ID: 1009520949

View in Genome Browser
Species Human (GRCh38)
Location 6:64681601-64681623
Sequence AAGTGATTCACGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1354
Summary {0: 1, 1: 1, 2: 20, 3: 222, 4: 1110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520943_1009520949 3 Left 1009520943 6:64681575-64681597 CCGCAATGATCACCTGGCCTCGC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG 0: 1
1: 1
2: 20
3: 222
4: 1110
1009520944_1009520949 -9 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG 0: 1
1: 1
2: 20
3: 222
4: 1110
1009520940_1009520949 28 Left 1009520940 6:64681550-64681572 CCACTAGGAATGTCAGGTGATGG 0: 26
1: 51
2: 80
3: 97
4: 252
Right 1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG 0: 1
1: 1
2: 20
3: 222
4: 1110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520949 Original CRISPR AAGTGATTCACGGCCGGGCG CGG Intronic
900281011 1:1868892-1868914 AAGTTATTTACAGCCAGGCGTGG + Intronic
901342996 1:8512321-8512343 GAGTGTTTCCTGGCCGGGCGCGG - Intronic
901644993 1:10712053-10712075 AAGTGATTACAGGCCGGGCGTGG + Intronic
901831837 1:11897736-11897758 AATTGTCTCAAGGCCGGGCGCGG + Intergenic
901896347 1:12316103-12316125 AAATGTTTCTCGGCCGGGCACGG - Intronic
901900979 1:12362151-12362173 AACTTATTCATGGCCGGGTGTGG - Intronic
902207878 1:14883003-14883025 AAGTGGTTCTTGGCCGGGCACGG + Intronic
902308145 1:15559226-15559248 AAGTCAGTCATGGCCGGACGTGG - Intronic
902499984 1:16904299-16904321 AAGTCTTTCTTGGCCGGGCGCGG - Intronic
903120174 1:21211122-21211144 AAGTGATTGGGGGCCAGGCGCGG - Intergenic
903273451 1:22206474-22206496 ACGTCATTCATGGCCGGGTGCGG - Intergenic
903434403 1:23335825-23335847 AAGTCTATCACAGCCGGGCGCGG + Intronic
903521257 1:23951987-23952009 AAGAAATTCACCGCCAGGCGAGG + Intergenic
903533941 1:24054005-24054027 AATTCACTCATGGCCGGGCGTGG + Intergenic
903826880 1:26152286-26152308 AAGTTATTCAAGGCCGGGCATGG - Intergenic
903887300 1:26547877-26547899 AAATAAGTCAAGGCCGGGCGCGG + Intronic
903979744 1:27177158-27177180 AACTGCTTGACGGCCGGCCGCGG - Intergenic
904079952 1:27865883-27865905 AAATGATTAAGGGCCAGGCGCGG - Intergenic
904138097 1:28329576-28329598 AAGAGAGCCAAGGCCGGGCGCGG - Intronic
904215096 1:28913156-28913178 AAATGAGGCACAGCCGGGCGCGG + Intronic
904517337 1:31066306-31066328 AATAGATTGAAGGCCGGGCGCGG + Intergenic
904583083 1:31562340-31562362 AAGATAATCAGGGCCGGGCGCGG - Intergenic
905717945 1:40169324-40169346 AAGTGCTTCTCGGCCGGGCGCGG + Intronic
906121135 1:43391789-43391811 AAATGAAACAAGGCCGGGCGCGG + Intronic
906161050 1:43649525-43649547 AAGCAATTCCTGGCCGGGCGTGG - Intergenic
906262404 1:44404317-44404339 AAGTCATTCCTGGCCGGGCGCGG - Intergenic
906428293 1:45732953-45732975 AAATGTTTCAAGGCCGGGCACGG - Intronic
906496062 1:46304673-46304695 AAATGAATTAGGGCCGGGCGCGG - Intronic
906736355 1:48132848-48132870 AAATGATTTAAGGCCGGGCGCGG - Intergenic
906990458 1:50731656-50731678 AAGTGTTTTGAGGCCGGGCGCGG - Intronic
907146196 1:52234069-52234091 AAGTGAATCTTGGCCAGGCGTGG - Intronic
907233299 1:53021297-53021319 AAGTGGTTGACGGCCAGGCATGG - Intronic
907389708 1:54150302-54150324 AAATTATTAACGGCCAGGCGTGG + Intronic
907669600 1:56463062-56463084 AAAGCATTCATGGCCGGGCGCGG - Intergenic
907835039 1:58101024-58101046 AAGCCAGTCACAGCCGGGCGCGG + Intronic
908201896 1:61806327-61806349 AGATGAGTCAAGGCCGGGCGCGG + Intronic
908296937 1:62721848-62721870 AAGAAATTGGCGGCCGGGCGTGG + Intergenic
908328272 1:63044819-63044841 TAATGAGTCTCGGCCGGGCGCGG + Intergenic
908362782 1:63385499-63385521 CAGTGGCTCAAGGCCGGGCGTGG - Intronic
908651581 1:66338726-66338748 AAGCTATTCTTGGCCGGGCGCGG + Intronic
909660618 1:78077896-78077918 TAGTGTATCACGGCCGGGCGCGG + Intronic
909877288 1:80823874-80823896 AAGGGATAGGCGGCCGGGCGCGG + Intergenic
910084158 1:83379137-83379159 AAGTAATTTAAGGCCAGGCGCGG + Intergenic
910410162 1:86934635-86934657 AACTGATTTTCGGCCGGGCACGG + Intronic
910499226 1:87870590-87870612 AAATAATTGTCGGCCGGGCGCGG + Intergenic
910871618 1:91838757-91838779 AAGAGATTTGCGGCCGGGCGCGG - Intronic
910879589 1:91910981-91911003 AAATAAATAACGGCCGGGCGCGG - Intergenic
910881212 1:91923801-91923823 AAGTTATTCCTGGCCGGGCGCGG - Intergenic
910995955 1:93104864-93104886 CAGACATTCTCGGCCGGGCGCGG + Intronic
911364443 1:96919761-96919783 AATAAATTCCCGGCCGGGCGCGG - Intergenic
911766118 1:101677146-101677168 AAGTACTTAGCGGCCGGGCGCGG + Intergenic
