122770630 14:104096096-104096118 CGATGCCATCCTGGGGGCCCTGG + Intronic
1122789896 14:104179754-104179776 TGCTGCCATCCCGGGGCCGCAGG + Exonic
1122798525 14:104218304-104218326 CGCTGCCACCATGTGGGCTCTGG - Intergenic
1123125522 14:105943228-105943250 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1202924785 14_KI270724v1_random:13851-13873 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1124620338 15:31270397-31270419 TCCTGCCATCCTGGGGGCCCTGG - Intergenic
1125626884 15:41116145-41116167 CGCCGCCATCTTGGGGTCCCAGG - Exonic
1125765354 15:42131899-42131921 TCCAGCCACCTTGGGGGCTGAGG + Intergenic
1126728282 15:51655295-51655317 CACTGCCATCTTGGGAGCTCTGG - Intergenic
1126814270 15:52439224-52439246 TGCCACCATCTTGGGAGCTCTGG + Intronic
1127819034 15:62639284-62639306 TGCTGCTATATTGGGGACTGTGG + Intronic
1129185882 15:73906231-73906253 TGCTGCCATCTTGAAGGAGCTGG + Intergenic
1129356947 15:74997616-74997638 TGCTGCCAATTTAGGGGCACTGG + Intronic
1129463558 15:75711830-75711852 TGCTGTCATGTTGGGGTTTCTGG + Intronic
1129721329 15:77879572-77879594 TGCTGTCATGTTGGGGTTTCTGG - Intergenic
1129754129 15:78085813-78085835 AGCACCCATCTGGGGGGCTCTGG - Intronic
1129776316 15:78238988-78239010 CGCCACCATCTTGGGAGCTCTGG - Intronic
1130162557 15:81415610-81415632 TCCTGCCATCTTGGGCCTTCCGG + Intergenic
1130575642 15:85090791-85090813 TGCTGCCCTCCTGGAGCCTCAGG + Intronic
1130764661 15:86857758-86857780 GGCTGCCATCCTGGGGGCCAGGG - Intronic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1131420175 15:92298628-92298650 TGCCACCATCATGGGAGCTCTGG + Intergenic
1132050813 15:98606371-98606393 TGCTGCCATCTTGGCGGCCGTGG - Intergenic
1132267331 15:100485778-100485800 TGCTGGAATCTTGGGGGCAGAGG + Intronic
1132978339 16:2721368-2721390 TGCTGCCCTCTGGTGGGCGCGGG + Intergenic
1133352226 16:5108992-5109014 TGCTGCCACATTGGGAGCCCAGG + Intergenic
1134049714 16:11128846-11128868 TGTTGCAATCTTGGGAGATCTGG - Intronic
1135489546 16:22897273-22897295 TGCTGCCCTCATGGGGCCTCTGG - Intronic
1135500665 16:22993164-22993186 AGCTGTCTTCTTGTGGGCTCAGG - Intergenic
1139150877 16:64380999-64381021 CCCTGCACTCTTGGGGGCTCAGG + Intergenic
1139924856 16:70480416-70480438 TCCTGCCATCATGTGGGCCCCGG + Intergenic
1141806943 16:86348060-86348082 TGCTGGAACCTTTGGGGCTCAGG + Intergenic
1141810318 16:86371567-86371589 CTCAGCCATTTTGGGGGCTCAGG - Intergenic
1142278254 16:89134136-89134158 CGCTACCATCTTGGGAGCTCTGG - Intronic
1142378363 16:89718257-89718279 TGCTCCCATCCTGGGTGGTCTGG + Intronic
1144580593 17:16456887-16456909 TCCTGCCATCTTCAGGGATCGGG - Intronic
1145255212 17:21318558-21318580 TGCTGCCCACCTGGCGGCTCAGG + Intergenic
1146002459 17:29139463-29139485 TGGTGCCAGTTTGGGGGCTGAGG + Intronic
1146139958 17:30357257-30357279 TGCTGCCTTCTCAGGGGCACAGG - Intergenic
