ID: 1009520944

View in Genome Browser
Species Human (GRCh38)
Location 6:64681587-64681609
Sequence GAATCACTTTTAGCGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520944_1009520954 22 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210
1009520944_1009520950 -6 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520950 6:64681604-64681626 TGATTCACGGCCGGGCGCGGTGG No data
1009520944_1009520951 0 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520951 6:64681610-64681632 ACGGCCGGGCGCGGTGGCTCAGG 0: 6
1: 94
2: 540
3: 1606
4: 3081
1009520944_1009520949 -9 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG 0: 1
1: 1
2: 20
3: 222
4: 1110
1009520944_1009520956 25 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG 0: 1570
1: 37199
2: 335401
3: 258215
4: 188863
1009520944_1009520953 21 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520953 6:64681631-64681653 GGCCTGTAATCCCAACATTTTGG 0: 23
1: 1812
2: 35085
3: 267994
4: 282689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520944 Original CRISPR GAATCACTTTTAGCGAGGCC AGG (reversed) Intronic
903163912 1:21508225-21508247 GAACCAATTTTAGCCAGGTCAGG - Intergenic
904513727 1:31036486-31036508 GGATCACTTGAGGCGAGGCCAGG + Intronic
908221329 1:62009792-62009814 AAACCACTTTTGGCCAGGCCTGG + Intronic
909361070 1:74759435-74759457 CAATCACTTCTGGCCAGGCCAGG - Intronic
918468112 1:184842456-184842478 GAATCACTTGTGGTAAGGCCGGG + Intronic
919455782 1:197818383-197818405 GAATCACCTCTAGCTAGGGCTGG - Intergenic
1072631309 10:97148826-97148848 GAATAACTTTTAGGGAGGTGAGG - Intronic
1072934771 10:99701576-99701598 AAATCACTTTTGGCCGGGCCCGG - Intronic
1080243914 11:30158240-30158262 GAATCAGGTTTAGCCAGGCTAGG - Intergenic
1082869692 11:57932572-57932594 CAATCACTTTCTGCGAGACCTGG - Intergenic
1084914704 11:72420053-72420075 AAAACACTTTTAGCCAGGCGTGG + Intronic
1094327847 12:29259173-29259195 GGATCACCTTTAGCAAAGCCTGG + Intronic
1096373998 12:51092535-51092557 GGATCACTTTAAGCCAGGTCAGG - Intergenic
1099210047 12:79773271-79773293 GAGGCACTTTTAGCCAGGCATGG - Intergenic
1112838092 13:103541561-103541583 GAATCAATTTCATCAAGGCCTGG - Intergenic
1118855813 14:69621312-69621334 GAGTCATTTGTAGGGAGGCCTGG + Intronic
1124065783 15:26342442-26342464 GAATCACTTGTAGGGAGCCATGG - Intergenic
1124136891 15:27042831-27042853 GCATCACTCTTAGCAGGGCCAGG + Intronic
1127814633 15:62597056-62597078 GAATCAGCTTTAGGGAGGCAGGG - Intronic
1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG + Exonic
1130976083 15:88776349-88776371 GAATCACTTGAAGCCAGGCATGG + Intergenic
1131253263 15:90844849-90844871 GAACCAGTTTTAGCCAGGCGTGG - Intergenic
1142126572 16:88413555-88413577 GAATCACTTCTCCAGAGGCCTGG - Intergenic
1142719587 17:1767221-1767243 GAAGCACTTTTAACAAGTCCAGG + Intronic
1159993150 18:74934516-74934538 TAATCACTTTTAGCTGGGCATGG + Intronic
928398813 2:30963537-30963559 TAAACACTGTTAGGGAGGCCTGG + Intronic
928420145 2:31132052-31132074 GAATCTCTTTTAGTCAGGCTGGG - Intronic
930835794 2:55792289-55792311 GGAGCTCTTTTAGGGAGGCCTGG + Intergenic