911933214 1:103931727-103931749 TAAGAATTCACGGCCGGGCGCGG - Intergenic
912599578 1:110915193-110915215 AATAAATTTACGGCCGGGCGCGG + Intergenic
912835041 1:112988804-112988826 CAGTGGTTCTCGGCCGGGCGTGG + Intergenic
913478174 1:119259002-119259024 AAGAGGTTTATGGCCGGGCGTGG - Intergenic
913528385 1:119714574-119714596 ATGTGTTTCTTGGCCGGGCGCGG + Intronic
913600593 1:120417889-120417911 AAGTGAATCACAGCCGGGTGGGG - Intergenic
913714337 1:121519134-121519156 AACTGATGGAAGGCCGGGCGCGG + Intergenic
914086463 1:144458747-144458769 AAGTGAATCATAGCCGGGTGGGG + Intronic
914192359 1:145422696-145422718 AAGTGAATCATAGCCGGGTGGGG + Intergenic
914194447 1:145438328-145438350 ATGACATTCCCGGCCGGGCGCGG + Intergenic
914311865 1:146473624-146473646 AAGTGAATCATAGCCGGGTGGGG - Intergenic
914475776 1:148021210-148021232 ATGACATTCCCGGCCGGGCGCGG + Intergenic
914590266 1:149100641-149100663 AAGTGAATCACAGCCGGGTGGGG + Intronic
914803388 1:150975569-150975591 AAGTGTTTTCCGGCCGGGCGCGG + Intergenic
914819742 1:151091765-151091787 AATTGTTTTAGGGCCGGGCGTGG - Intronic
914868900 1:151457634-151457656 AAGTAAAACCCGGCCGGGCGCGG + Intronic
915015647 1:152730728-152730750 AAGTGAATCTCGACCAGGCGTGG + Intergenic
915130896 1:153694713-153694735 AAGAGATTCTCGGCCGGGTGTGG - Intergenic
915391089 1:155544575-155544597 AAGGGTTTCTCGGCCGGGCACGG - Intronic
915463695 1:156083510-156083532 AACCTATTCAGGGCCGGGCGCGG + Intronic
916090073 1:161301133-161301155 AATTTATTTATGGCCGGGCGCGG + Intergenic
916393511 1:164359484-164359506 AAGAAATTCTAGGCCGGGCGCGG - Intergenic
916991840 1:170252702-170252724 AAGTTGTTCACGGCCAGGCGCGG - Intergenic
917136842 1:171796155-171796177 AAGTGATTCCCAGCTGGGCACGG - Intronic
917298786 1:173550725-173550747 AAATGATACAGGGCTGGGCGTGG - Intronic
917376380 1:174352096-174352118 GAGTACTTCCCGGCCGGGCGTGG - Intronic
917850893 1:179062984-179063006 AAGTGAGTTCAGGCCGGGCGCGG + Intronic
918001473 1:180501606-180501628 ATGTGATGCAGGGCTGGGCGTGG - Intronic
918240207 1:182614370-182614392 AAGTGTTTTGAGGCCGGGCGCGG + Intergenic
918404180 1:184195228-184195250 TAGTGATTATTGGCCGGGCGTGG + Intergenic
918646258 1:186909262-186909284 AAGAAATTAAAGGCCGGGCGCGG - Intronic
918868717 1:189937816-189937838 AAAAGGTTCCCGGCCGGGCGCGG - Intergenic
918898427 1:190379707-190379729 AAGAGATTTAGGGCTGGGCGCGG + Intronic
919107934 1:193177231-193177253 ACATGATCCTCGGCCGGGCGCGG + Intronic
919438274 1:197591818-197591840 AAGTGTATCACGGCCGGGCGCGG + Intronic
920396662 1:205651499-205651521 AAATGATAGAAGGCCGGGCGCGG + Intergenic
920408754 1:205741009-205741031 AAGTCACACACGGCCGGGCGCGG + Intronic
920506107 1:206516745-206516767 ATATGAGTCACGGCCAGGCGTGG - Intronic
921170042 1:212539017-212539039 TAGATATTCACGACCGGGCGTGG + Intergenic
921209152 1:212877501-212877523 AAGACATTCATGGCCAGGCGCGG - Intronic
921342266 1:214145989-214146011 AAGTGAATCAAGGCCAGGCGTGG + Intergenic
921597863 1:217074337-217074359 AAGGGATTCATGGCTGGGCGCGG - Intronic
921862613 1:220055314-220055336 AAGTTATTTTCGGCCGGGTGTGG + Intergenic
922425811 1:225491431-225491453 AAATGTTTCATGGCCGGGCATGG - Exonic
922611391 1:226931692-226931714 ATGTGATTGACGGCCAAGCGTGG - Intronic
922637611 1:227191051-227191073 AAGAAATTCAAGGCCGGGCACGG + Intronic
923357117 1:233169354-233169376 ATGTGACACAGGGCCGGGCGCGG + Intronic
923481200 1:234385786-234385808 AAGTGAAGCCTGGCCGGGCGTGG - Intergenic
923711391 1:236390263-236390285 AACTTACTCATGGCCGGGCGTGG + Intronic
924100160 1:240595093-240595115 AAGTGAAGTATGGCCGGGCGTGG + Intronic
924366993 1:243305014-243305036 ATAAGAATCACGGCCGGGCGCGG + Intronic
924532928 1:244908671-244908693 AAATAATTCACGGCCAGGTGCGG - Intergenic
924600888 1:245488076-245488098 AAAAGATACATGGCCGGGCGTGG - Intronic
924748554 1:246862188-246862210 AAGTGCTTATAGGCCGGGCGCGG + Intronic
1063399151 10:5725107-5725129 GGATGATTCACGGCCAGGCGTGG + Intronic
1063462573 10:6223905-6223927 AAATGAGACACGGCCAGGCGTGG - Intronic
1063502498 10:6567940-6567962 AAGTGATTATAGGCTGGGCGTGG + Intronic
1063540938 10:6933060-6933082 AAATGCTTCACGACCCGGCGCGG - Intergenic
1063605500 10:7519922-7519944 AAGAAATTGAAGGCCGGGCGCGG + Intergenic
1063804138 10:9618774-9618796 ATGTCATTAAGGGCCGGGCGCGG + Intergenic
1064125038 10:12652066-12652088 AAGTTATTTCCGGCCGGGCGCGG - Intronic
1065531255 10:26672273-26672295 AAATGCATCACGGCCGGGCATGG - Intergenic
1065618735 10:27556342-27556364 AAATCAGTCAAGGCCGGGCGCGG - Intergenic