1146169954 17:30625224-30625246 AGCTGCGATCTTGGGGACTGTGG - Intergenic
1146343407 17:32041254-32041276 AGCTGCAATCTTGGGGACTGTGG - Intronic
1147217269 17:38908183-38908205 TGCTGGCACCTTCGGGGCCCAGG + Intronic
1147462155 17:40580005-40580027 TGCAGCCATATTGGGGGTTAGGG + Intergenic
1147661133 17:42117677-42117699 TGCTGCCATGCTGGGGCCTGAGG - Exonic
1148542769 17:48493298-48493320 TGCGCCTCTCTTGGGGGCTCAGG + Intergenic
1149557941 17:57587562-57587584 TGCAGCCACCTTTGGGGCTGGGG - Intronic
1149949389 17:60968922-60968944 TCCCACCATCTTGGGTGCTCTGG - Intronic
1150782530 17:68134756-68134778 AGCTGCGATCTTGGGGACTGTGG + Intergenic
1151089217 17:71416173-71416195 TGCTGTCATGTTTGGAGCTCAGG + Intergenic
1151161971 17:72173660-72173682 TGTTGCCATCTGGTGGGCCCTGG + Intergenic
1152101097 17:78302131-78302153 TAGTGCCATCCTGGGAGCTCAGG + Intergenic
1152123498 17:78432975-78432997 TGCTGCCTACGTGGGGCCTCGGG - Intronic
1152706516 17:81846366-81846388 AGCCGCCACCTTGGGGTCTCTGG - Intronic
1153400832 18:4682386-4682408 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1153577913 18:6541335-6541357 TGCTCCCCTGTAGGGGGCTCTGG - Intronic
1153577926 18:6541398-6541420 TGCTCCCCTGTAGGGGGCTCTGG - Intronic
1153577939 18:6541461-6541483 TGCTCCCCTGTAGGGGGCTCTGG - Intronic
1153577952 18:6541524-6541546 TGCTCCCCTGTAGGGGGCTCTGG - Intronic
1153577965 18:6541587-6541609 TGCTCCCCTGTAGGGGGCTCTGG - Intronic
1155749181 18:29398879-29398901 AGCCACCATCTTGGGAGCTCTGG - Intergenic
1156474281 18:37395785-37395807 GGCTGCCATGTGGGGGCCTCAGG - Intronic
1157189402 18:45568106-45568128 TGCTGCCATTTTGAGGGGTCTGG - Intronic
1157259394 18:46165439-46165461 CACTGTCATCTTGGGAGCTCTGG + Intergenic
1157782148 18:50449174-50449196 TGCCGCCATCTTGGGAGCTCTGG - Intergenic
1159276184 18:66223798-66223820 TGCCACCATCTTGGGACCTCTGG + Intergenic
1160135074 18:76264771-76264793 TCCTGCCCTCCTGGGCGCTCTGG - Intergenic
1160730231 19:638772-638794 GGATGCCTTCTTGGTGGCTCAGG - Intergenic
1160835983 19:1124608-1124630 TGCTGCCCTCGAGGGGCCTCAGG - Intronic
1161180215 19:2875627-2875649 TTCTGCCATCTTGGAGCCTGTGG - Intronic
1161454336 19:4362610-4362632 ACCTGCGATCTTGGGGGCTGTGG + Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163142332 19:15358236-15358258 TGCTCCCATCATGAAGGCTCTGG + Intronic
1163509694 19:17727316-17727338 CGCTGCCCTCTGCGGGGCTCCGG - Exonic
1163547086 19:17947140-17947162 TGCTGCCTTCCTGGCGGCTCTGG - Intergenic
1163721177 19:18898947-18898969 TGGTGACATCTGGGAGGCTCCGG + Intergenic
1163862842 19:19751160-19751182 TGTTGCCACCACGGGGGCTCAGG - Intergenic
1164056931 19:21629836-21629858 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1164617288 19:29674722-29674744 AGCTGCCCTCTTGGGGGCCTGGG - Exonic
1164675523 19:30097984-30098006 TTCTGCCCTCTTGGGGCCTGTGG + Intergenic
