ID: 1009520944

View in Genome Browser
Species Human (GRCh38)
Location 6:64681587-64681609
Sequence GAATCACTTTTAGCGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520944_1009520954 22 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210
1009520944_1009520949 -9 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG 0: 1
1: 1
2: 20
3: 222
4: 1110
1009520944_1009520951 0 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520951 6:64681610-64681632 ACGGCCGGGCGCGGTGGCTCAGG No data
1009520944_1009520950 -6 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520950 6:64681604-64681626 TGATTCACGGCCGGGCGCGGTGG No data
1009520944_1009520956 25 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG No data
1009520944_1009520953 21 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520953 6:64681631-64681653 GGCCTGTAATCCCAACATTTTGG 0: 23
1: 1812
2: 35085
3: 267994
4: 282689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520944 Original CRISPR GAATCACTTTTAGCGAGGCC AGG (reversed) Intronic