1066187929 10:33028644-33028666 AAGTTGTTCAGGGCTGGGCGTGG - Intergenic
1066419794 10:35254165-35254187 CAGTCACTCAAGGCCGGGCGCGG - Intronic
1066674157 10:37871169-37871191 AAGAAATTCAAGGCTGGGCGCGG - Intergenic
1066685723 10:37979605-37979627 AAGTAATTTAAGGCTGGGCGTGG + Intergenic
1067072748 10:43147263-43147285 AAAAGATGCTCGGCCGGGCGCGG - Intronic
1067111826 10:43406798-43406820 GAGTCATTATCGGCCGGGCGAGG - Intronic
1067114020 10:43420927-43420949 AAGAGGCTCTCGGCCGGGCGCGG - Intergenic
1067311093 10:45114276-45114298 ATGTCATTCGCGGCTGGGCGTGG + Intergenic
1067520220 10:46994622-46994644 AAGAGCATCAGGGCCGGGCGCGG - Intronic
1068240319 10:54295852-54295874 AAGTGGTTGGTGGCCGGGCGCGG + Intronic
1068476760 10:57536937-57536959 AAGTACTTTAGGGCCGGGCGCGG + Intergenic
1068672571 10:59738829-59738851 AAGTAATTCCCGACCGGGCACGG + Intergenic
1069182116 10:65374532-65374554 CAGTGATTCTTGGCTGGGCGTGG - Intergenic
1069446226 10:68475471-68475493 AAGAAATTGAGGGCCGGGCGTGG - Intergenic
1069890096 10:71647170-71647192 AAGTGATTTCAGGCCGGGCTCGG + Intronic
1070160144 10:73861644-73861666 AAGAGATTCTGGGCCAGGCGCGG - Intronic
1070207024 10:74274269-74274291 AAGAAAATCATGGCCGGGCGTGG + Intronic
1070221869 10:74456382-74456404 AAGTCACTCAAGGCTGGGCGCGG + Intronic
1070473094 10:76803271-76803293 AAAAGATTCTCGGCCGGGCGCGG + Intergenic
1070608674 10:77918118-77918140 AAATGGTTCAAGGCCGGGTGCGG + Intronic
1070843139 10:79502050-79502072 AAGTGCATCACGGCCAGGTGTGG + Intergenic
1070930536 10:80257588-80257610 AAGTGCATCATGGCCAGGCGCGG - Intergenic
1071519807 10:86322699-86322721 AAATAATTCAAGGCCGGGCAAGG - Intronic
1071843907 10:89502158-89502180 AAGTGATGCCCGGCCGGGTGCGG + Intronic
1072115638 10:92367984-92368006 AAGTTGTGCACGGCCGGGCACGG - Intergenic
1072148735 10:92667530-92667552 AAGTTATACACGGCTGGGCACGG - Intergenic
1072271452 10:93781066-93781088 AAGTTATTATAGGCCGGGCGTGG + Intronic
1072281052 10:93865810-93865832 ATGTGATTCAGGGCCGGGCATGG + Intergenic
1072582549 10:96751859-96751881 GAATGATTTATGGCCGGGCGCGG - Intergenic
1073055281 10:100696169-100696191 AAGAGATTACCGGCCGGGCACGG + Intergenic
1073102009 10:101011329-101011351 ATGTAATTCTAGGCCGGGCGCGG - Intronic
1073156665 10:101353006-101353028 AAGTGATTTAGGGCCAGGCGCGG - Intergenic
1073414690 10:103370948-103370970 ATGTGATTGAAGGCCGGGCTCGG + Intronic
1073451770 10:103613964-103613986 AAGTGATTTGGGGCTGGGCGAGG + Intronic
1073613477 10:104968404-104968426 AAGTTGCTCAAGGCCGGGCGCGG - Intronic
1074465469 10:113678108-113678130 AAGAAATTCAAGGCCAGGCGCGG - Intergenic
1074552767 10:114460308-114460330 AAATGATTTAAGGTCGGGCGCGG + Intronic
1074670349 10:115783722-115783744 AAGTGATTCGGGGCCGGGCGCGG + Intronic
1075272819 10:121068182-121068204 AAGTGGTTTAAGGCTGGGCGCGG + Intergenic
1075451990 10:122557832-122557854 AAGCCATACATGGCCGGGCGCGG + Intergenic
1075669444 10:124254083-124254105 AATTGAGTCTTGGCCGGGCGAGG + Intergenic
1075752660 10:124786214-124786236 AAGAATTTCAGGGCCGGGCGTGG + Intronic
1075759128 10:124841864-124841886 AGGAGATTCTCGGCCGGGCGCGG - Intergenic
1075770168 10:124927744-124927766 AAGGGATTAAAGGCCTGGCGCGG + Intergenic
1075944116 10:126417906-126417928 AAATGATTACTGGCCGGGCGCGG + Intergenic
1076430334 10:130397575-130397597 ATGTGTTTCAAGGCCGGGCACGG + Intergenic
1076633160 10:131864794-131864816 AAGTAATTCATGGCCGGGTACGG - Intergenic
1076748409 10:132526741-132526763 AAGTGAATGTCGGCCGGGCGCGG - Intergenic
1076793023 10:132786649-132786671 ACGGGCCTCACGGCCGGGCGAGG + Intergenic
1077079131 11:715908-715930 AAGTGAATCAATGCCGGGCGCGG - Intronic
1077265560 11:1647604-1647626 AAGGAAGGCACGGCCGGGCGCGG + Intergenic
1077361107 11:2140457-2140479 AAGTGATTGATGGCGGAGCGAGG - Intronic
1077881752 11:6356104-6356126 ATGTGATACATAGCCGGGCGTGG + Intergenic
1077884640 11:6377797-6377819 AAGTGATATAAGGCCGGGCGCGG - Intergenic
1077995966 11:7453070-7453092 AGGAGTTTCAGGGCCGGGCGCGG - Intronic
1078177499 11:8981177-8981199 AAGTGAATGAAGGCCGGGTGCGG + Exonic
1078209038 11:9255298-9255320 AGGTTAAACACGGCCGGGCGCGG + Intronic
1079044942 11:17093552-17093574 AACTGAAGCATGGCCGGGCGCGG - Intronic
1079191271 11:18278549-18278571 AAGAGATTGTCGGCTGGGCGCGG - Intergenic
1079234541 11:18678741-18678763 AAATGATTCAAGGCTGGGCTTGG + Intergenic
1079724341 11:23861698-23861720 AACCCATTCCCGGCCGGGCGTGG - Intergenic