1164921181 19:32089855-32089877 TGCTGCCAGGTTTGGGGCTGTGG - Intergenic
1165721521 19:38082537-38082559 TGCTGGCTTCCGGGGGGCTCCGG - Exonic
1167117760 19:47498044-47498066 TGCTGCCACCTTGGTGGCTCTGG - Intronic
1167499623 19:49837745-49837767 AGGTGCCATGTTGGGAGCTCAGG + Intronic
1168636428 19:58000634-58000656 GGCTGCCATATTGTGGCCTCTGG - Intronic
1202659660 1_KI270708v1_random:56149-56171 TGTTTCCATCATGGGGTCTCAGG + Intergenic
924974455 2:160043-160065 TGCCACCATCTTGGCAGCTCTGG - Intergenic
925438955 2:3867496-3867518 TTCTGGCATCATGAGGGCTCTGG + Intergenic
925534551 2:4902261-4902283 TCCTGACATCTTTGAGGCTCGGG - Intergenic
926624851 2:15082637-15082659 CCCTGCCTCCTTGGGGGCTCTGG - Intergenic
927598773 2:24421934-24421956 TGCTGGGATCATGGGGACTCAGG - Intergenic
927703988 2:25285917-25285939 TAGTGCCATGTTGGGGGCTTTGG - Intronic
927944040 2:27123963-27123985 AGGTGCCATTCTGGGGGCTCAGG - Exonic
928109417 2:28494532-28494554 TGCTGCCCTCTTCTAGGCTCTGG + Intronic
929542423 2:42832454-42832476 TGCCACCATCTTGGGAGCTCTGG + Intergenic
930018898 2:46989089-46989111 TGCTGCCACCTAGGGGACTGGGG + Intronic
930558096 2:52924992-52925014 TGAGGCCATCTTGGATGCTCTGG + Intergenic
932707482 2:74037982-74038004 GCCTGGCATCTGGGGGGCTCTGG + Intronic
932749785 2:74363972-74363994 TGCAGACATATTGGGGTCTCTGG - Intronic
933175672 2:79169855-79169877 TGCCACCATCTTGGGAGCTCTGG - Intergenic
934529008 2:95073629-95073651 GGCTTCCATCCTGAGGGCTCTGG + Intergenic
937972836 2:127564037-127564059 TCCAGCCACCTTGGGAGCTCTGG + Intronic
938293772 2:130164094-130164116 TGCTGCCAGGGAGGGGGCTCAGG + Intronic
938406934 2:131038022-131038044 TGCTGGCATCTCTGGGGCTTGGG + Intronic
938790969 2:134675710-134675732 GGCTGCCCTGTTGGGAGCTCTGG - Intronic
939493104 2:142899947-142899969 TGCCACCATCTTGGGAGCTCTGG - Intronic
939958355 2:148545490-148545512 TGGTGCCACCCTGGTGGCTCTGG - Intergenic
942493430 2:176512674-176512696 TGCTGCCATCTTGGTTCCTTTGG - Intergenic
943023543 2:182602183-182602205 TCCTGCACTCTTGGGGGCCCGGG - Intergenic
944681821 2:202084231-202084253 TGTTGCCTTCCTGGGGACTCTGG + Intronic
945395056 2:209306927-209306949 TACCACCATCTTGGGAGCTCTGG + Intergenic
946155332 2:217803314-217803336 TGATGCCTTTTTGGGGGCTGGGG - Exonic
947662179 2:231877795-231877817 TGGTGGGATCCTGGGGGCTCGGG + Intergenic
948523998 2:238559321-238559343 GGGTCCCGTCTTGGGGGCTCTGG - Intergenic
948863447 2:240763856-240763878 TGCTTCCTTCTTGTGGTCTCTGG - Intronic
948906453 2:240981942-240981964 AGCTGCCAGCTCTGGGGCTCAGG + Intronic
948921076 2:241066198-241066220 CCCTGCAATCTTGGTGGCTCAGG - Intronic
949012238 2:241687237-241687259 CGCTGCCAGCGTGAGGGCTCCGG + Intergenic
1173713093 20:45177327-45177349 TGCTCCCCTCCTGGGGGCTGTGG - Intergenic
1175125524 20:56748569-56748591 AGCTGCCCTCATGGGGGCCCTGG + Intergenic