931046441 2:58359266-58359288 GAATCCCTTGCAGCAAGGCCTGG + Intergenic
932627505 2:73309238-73309260 GAGTCACCTTGAGCAAGGCCTGG - Intergenic
932901295 2:75703737-75703759 GAATCACTGGTATAGAGGCCTGG - Intronic
942927069 2:181446613-181446635 GAATCACTTTAACCCAGGCTTGG + Intergenic
946820477 2:223623992-223624014 GTATCACTTTTACCTGGGCCAGG + Intergenic
1170710338 20:18785058-18785080 GAATTACTTCTACTGAGGCCTGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1173245758 20:41336372-41336394 GAATCACTGTTAGCCTGGCATGG + Intergenic
1177778439 21:25595995-25596017 GAAACATTTTTAGCGTGTCCTGG - Intronic
1179829331 21:43986282-43986304 GGAACACTTTTAGGGAGCCCAGG + Exonic
1182371086 22:29811532-29811554 TAACCACTTTCAGAGAGGCCTGG + Intronic
952415008 3:33082186-33082208 TTATCACTCTTAGGGAGGCCAGG + Intronic
955040682 3:55314809-55314831 GAATCACTTGTTTCAAGGCCAGG - Intergenic
964584424 3:158280935-158280957 GAATCACTTTGGGCCAGGCGCGG - Intronic
966082214 3:176017955-176017977 GGAGCTCTTTTAGCCAGGCCTGG - Intergenic
969990183 4:11254032-11254054 GGATCACTTCTAGTGAGGCAAGG - Intergenic
972497398 4:39646803-39646825 GAATAACTTTTGGCCAGGCTTGG + Intergenic
973734431 4:53856572-53856594 GAATGACTTGTAGGGAGGGCTGG + Intronic
980154119 4:129083499-129083521 AAATCACTTTTGGCCAGGCATGG + Intronic
980677717 4:136110706-136110728 GTATCACTTGAGGCGAGGCCAGG - Intergenic
981435545 4:144716959-144716981 GAATCATTTGTAGCAAGGTCTGG - Intronic
983113258 4:163780314-163780336 GAATCACTCTTTGCCAGGACAGG + Intronic
984953446 4:185023154-185023176 GATTGACTTTTAGCCAAGCCTGG - Intergenic
987432758 5:17856633-17856655 AAATCTCTTTTAGAGGGGCCTGG - Intergenic
987903789 5:24050136-24050158 GATTCACTTTTGGCTAGGACTGG - Intronic
998555136 5:143115780-143115802 GAAACAGGTTTAGAGAGGCCAGG + Intronic
999028424 5:148261932-148261954 AAAACACTTTTTGCAAGGCCTGG - Intergenic
1006747302 6:36352323-36352345 GAGTGAATTTTAGCCAGGCCTGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1009532288 6:64833842-64833864 GAATCACTTTTACAGAATCCTGG + Intronic
1024161467 7:46680659-46680681 GAATCACTTAGAAGGAGGCCTGG + Intronic
1027480804 7:78694217-78694239 GAATGATTTTTAGGGAGACCTGG - Intronic
1029971490 7:104793950-104793972 GAATCACTCTTAGAGAGGCTCGG + Intronic
1041065268 8:54076665-54076687 GAATGCCTTTAAGCGGGGCCAGG - Intronic
1042046635 8:64660366-64660388 GAATCACTCTAAGCCATGCCTGG - Intronic
1048043146 8:130749986-130750008 GAATCCTTTTTATAGAGGCCTGG + Intergenic
1048926942 8:139279946-139279968 GAATCACTTTGATTGAGGCCAGG - Intergenic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1050012390 9:1198317-1198339 GAATAACTTTGAGCAAGACCTGG + Intergenic
1050288661 9:4130727-4130749 GAACCACTTCTAGGGAGGCGTGG + Intronic
1050913307 9:11101532-11101554 GAATTATTTTTAGCCAGGCATGG + Intergenic
1051786415 9:20749169-20749191 GAATCCCTTTTAGAGAGCCAGGG - Intronic
1053726425 9:41006475-41006497 GAAGCTCTTTTAGGCAGGCCTGG + Intergenic
1059930764 9:119258379-119258401 GAAGCACTGTTATCGAGGGCAGG + Intronic
1195572710 X:106414324-106414346 GATTCACTTTTGGCCAGGCCCGG - Intergenic
1197867160 X:131031150-131031172 GAAGCACTTTAGTCGAGGCCTGG + Intergenic