1079914330 11:26349836-26349858 AAACAATTCTCGGCCGGGCGTGG - Intronic
1080506281 11:32917075-32917097 GAGTCATGCCCGGCCGGGCGTGG - Intronic
1080640721 11:34156812-34156834 AAGTTACTCACAGCCGGGCACGG - Intronic
1081892278 11:46553231-46553253 AAGTGAATGGTGGCCGGGCGTGG - Intronic
1081979348 11:47257018-47257040 AATATATTCTCGGCCGGGCGCGG - Intronic
1082677013 11:56117668-56117690 AAATAATTGCCGGCCGGGCGTGG - Intergenic
1083280513 11:61624167-61624189 AAGTGATTGGAGGCCGGGCGCGG - Intergenic
1083285019 11:61652996-61653018 AAGAGATTCGGGGCCGGGTGCGG + Intergenic
1083390773 11:62348411-62348433 AAGGGGGTCATGGCCGGGCGTGG + Intronic
1083541968 11:63517751-63517773 AAGAGACTCCAGGCCGGGCGAGG + Intergenic
1084003362 11:66310776-66310798 AAGTGCTTCAAGGCTGGGCATGG + Intergenic
1084011867 11:66355472-66355494 AAGTTATGCTTGGCCGGGCGCGG - Intronic
1084027530 11:66461286-66461308 AAGTGATTCTGGGCTGGGCGTGG - Intronic
1084074717 11:66764361-66764383 AAGTGAAAATCGGCCGGGCGCGG + Intronic
1084117557 11:67050823-67050845 AGGTGATTCAGGGCCGAGCAGGG - Exonic
1084202277 11:67568451-67568473 AAGAGATACTAGGCCGGGCGCGG + Intergenic
1084322225 11:68379839-68379861 AAGTCACTCATGGCTGGGCGTGG + Intronic
1085433534 11:76478629-76478651 ATATTATTCACGGCCGGGCGCGG - Intronic
1085663275 11:78389595-78389617 AAGAAAACCACGGCCGGGCGCGG - Intronic
1086122080 11:83314936-83314958 AAGAGATCCTTGGCCGGGCGCGG + Intergenic
1086228181 11:84537394-84537416 AAGTAATTCAGGGCTGGGTGCGG - Intronic
1086316131 11:85594775-85594797 AAATGATTCAAGGCCGGGCACGG + Intronic
1086721168 11:90123276-90123298 AAGAGATTCCAGGCTGGGCGTGG - Intergenic
1086985397 11:93243175-93243197 AACAGATTTTCGGCCGGGCGCGG + Intergenic
1086997028 11:93369639-93369661 AATGGATTTACGGCCGGGCGCGG + Intronic
1087263776 11:96039654-96039676 AAGAGATCATCGGCCGGGCGCGG + Intronic
1087492581 11:98846846-98846868 AAGATATTCATGGCCAGGCGTGG - Intergenic
1088557195 11:111073690-111073712 AGCTGATTCTGGGCCGGGCGCGG - Intergenic
1088894425 11:114067058-114067080 AAGTGAGTGAAGGCCGGGCGGGG - Intronic
1088931049 11:114351013-114351035 AGGTGTTTCAAGGCCGGGCGTGG - Intergenic
1089104550 11:115991267-115991289 ATGTGTTTCTGGGCCGGGCGCGG - Intergenic
1089526276 11:119099132-119099154 GAGTAATTCATGGCCGGGTGCGG + Intronic
1090002289 11:122972138-122972160 AAGAGAGTAATGGCCGGGCGTGG + Intergenic
1090556303 11:127880025-127880047 ATGTGAATCACGGCCATGCGCGG - Intergenic
1090578856 11:128138282-128138304 AAGAAATTCATGGCCGGGCGTGG + Intergenic
1090620677 11:128558352-128558374 AAATGTTTCCTGGCCGGGCGCGG + Intronic
1090862071 11:130662978-130663000 AAGTGAAACATGGCCAGGCGCGG + Intergenic
1091238750 11:134038703-134038725 AAGTCATTCTTGGCCGGGCGCGG - Intergenic
1091382716 12:72752-72774 AAGGGAATCAGGGCCAGGCGTGG + Intronic
1092221078 12:6714230-6714252 AAATCATTCTCGGCTGGGCGTGG + Intergenic
1092455447 12:8638724-8638746 AAGTGACTCTAGGCCGGCCGCGG + Intronic
1092456013 12:8643465-8643487 AAGTGACACTTGGCCGGGCGCGG - Intronic
1092625112 12:10318553-10318575 AAGTTTTTCATGGCTGGGCGCGG + Intergenic
1092809654 12:12261128-12261150 AATTGAATCATGGCCGGGCGCGG + Intronic
1093030746 12:14286358-14286380 AAGAGATTTCAGGCCGGGCGTGG + Intergenic
1093333055 12:17866550-17866572 AAGAGGTTTACGGCCGGGCATGG - Intergenic
1093643725 12:21557607-21557629 AAGTAATTTCTGGCCGGGCGCGG + Intronic
1093816828 12:23558891-23558913 TAGTGATTCATGGCCGGGCACGG - Intronic
1094079136 12:26513129-26513151 AATTGTTTCCCGGCCGGGCGCGG - Intronic
1094613072 12:32012217-32012239 AAGTTAATGAAGGCCGGGCGCGG - Intergenic
1095248363 12:39947948-39947970 AAGAAATTCTCGGCCAGGCGCGG - Intronic
1095463014 12:42462086-42462108 AAGTTATATAGGGCCGGGCGCGG - Intronic
1095465408 12:42483679-42483701 AAGTGCGTCACGGCGGGGCGGGG - Intronic
1095998083 12:48106052-48106074 AAGGGGTTTCCGGCCGGGCGCGG + Exonic
1096059488 12:48684599-48684621 AAGTGGTTCTAGGCCGGGCATGG - Intergenic
1096234894 12:49919700-49919722 AAGAGACTTAAGGCCGGGCGCGG - Intergenic
1096406455 12:51347416-51347438 AAGGGAGTTGCGGCCGGGCGCGG + Intergenic
1096698949 12:53369645-53369667 AAATCATTTAAGGCCGGGCGCGG + Intergenic
1096831065 12:54314990-54315012 AAGATATACAAGGCCGGGCGTGG + Intronic
1097650053 12:62286645-62286667 ATGTGATACATGGCCGGGCGTGG + Intronic
1097888700 12:64755955-64755977 AAATAATTCATGGCCGGGCGCGG - Intronic
1098456719 12:70682331-70682353 AAGTGAACAACGGCCGGGCGCGG - Intronic
1098482777 12:70985184-70985206 AAGTTATTTTAGGCCGGGCGCGG + Intergenic