1175131668 20:56794175-56794197 TGCTGGCATCTTGCGGGTTGAGG - Intergenic
1175244278 20:57572251-57572273 TCCTGCCATATTGGAGCCTCTGG - Intergenic
1175979337 20:62729221-62729243 TCCTCCCAACTTGGGGGCTCCGG + Intronic
1176204143 20:63879047-63879069 TGCCGCCACCTTGGAGGCCCAGG + Intronic
1177093842 21:16806488-16806510 TGGTGCCATATTGGGGGCTGAGG - Intergenic
1178063625 21:28879164-28879186 AGCTTCCACCTTGTGGGCTCAGG + Intronic
1178247939 21:30972243-30972265 AGCTGCCATCTTGGGGGAGCTGG - Intergenic
1178393071 21:32215071-32215093 TGTTGACATCTTGTGGGCTCAGG + Intergenic
1179255562 21:39712515-39712537 TTGTGCCATACTGGGGGCTCAGG + Intergenic
1179883851 21:44305121-44305143 TGCTGCCACCTGCTGGGCTCTGG + Intronic
1180163859 21:46010274-46010296 TGCAGCCCTCTTGCGGGCTGTGG + Intergenic
1180175329 21:46084407-46084429 TCCTGCCGTCCTGGGGGCTGCGG + Intergenic
1182062452 22:27407703-27407725 AGATGCCTTCCTGGGGGCTCCGG - Intergenic
1182368899 22:29797226-29797248 TGCTCCCATCTTGGAGGCTGAGG - Intronic
1183010840 22:34945241-34945263 TGCTGCCTCCTTAGGGCCTCAGG - Intergenic
1183290966 22:37001941-37001963 CGGTCCCAGCTTGGGGGCTCAGG - Exonic
1183407641 22:37638350-37638372 GGCTCCCATCTGGGAGGCTCTGG + Intronic
1183546496 22:38456835-38456857 TGCTGACATCCTCGAGGCTCAGG - Intergenic
1184481949 22:44753002-44753024 TGCTTCCGTCCTGGGGTCTCAGG + Intronic
1184779164 22:46637738-46637760 TGCTGCCATCCTGGGGCCCCTGG + Intronic
949811615 3:8012621-8012643 TGCCACTATCTTGGGAGCTCTGG - Intergenic
950029271 3:9841394-9841416 AGCTGCCATCTTCTGAGCTCAGG + Intronic
950740536 3:15047586-15047608 TGCTACCATCTTTGGGAGTCAGG - Exonic
951326014 3:21302794-21302816 CGCCGCCATCTTGGGAGCTCTGG - Intergenic
952407053 3:33014207-33014229 TGCAGCCACCTGGGGGGCTGGGG - Exonic
952921657 3:38289441-38289463 CGCCACCATCTTGGGAGCTCTGG - Intronic
952922639 3:38296566-38296588 TGCCACCATCTTGGGAGCTCTGG - Intronic
953505955 3:43485589-43485611 CGCCACCATCTTGGGAGCTCTGG + Intronic
956564300 3:70617823-70617845 TGCCACCATCTTGGGAGCTCGGG + Intergenic
957000446 3:74877603-74877625 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957081454 3:75639273-75639295 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957687101 3:83515655-83515677 TGCCACCGTCTTGGGAGCTCTGG + Intergenic
957923048 3:86772093-86772115 TGCTGCCATCTATGGTGCCCAGG - Intergenic
958016680 3:87945876-87945898 CGCCACCATCTTGGGAGCTCTGG - Intergenic
961010195 3:123430375-123430397 TGCTTCCATCCTGGGGTGTCCGG - Intronic
964652557 3:159027788-159027810 TGCTGGCATCTTCTTGGCTCTGG - Intronic
964781416 3:160342627-160342649 TTCTGCCATCTTGGAGCCTGTGG + Intronic
965342072 3:167503355-167503377 CGCCACCATCTTGGGAGCTCTGG - Intronic
966353331 3:179055059-179055081 CGCCGCCATCTTGGGAGCTCTGG + Intronic