1098934350 12:76461176-76461198 AAGTGATTTAGGGCCTGGTGTGG - Intronic
1099245641 12:80190495-80190517 GAGTGAATCCAGGCCGGGCGCGG + Intergenic
1099912907 12:88854978-88855000 AAGAAATTGCCGGCCGGGCGCGG - Intergenic
1100010971 12:89952583-89952605 AAATGCTATACGGCCGGGCGCGG - Intergenic
1100046897 12:90393444-90393466 AAATGATTTTCGGCCGGGCACGG + Intergenic
1100322233 12:93506553-93506575 AAGACATTCTTGGCCGGGCGTGG - Exonic
1100335510 12:93625455-93625477 AATTTATTGAGGGCCGGGCGCGG + Intergenic
1100478541 12:94956104-94956126 AAAGGATTCAGGGCTGGGCGTGG + Intronic
1100490231 12:95072036-95072058 AAGTGGGTCGCGGCTGGGCGCGG - Intronic
1100514870 12:95317720-95317742 AAGTTAATCAAGGCCGGGCATGG + Intergenic
1100592009 12:96037978-96038000 AATTCTTTCTCGGCCGGGCGCGG - Intronic
1100671481 12:96817708-96817730 AAGGTATTTATGGCCGGGCGTGG - Intronic
1100822097 12:98441193-98441215 AATTTACTCATGGCCGGGCGTGG + Intergenic
1101003094 12:100375775-100375797 AAATGATTCACGGCAGTGCCTGG - Intronic
1101061815 12:100980028-100980050 AAGGATTTCTCGGCCGGGCGTGG - Intronic
1101154812 12:101917395-101917417 AAGTGCTTCTTGGCCGGGTGCGG + Intronic
1101247598 12:102899567-102899589 AAGTGAGTAACGGCCGGGCGCGG + Intronic
1101367560 12:104089220-104089242 AAATAATCCACGGCCAGGCGTGG + Intronic
1101753621 12:107603877-107603899 AAATGAGTGAGGGCCGGGCGTGG + Intronic
1101924961 12:108964062-108964084 AAGTTATTCAGGTCCGGGCAAGG + Intronic
1101960364 12:109244907-109244929 AAGTAATTTGCTGCCGGGCGTGG + Intronic
1102021731 12:109688000-109688022 ATGTGTTTCATGGCCGGGTGTGG - Intergenic
1102069337 12:110004323-110004345 AAGTGAATTCCAGCCGGGCGTGG + Intronic
1102160100 12:110761886-110761908 AAGAGATTACCGGCCAGGCGCGG - Intergenic
1102292278 12:111710771-111710793 AAAAGATTCACGGCCGGGCGTGG - Intronic
1102379818 12:112455108-112455130 AAAAGATTTAGGGCCGGGCGTGG - Intronic
1102643726 12:114389462-114389484 AAGTGGATGAAGGCCGGGCGCGG + Intronic
1102937918 12:116912751-116912773 GAATTATTCTCGGCCGGGCGCGG - Intronic
1103267513 12:119643476-119643498 AAGAGATTGGTGGCCGGGCGCGG + Intergenic
1103370606 12:120416431-120416453 ATGTGAATCATGGCTGGGCGCGG + Intergenic
1103452114 12:121036491-121036513 AACTCATTCTTGGCCGGGCGTGG + Intronic
1103549796 12:121728608-121728630 AAGTGAGTGTCGGCCGGGCGCGG - Intronic
1103643636 12:122373132-122373154 AAGTTAATAAGGGCCGGGCGTGG + Intronic
1103707507 12:122885971-122885993 TAATGTTTTACGGCCGGGCGCGG - Intronic
1103785320 12:123428424-123428446 AAGTAATTCAGGGCCGGGCGCGG - Intronic
1104699289 12:130889474-130889496 AACAGAATCACGGCTGGGCGCGG - Intergenic
1104882569 12:132082748-132082770 AATTAATTCATGGCCGGGTGCGG - Intergenic
1105058768 12:133129209-133129231 AATTGAGTCAGGGCCGGGTGCGG + Intronic
1105332105 13:19427371-19427393 AAGTGCCTCACGGCCGGGCACGG - Intronic
1105591218 13:21794672-21794694 AAGTCATTTAAGGCCGGGCGCGG - Intergenic
1105888282 13:24661549-24661571 ATGTGATATATGGCCGGGCGCGG - Intergenic
1106119395 13:26846387-26846409 AAGCCAGTCACGGCCGGGCATGG - Intergenic
1106131871 13:26947549-26947571 AATTGATTCATGGCAGGGTGTGG - Intergenic
1106196755 13:27500630-27500652 TATTGATCCACGGCCAGGCGTGG - Intergenic
1106324667 13:28676292-28676314 ATGTGATTCCCGGCCAGGCGCGG - Intronic
1106505457 13:30367431-30367453 AAGTACATCAAGGCCGGGCGCGG + Intergenic
1106511238 13:30414509-30414531 ACATGATTCAAGGCCAGGCGCGG - Intergenic
1106817846 13:33429304-33429326 ATGTGGTACAGGGCCGGGCGTGG + Intergenic
1107253634 13:38396013-38396035 AAATTATTCCCGGCCGGGCGCGG + Intergenic
1107275787 13:38677658-38677680 TATTGATTCATGGCCAGGCGCGG - Intergenic
1107891593 13:44919175-44919197 AAGTGAATATGGGCCGGGCGCGG + Intergenic
1107931975 13:45314372-45314394 AAATTACTCATGGCCGGGCGTGG + Intergenic
1108394994 13:49983233-49983255 AAAAGATTCTGGGCCGGGCGCGG + Intergenic
1108460350 13:50660168-50660190 AAGGTATGAACGGCCGGGCGCGG - Intronic
1108517604 13:51217791-51217813 AAGTGATTCAGGGCTGGGCGTGG + Intergenic
1108622171 13:52195228-52195250 AAGTGATTTTAGGCCGGGCGCGG + Intergenic
1108651618 13:52486297-52486319 AAGTGACTCAAGGCCAGGTGCGG + Intergenic
1108939824 13:55939018-55939040 AAGTCATCTAAGGCCGGGCGCGG + Intergenic
1108951631 13:56101064-56101086 AATAAATACACGGCCGGGCGTGG - Intergenic
1109170063 13:59083934-59083956 AACTAGTTCAAGGCCGGGCGCGG - Intergenic
1109226048 13:59697167-59697189 AGGGGATTCAGGGCCGGGCGCGG + Intronic