968522640 4:1040973-1040995 GGCTGCCAGCCTGGGGTCTCCGG - Intergenic
969162680 4:5275157-5275179 TGCCACCATCTTGGGAGCTTTGG + Intronic
969863395 4:10055420-10055442 TGCTGGCATCTGGTGGGCACAGG - Intergenic
969942570 4:10749042-10749064 TGCTGAAATCTGGAGGGCTCAGG + Intergenic
971897629 4:32618033-32618055 TGCTTCCATATGGGGGCCTCAGG - Intergenic
972072501 4:35038734-35038756 TCCTGCAGTCTTGGGGGCCCGGG + Intergenic
972766716 4:42158230-42158252 TGCCACCATCTTGGGAGCTCTGG - Intergenic
972788280 4:42347052-42347074 TGACACCATCTTTGGGGCTCTGG + Intergenic
973205009 4:47550508-47550530 CGCCACCATCTTGGGAGCTCTGG - Intronic
974190034 4:58493061-58493083 TGCCACCATCTTGGGAGCTCTGG - Intergenic
974487797 4:62526557-62526579 CGCCACCATCTTGGGAGCTCTGG - Intergenic
974520820 4:62977716-62977738 TGCCGCCATCTTGGGAGCTCTGG + Intergenic
976203836 4:82606013-82606035 TGCTGACATTTTGGAGGCTGAGG - Intergenic
976963553 4:91008758-91008780 TGCCAACATCTTGGGAGCTCTGG - Intronic
977064650 4:92299334-92299356 GGCTGCCATCTTGTGGGGACAGG + Intronic
978909082 4:114044860-114044882 TGCCACCATCTTGGGAGCTCTGG + Intergenic
980443868 4:132882755-132882777 TGCCACCATCTTGGGAGCTCTGG + Intergenic
982255893 4:153451413-153451435 TACTGCCAGCGTGGTGGCTCGGG + Intergenic
982847909 4:160275218-160275240 TGCTGGCAACTTGGGAACTCAGG - Intergenic
983777851 4:171630218-171630240 CGCCACCATCTTGGGAGCTCTGG + Intergenic
985449443 4:190051849-190051871 CGCCACCATCTTGGGCGCTCTGG + Intergenic
985757286 5:1726497-1726519 TGCAGCCACCTTGGGGGCGCTGG - Intergenic
986918778 5:12660403-12660425 CGCTGCCATCTTGGGATCTCTGG - Intergenic
987537626 5:19208643-19208665 CCCTGCCCTCTTGGGGGCCCGGG + Intergenic
987815913 5:22901202-22901224 TGATACCCTCTTTGGGGCTCTGG - Intergenic
987855186 5:23411618-23411640 TGCCACCATCTTGGGAGCTCTGG + Intergenic
988420921 5:31005397-31005419 TGTTGGCATCTGGGGGGCTAGGG - Intergenic
989425508 5:41291141-41291163 TCTTGCCTTCTTGGGGGCTCAGG - Intergenic
989717755 5:44483832-44483854 CGCCACCATCTTGGGAGCTCTGG + Intergenic
991290681 5:65031240-65031262 CGCCACCATCTTGGGAGCTCTGG + Intergenic
993982393 5:94558251-94558273 CGCCACCATCTTGGGAGCTCTGG + Intronic
994790987 5:104224656-104224678 TGCTGCCATCATGCCGGCTACGG - Intergenic
995647576 5:114329954-114329976 TGGTGCTCTCCTGGGGGCTCAGG - Intergenic
995785024 5:115818772-115818794 TGCTGCCATCCTGGGAGCGGTGG - Intergenic
996321951 5:122228882-122228904 TGCCACCATCTTGGGCGCTCTGG - Intergenic
997414111 5:133711873-133711895 TGCTGCCATGTGCTGGGCTCAGG + Intergenic
997662666 5:135601379-135601401 TGCTGCCATCCTGGGGAATCTGG + Intergenic
998644376 5:144045892-144045914 TGCCACCATCTTGGGAGCTCTGG + Intergenic
998666022 5:144298275-144298297 TGCCACCATCTTGGGAGCTCTGG + Intronic
999057580 5:148596508-148596530 TGCTGGCATTTTGGGGGCTGGGG + Intronic