1109298573 13:60565343-60565365 AAGATACTGACGGCCGGGCGCGG - Intronic
1109892893 13:68641152-68641174 AAATATTTCAAGGCCGGGCGCGG + Intergenic
1110177911 13:72579413-72579435 AAGTGATTAAGGGCCGGGTGCGG - Intergenic
1110407455 13:75166845-75166867 AAATAATTCATGGCTGGGCGCGG - Intergenic
1110595610 13:77317646-77317668 AAGTGGGTCCCGGCCGGGCGCGG + Intronic
1110948205 13:81451365-81451387 AAGTGTTTACCGGCCGGGCGCGG + Intergenic
1111071732 13:83176926-83176948 AAGTGAAATAGGGCCGGGCGTGG - Intergenic
1111543511 13:89699733-89699755 AAATGACTCTTGGCCGGGCGCGG + Intergenic
1111763322 13:92494377-92494399 AAGTAATTCTTGGCCAGGCGCGG - Intronic
1112093854 13:96110712-96110734 ATGTGATCCCCGGCCAGGCGTGG - Intronic
1112433378 13:99372822-99372844 AAGTGTATCCAGGCCGGGCGCGG + Intronic
1112472585 13:99702338-99702360 AATTGGCTCACAGCCGGGCGCGG + Intronic
1112674196 13:101679194-101679216 AAGTGTTTCTCGGCCAGGCGCGG - Intronic
1113026313 13:105945061-105945083 AAGTGAAGAACGGCTGGGCGCGG - Intergenic
1113315306 13:109173603-109173625 AAGAGTGTCTCGGCCGGGCGCGG + Intronic
1113492251 13:110701352-110701374 AAGTGGTTCTTGGCCGGGCGTGG - Intronic
1113853623 13:113432006-113432028 AATTATTTCACGGCCAGGCGCGG - Intronic
1114143616 14:19947076-19947098 AAGTTAGATACGGCCGGGCGCGG + Intergenic
1114507597 14:23230362-23230384 AAGCCATTGCCGGCCGGGCGCGG + Intronic
1114860393 14:26511475-26511497 AAGAGCTTCCTGGCCGGGCGCGG + Intronic
1115007880 14:28508767-28508789 AAGAAACTCATGGCCGGGCGTGG - Intergenic
1115192252 14:30758125-30758147 AAGTAATTCATGGCCGGGCACGG - Intergenic
1115263208 14:31474103-31474125 AAAAGATTTGCGGCCGGGCGCGG - Intergenic
1115286743 14:31722298-31722320 ATGTGGTACATGGCCGGGCGTGG - Intronic
1115545105 14:34458734-34458756 AAGTCAATCTTGGCCGGGCGCGG - Intronic
1115659728 14:35480946-35480968 AAGCAAATCACGGCTGGGCGCGG - Intergenic
1115977459 14:39012754-39012776 AAGTGAATCAGGGCCAAGCGCGG + Intergenic
1115994305 14:39179601-39179623 AAGATATTCTAGGCCGGGCGTGG + Intronic
1116206962 14:41880215-41880237 AAAAGATTGAGGGCCGGGCGCGG - Intronic
1116850255 14:49901628-49901650 AACTTATTGATGGCCGGGCGCGG - Intergenic
1116947940 14:50853612-50853634 AAGGGAATCACGGCTGGGTGCGG + Intergenic
1117137801 14:52754501-52754523 AAGTGTTTCATGGCCAGGTGTGG - Intronic
1117354292 14:54908905-54908927 AAGTGATCCTCGGCCAGGCGTGG + Intergenic
1117361773 14:54982297-54982319 AAATTATTATCGGCCGGGCGCGG - Intronic
1117525163 14:56593975-56593997 AAGACACTCACGGCCGGGCGCGG - Intronic
1117532988 14:56677014-56677036 AAAGGACTCCCGGCCGGGCGCGG - Intronic
1118396115 14:65338089-65338111 AAGAAATTCAGGGCCGGGCACGG - Intergenic
1118525469 14:66635846-66635868 AAGTGATTTTAGGCCGGGCACGG + Intronic
1118831454 14:69437155-69437177 AAGGGATCCCAGGCCGGGCGCGG - Intronic
1118873302 14:69761302-69761324 AAGTGAGTTTAGGCCGGGCGCGG + Intronic
1119106324 14:71927946-71927968 AAAGGATTCTTGGCCGGGCGCGG - Intergenic
1119240727 14:73057447-73057469 AAATGATTACCGGCCGGGCGCGG - Intergenic
1119291821 14:73501413-73501435 AAATAATTTAAGGCCGGGCGCGG - Intronic
1119321406 14:73733295-73733317 AAGTAATTCAGGGCCGGGTGAGG + Intronic
1119557854 14:75567215-75567237 GAGTGAAGCACGGCCGGGCGCGG + Intergenic
1119839782 14:77783517-77783539 TAGTGATTATTGGCCGGGCGCGG + Intergenic
1120115922 14:80617523-80617545 ATGATATTCACGGCCGGGCGCGG - Intronic
1120116643 14:80626172-80626194 GAGTGAGACAGGGCCGGGCGCGG + Intronic
1120184073 14:81374307-81374329 AAGGGATTATTGGCCGGGCGTGG - Intronic
1120362547 14:83524212-83524234 AAAAGATTCTCGGCCGGGCGCGG + Intergenic
1120513782 14:85446241-85446263 AACTGGATCAGGGCCGGGCGCGG - Intergenic
1120721157 14:87891025-87891047 AAGTTATTCTAGGCTGGGCGTGG - Intronic
1120828674 14:88978523-88978545 CAAGGATTTACGGCCGGGCGCGG + Intergenic
1120996263 14:90420785-90420807 AAATGCATCACGGCTGGGCGCGG - Intergenic
1121178515 14:91909205-91909227 TACTGATTCCTGGCCGGGCGCGG - Intronic
1122559131 14:102598736-102598758 AACTGAATCAGGGCCAGGCGTGG - Intronic
1122731035 14:103798440-103798462 AAGAGATTCTTGGCCGGGTGTGG - Intronic
1123408339 15:20038160-20038182 TAGTAATCCTCGGCCGGGCGCGG + Intergenic
1123517663 15:21044811-21044833 TAGTAATCCTCGGCCGGGCGCGG + Intergenic
1123693039 15:22855120-22855142 AAATTATTCTGGGCCGGGCGTGG + Intronic
1123763854 15:23455355-23455377 AAGCCATACATGGCCGGGCGAGG - Intergenic
1123765983 15:23478598-23478620 AAAGTATTCCCGGCCGGGCGCGG - Intergenic