1001141233 5:169145674-169145696 TCCTGCCAGCTTCTGGGCTCTGG + Intronic
1001219725 5:169890134-169890156 TGCTGCCAGCCTCGGGGCTCTGG + Intronic
1001701215 5:173707734-173707756 TGCTGCCATGCTGAGAGCTCTGG - Intergenic
1002439731 5:179258096-179258118 TGCTCTCATCCTGGGGGCTCTGG + Intronic
1006801195 6:36760658-36760680 TATTCCCATCATGGGGGCTCAGG - Intronic
1007518135 6:42429652-42429674 TGCTGTGTCCTTGGGGGCTCGGG - Intronic
1008582715 6:52921177-52921199 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1008896319 6:56560311-56560333 TGTTTCCATCTGGGGGCCTCAGG + Exonic
1009519496 6:64663757-64663779 TGCTGCCATCTTGGGGGCTCTGG - Intronic
1009702518 6:67202054-67202076 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1009914708 6:69979183-69979205 TGCTGACTTCTTGGAGGCTGTGG - Intronic
1011136527 6:84106448-84106470 TGGTGCCATATTGAGGACTCAGG + Intergenic
1013418066 6:109942189-109942211 TTCTTCCATTTTAGGGGCTCTGG - Intergenic
1014243405 6:119041998-119042020 CGCCACCATCTTGGGAGCTCTGG + Intronic
1014289175 6:119539252-119539274 TGCTGCCATCATGCGAGCTGCGG + Intergenic
1018174585 6:161167719-161167741 TGATGCCTTCTAGAGGGCTCTGG - Intronic
1018842326 6:167526316-167526338 TCCAGCCGTCTTGGGGGATCTGG - Intergenic
1019221988 6:170480211-170480233 TGCTGCCCTCTAGGAGGCTTTGG - Intergenic
1020906278 7:14067573-14067595 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1021021221 7:15600346-15600368 TCCTGTGCTCTTGGGGGCTCAGG - Intergenic
1021885279 7:25131590-25131612 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1022117720 7:27276828-27276850 TGCCACCATCTTGGGGGCTCTGG + Intergenic
1027868303 7:83674746-83674768 CTCTGCCATCTTGGAAGCTCTGG - Intergenic
1028993449 7:97075153-97075175 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1029154327 7:98504245-98504267 TGTTTTCTTCTTGGGGGCTCAGG - Intergenic
1030336875 7:108337789-108337811 CGCCACCATCTTGGGAGCTCTGG + Intronic
1030431310 7:109452518-109452540 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1030661210 7:112221373-112221395 TGCCACCATCTCGGGAGCTCTGG + Intronic
1031299634 7:120047827-120047849 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1031742766 7:125455583-125455605 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1032653905 7:133907025-133907047 AGCCACCATCTTGGGAGCTCTGG + Intronic
1033471463 7:141653359-141653381 TGCTGCTATTTTGTGAGCTCCGG + Exonic
1034830791 7:154305701-154305723 TCCTCCCAGCTTGGTGGCTCAGG - Intronic
1034964950 7:155385071-155385093 CGCCACCATCTTGGGAGCTCTGG - Intronic
1035090456 7:156305840-156305862 TGCTGCAAGCTTGGGGTCTGGGG + Intergenic
1035361395 7:158316058-158316080 TGATGTCATGTTGGGGACTCAGG - Intronic
1035564874 8:634932-634954 GGCTGCCCTCTTGGTGCCTCTGG + Intronic