1124067060 15:26354413-26354435 AGGAGACTCAGGGCCGGGCGCGG + Intergenic
1124077935 15:26463173-26463195 AAGAACTTCACGGCCGGGCATGG + Intergenic
1124133828 15:27015675-27015697 AAATCAAACACGGCCGGGCGCGG - Intronic
1124435363 15:29644510-29644532 AAGTGAGTCCTGGCCGGGCGCGG + Intergenic
1124451945 15:29801749-29801771 AATTTATTTTCGGCCGGGCGCGG - Intronic
1124458200 15:29864101-29864123 AAGTTGTACCCGGCCGGGCGCGG + Intronic
1124908749 15:33897558-33897580 AATAAATTCATGGCCGGGCGCGG - Intronic
1125092160 15:35806427-35806449 AAGTTATTTACGGCCGGATGCGG - Intergenic
1125190796 15:36990233-36990255 AACTGCTTCCAGGCCGGGCGCGG - Intronic
1125463995 15:39933489-39933511 AAGAGTTTCCCGGCCGGGCGCGG + Intergenic
1125553529 15:40565650-40565672 CAGTGATAGACAGCCGGGCGCGG + Intergenic
1125702926 15:41704367-41704389 TAGTGATTAGCGGCCAGGCGCGG + Intronic
1125840817 15:42799724-42799746 AAGTAATGCAGGGCCGGGTGCGG - Intronic
1125957928 15:43803497-43803519 AGGTTAATCAGGGCCGGGCGTGG + Intergenic
1126009250 15:44287025-44287047 AAATTATTCTAGGCCGGGCGCGG - Intergenic
1126633131 15:50757370-50757392 AAAGGATTTAGGGCCGGGCGTGG - Intronic
1126892888 15:53225095-53225117 AAAAGTTTCAGGGCCGGGCGCGG + Intergenic
1127168193 15:56269944-56269966 AACTCACTCAGGGCCGGGCGCGG - Intronic
1127256807 15:57299828-57299850 ATGAGACCCACGGCCGGGCGTGG + Intergenic
1127492341 15:59476829-59476851 AACTGATACTTGGCCGGGCGTGG + Intronic
1127519043 15:59724950-59724972 GAGTGATTCAAGGCTGGGCATGG - Intergenic
1127884267 15:63185594-63185616 AACTGATTTTGGGCCGGGCGCGG + Intergenic
1127888963 15:63230590-63230612 AAGTGATAACAGGCCGGGCGTGG - Intronic
1128134614 15:65253618-65253640 AAGAGAATGAAGGCCGGGCGCGG - Intronic
1128475960 15:67997073-67997095 AAGTGGTTCTGGGCCGGGCACGG - Intergenic
1128691790 15:69729972-69729994 AAATAATTCCTGGCCGGGCGCGG - Intergenic
1128821281 15:70657318-70657340 AAGGAGTGCACGGCCGGGCGTGG + Intronic
1129000460 15:72329023-72329045 AAGCTATTCTTGGCCGGGCGTGG - Intronic
1129527522 15:76229990-76230012 AAGTGTTTCCTGGCCGGGCGCGG + Intronic
1129562625 15:76588210-76588232 AAGAGAGACAGGGCCGGGCGCGG - Intronic
1129827496 15:78643857-78643879 AAGAGATTCTAGGCCGGGCACGG + Intronic
1129947034 15:79548148-79548170 ATGTGATTCTCAGCTGGGCGTGG + Intergenic
1130005541 15:80093435-80093457 AAGTGATTCCTGGCTGGGCGCGG + Intronic
1130037328 15:80372768-80372790 AAGTGATATTGGGCCGGGCGCGG - Intronic
1130261699 15:82359452-82359474 AAGTGTTTCATGGCCTGGTGCGG + Intergenic
1130279535 15:82509560-82509582 AAGTGTTTCATGGCCTGGTGCGG - Intergenic
1130299676 15:82670398-82670420 AATGAATTCACGGCCAGGCGTGG - Intronic
1130334274 15:82945678-82945700 AAGTGGTAGATGGCCGGGCGCGG + Intronic
1130470914 15:84225742-84225764 AAGTGTTTCATGGCCTGGTGCGG - Intergenic
1130478403 15:84340310-84340332 AAGTGTTTCATGGCCTGGTGCGG - Intergenic
1130493362 15:84447820-84447842 AAGTGTTTCATGGCCTGGTGCGG + Intergenic
1130593203 15:85230381-85230403 AAGTGTTTCATGGCCTGGTGCGG - Intergenic
1131118261 15:89807408-89807430 AAATCATTCCCGGCTGGGCGTGG + Intronic
1131167100 15:90150150-90150172 AAGTGACCGACAGCCGGGCGCGG + Intergenic
1131211754 15:90503690-90503712 AAGTGCTTATCGGCCGGGCACGG + Intergenic
1131303119 15:91217165-91217187 TAGTTATTCAGGGCCAGGCGCGG - Intronic
1131390744 15:92046222-92046244 AAGTTATTGTCGGCTGGGCGTGG + Intronic
1132371901 15:101305415-101305437 GATTGTTTCAAGGCCGGGCGCGG + Intronic
1132412387 15:101592578-101592600 AACTTATTCATGGCCTGGCGTGG - Intergenic
1132594439 16:741859-741881 AAGTGAGTCGGGGTCGGGCGCGG - Intronic
1132945526 16:2529797-2529819 AAGGCATTCACGGCCTGGGGTGG + Intronic
1132946000 16:2531781-2531803 AAGTGACACCCGGCCGGGCGCGG - Intergenic
1133011855 16:2917517-2917539 AAATCATTAACGGCCGGGCATGG - Intronic
1133067282 16:3217589-3217611 TACTCATTCATGGCCGGGCGTGG - Intergenic
1133074850 16:3272061-3272083 AGGCAACTCACGGCCGGGCGTGG + Intronic
1133079045 16:3304124-3304146 AAGTAAATCCTGGCCGGGCGCGG - Intronic
1133122448 16:3618437-3618459 AAGTGTTTAAGGGCCAGGCGCGG + Intronic
1133274982 16:4632790-4632812 CAGTCACTCACGGCCAGGCGTGG + Intronic
1133291965 16:4728332-4728354 ATGTGAATCCCGGCTGGGCGCGG - Intronic
1133295414 16:4749522-4749544 AGGAGAATCATGGCCGGGCGCGG + Exonic
1133307905 16:4822677-4822699 AAGTAAATCCAGGCCGGGCGCGG - Intronic
1134118205 16:11565371-11565393 GAGTAATTCAAGGCCAGGCGCGG - Intronic
1134451682 16:14367787-14367809 AAGGTAGCCACGGCCGGGCGCGG + Intergenic