1036571040 8:9980047-9980069 CCCTGCCATCATGGAGGCTCTGG - Intergenic
1036594740 8:10201404-10201426 AGCTGCCATCTTGGGAGTCCTGG - Intronic
1037123363 8:15316661-15316683 CGCGGCCATCGTGGGAGCTCTGG - Intergenic
1037170751 8:15888811-15888833 TGCTTCCATCTAGGCAGCTCTGG + Intergenic
1037635703 8:20699853-20699875 TTCTCCCATCTTCGGGGCTGTGG + Intergenic
1038068141 8:23984569-23984591 TGCTGCCATCTGCTGGGCACTGG + Intergenic
1038818755 8:30932833-30932855 TTCTGCCCTCTTGGAGTCTCAGG + Intergenic
1041561616 8:59225536-59225558 TGCTGCCATCTTTGCTGTTCAGG + Intergenic
1043336810 8:79186167-79186189 TGCTGGCATGTTGGGCACTCAGG + Intergenic
1045657649 8:104403462-104403484 TGCCACCATCTTGGGAGCTCTGG + Intronic
1047618372 8:126581661-126581683 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1048080145 8:131117953-131117975 TCCTACCATCTTGGGTGCCCTGG - Intergenic
1048315262 8:133357008-133357030 TGCTGCCTTCTTAGGAGGTCTGG - Intergenic
1048631544 8:136247986-136248008 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1049021633 8:139961278-139961300 TGCTGCCATCATGCCGGCTGTGG + Intronic
1049302843 8:141880733-141880755 TGCTGTCATGTTGTGAGCTCAGG - Intergenic
1049484408 8:142846147-142846169 AGCTGCCATCTTTAGGCCTCTGG - Intronic
1049542730 8:143215781-143215803 TGCAGCCCTCATGGGGGCTGGGG + Intergenic
1050115991 9:2264247-2264269 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1051699128 9:19801059-19801081 GGCCACCATCTTGGGAGCTCTGG - Intergenic
1051867444 9:21697071-21697093 TGCGGCAAGCTTGGGGGCTCAGG + Intergenic
1051970117 9:22877736-22877758 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1052056732 9:23914894-23914916 TGCTGCCATAGTGGGAGCCCAGG + Intergenic
1052398761 9:27974214-27974236 TGCTGTCATGTTAGGGGTTCAGG + Intronic
1052854466 9:33398481-33398503 CGCTGCCATCTCTGTGGCTCAGG - Intronic
1053007364 9:34612972-34612994 TGCTGCCCCCTTGTGGTCTCAGG - Intergenic
1053276010 9:36783768-36783790 TCCTTCCATTTTGGGGGTTCAGG - Intergenic
1053281656 9:36824189-36824211 TGCTGCCATCTTGGGCCTTGGGG + Intergenic
1055049266 9:71963293-71963315 TGCCACCATCTTGGGAGCTCTGG - Intronic
1055431288 9:76246861-76246883 TGCCACCATCTTAGGAGCTCTGG - Intronic
1055455755 9:76469946-76469968 TGCCACCATCTTGGGAGCTCTGG + Intronic
1056186900 9:84143820-84143842 TTCTGCCTTCATTGGGGCTCAGG + Intergenic
1057023496 9:91718725-91718747 TGCTGCCATCTTGGGGGCGGTGG + Intronic
1057444251 9:95102930-95102952 TGCAGCCAGCACGGGGGCTCCGG + Intronic
1057814195 9:98282067-98282089 AGCTGCCAGCCTGGAGGCTCTGG - Intergenic
1058077569 9:100666939-100666961 TCCTGCACTCTTGGGGGCTCAGG + Intergenic
1058557744 9:106187621-106187643 TTCTGCCATCTTGGCTCCTCCGG + Intergenic
1059681610 9:116591194-116591216 TGACGCCCTCTTTGGGGCTCTGG + Intronic
1059936647 9:119318597-119318619 TGCTTGCCACTTGGGGGCTCTGG - Intronic
1059991635 9:119870763-119870785 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1060240506 9:121898540-121898562 GGCTGCCAGTGTGGGGGCTCTGG + Intronic
1061855247 9:133438402-133438424 TGTGGCCATCTTGGAGGCTGGGG - Intronic
1062079181 9:134611443-134611465 TACTGCCACCTTGGGGGGACTGG - Intergenic
1062403735 9:136383708-136383730 TGCTGCCATCATGGGTGAACCGG - Intronic
1062598798 9:137310996-137311018 TGTGGCCATGTTGGGGGCACCGG + Intronic
1062656702 9:137607334-137607356 TGCTGTCCTCCTGGGGGCTGAGG - Intronic
1062708016 9:137955882-137955904 TGCTGCCAGCTGGGGTGCCCTGG + Intronic
1186208153 X:7221579-7221601 TGGTGCCATCTTGAGCTCTCTGG - Intronic
1187613878 X:20972193-20972215 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1188363603 X:29286821-29286843 TGCTACCATTTGGGGGGCACTGG - Intronic
1188573334 X:31616241-31616263 GTCTTCCAGCTTGGGGGCTCAGG + Intronic
1189954213 X:46261640-46261662 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1190360720 X:49645629-49645651 TGCTGCCATCATAGTCGCTCTGG + Intergenic
1190438125 X:50448214-50448236 TACTTCCATCTTGCAGGCTCTGG + Intronic
1191167434 X:57405221-57405243 CGCCACCATCTTGGGAGCTCTGG - Intronic
1191184126 X:57592189-57592211 GCCCGCCATCTTGGGGGCCCCGG - Exonic
1191213262 X:57910258-57910280 GCCCGCCATCTTGGGGGCCCCGG + Exonic
1192502488 X:71663115-71663137 AGCTGCCACCTTTGGAGCTCCGG - Intergenic
1192509691 X:71714491-71714513 AGCTGCCACCTTTGGAGCTCCGG - Exonic
1192517006 X:71767062-71767084 AGCTGCCACCTTTGGAGCTCCGG + Exonic
1192522437 X:71814556-71814578 TGCTGGCTTCTTGGGGCTTCCGG - Intergenic
1193295429 X:79827207-79827229 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1193687429 X:84594585-84594607 TTCTGCCATCTTTGGGGCTTTGG - Intergenic
1194200710 X:90950590-90950612 CACCGCCATCTTGGGAGCTCTGG - Intergenic
1194766583 X:97849085-97849107 TGCCGCCATCTTGGGTCCTGGGG - Intergenic
1196772470 X:119308838-119308860 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197545267 X:127816244-127816266 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197972438 X:132129623-132129645 TGCTGCTATTTTGAGAGCTCCGG - Intergenic
1198862388 X:141084644-141084666 TGCCGCCATCTTGGTAGCTCTGG + Intergenic
1198900306 X:141502742-141502764 TGCCGCCATCTTGGTAGCTCTGG - Intergenic
1199268727 X:145858161-145858183 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1199614681 X:149647419-149647441 ACCTGCCCTCTTGGGGGCCCAGG + Intergenic
1200546700 Y:4527023-4527045 CACCGCCATCTTGGGAGCTCTGG - Intergenic
1200762739 Y:7054945-7054967 TGCCACCATCTTGGGAGCTCTGG + Intronic
1201500828 Y:14640801-14640823 TGCTGCTATTTTGTGAGCTCTGG + Intronic
1201581978 Y:15519198-15519220 CCCTACCATCTTGGGAGCTCTGG - Intergenic
1202062426 Y:20901162-20901184 CGCCACCATCTTGGGAGCTCTGG + Intergenic