1134469884 16:14514474-14514496 AAGTGACTCTTGGCCAGGCGTGG - Intronic
1134528937 16:14967222-14967244 ATATGATTCTCGGCCGGGCATGG + Intergenic
1134603278 16:15550228-15550250 AAGTGCTTTTGGGCCGGGCGCGG - Intronic
1134855488 16:17515096-17515118 AATAGATTTGCGGCCGGGCGCGG - Intergenic
1135135080 16:19881489-19881511 AAGTCAATCATGGCCAGGCGCGG + Intronic
1135434126 16:22413928-22413950 AAGTAAGTCAAGGCTGGGCGTGG - Intronic
1135458480 16:22619724-22619746 AAGTGTTCATCGGCCGGGCGCGG - Intergenic
1135682314 16:24468251-24468273 AAATGATTAAGGGCCGGGCGTGG - Intergenic
1135717305 16:24782585-24782607 GAGTGATTTGAGGCCGGGCGTGG + Intronic
1135890058 16:26348920-26348942 AAGAGATTAGGGGCCGGGCGCGG - Intergenic
1135947887 16:26881342-26881364 AAAATATTCTCGGCCGGGCGCGG - Intergenic
1136097593 16:27968539-27968561 AAATGTTTTAGGGCCGGGCGTGG - Intronic
1136416252 16:30105791-30105813 AATTTATTTAGGGCCGGGCGCGG - Intronic
1136479018 16:30530117-30530139 TAGCTATTCTCGGCCGGGCGTGG - Intronic
1136521680 16:30800765-30800787 AAAGAATTCATGGCCGGGCGTGG - Intergenic
1137288682 16:47037351-47037373 AAGTATGTCCCGGCCGGGCGCGG - Intergenic
1137987620 16:53123151-53123173 AAGTGATTCCAGGCCGGGCGTGG - Intronic
1138325809 16:56166268-56166290 AAATGATTATGGGCCGGGCGTGG - Intergenic
1138612094 16:58133391-58133413 AAGAAATTCTCGGCCAGGCGCGG - Intergenic
1138827163 16:60334168-60334190 AAGAGACTCCAGGCCGGGCGCGG - Intergenic
1139103532 16:63799020-63799042 AAGATATTCTGGGCCGGGCGCGG + Intergenic
1139117537 16:63975195-63975217 GTCTGAATCACGGCCGGGCGCGG + Intergenic
1139554227 16:67696301-67696323 AAAAGATTCCCGGCCGGGCGCGG - Intronic
1139738988 16:69018436-69018458 AAGAGATTTCCGGCCGGGCGCGG - Intronic
1139789972 16:69426107-69426129 AAGTGCTTTCCGGTCGGGCGCGG + Intronic
1139867429 16:70073756-70073778 ATATGATTCTCGGCCGGGCATGG - Intergenic
1139892500 16:70262677-70262699 AAGGGCTTCGCGGCCGGGCGCGG + Intronic
1140074272 16:71682880-71682902 AAGTCATTCATGGCTAGGCGTGG + Intronic
1140074530 16:71685035-71685057 AAGAAATTCTCGGCCAGGCGTGG + Intronic
1140350775 16:74260312-74260334 ATGGTATTCACGGCCGGGCGTGG + Intergenic
1140412294 16:74748482-74748504 AAGTGATTGCTGGACGGGCGGGG + Intronic
1140508795 16:75492556-75492578 AAATAACTCAGGGCCGGGCGCGG + Intronic
1140538287 16:75731272-75731294 AATTGAATCATGGCCGGGCGTGG + Intronic
1140996934 16:80269721-80269743 AAATGTTTCTAGGCCGGGCGTGG + Intergenic
1141273739 16:82565576-82565598 AAGTTAATCTTGGCCGGGCGCGG + Intergenic
1141425495 16:83942056-83942078 AAGTGATTCCAGGCCGGGCGCGG - Intronic
1141457382 16:84152360-84152382 AAGTGACTTAAGGCCAGGCGTGG + Intronic
1141480649 16:84304516-84304538 AAATGATTCCTGGCCGGGCGCGG - Intronic
1141596602 16:85100755-85100777 AGGTGATTGAGTGCCGGGCGCGG + Intronic
1142594246 17:1021866-1021888 AAATGACTCCCAGCCGGGCGCGG + Intronic
1142663374 17:1446881-1446903 AAGAAAGTCACGGCCGGGCGTGG - Intronic
1142789775 17:2255112-2255134 ATGTGATCTTCGGCCGGGCGCGG + Intronic
1142823972 17:2495816-2495838 AAGTGAAGACCGGCCGGGCGCGG + Intronic
1142958618 17:3537611-3537633 ATGTGTTTTAGGGCCGGGCGCGG + Intronic
1142999982 17:3787400-3787422 AAGAAATTCACAGCCGGGCATGG - Intronic
1143086929 17:4423124-4423146 GAGTGATTCCTGGCCGGGCTCGG + Intergenic
1143702017 17:8667503-8667525 AAATTATTCATGGCCGGGCGCGG - Intergenic
1143785818 17:9254684-9254706 TAATGATTCAAGGCCGGGCGCGG - Intronic
1143842385 17:9743176-9743198 AAGAGATTGTCAGCCGGGCGTGG - Intergenic
1143910323 17:10243674-10243696 AAGTGTTTAAAGGCCGGGCGTGG - Intergenic
1143922833 17:10344525-10344547 AAGTTAATGTCGGCCGGGCGTGG + Intronic
1144205644 17:12977747-12977769 AAGTGTGTCCGGGCCGGGCGTGG + Intronic
1144361919 17:14503776-14503798 AAATCATTTACGGCCGGGCACGG + Intergenic
1144461484 17:15462137-15462159 AAAAGATTCTAGGCCGGGCGTGG + Intronic
1144507003 17:15840365-15840387 AATTAATTTATGGCCGGGCGCGG - Intergenic
1145034195 17:19528799-19528821 AAGAGAATCAGGGCCGGGCACGG + Intronic
1145198151 17:20914275-20914297 ATGTGACTCTTGGCCGGGCGCGG + Intergenic
1145245643 17:21267631-21267653 AAATGATTCAGGGCCAGGTGTGG + Intergenic
1145951778 17:28824165-28824187 AAAAAATTCTCGGCCGGGCGTGG - Intronic
1145953193 17:28836276-28836298 AAGTGATTTAGGGCCAGGCGCGG - Intronic
1146049828 17:29540994-29541016 AAATGTATCAAGGCCGGGCGTGG - Intronic
1146231753 17:31117380-31117402 TAGTGATTTGCGGCCAGGCGCGG + Intronic
1146378941 17:32314471-32314493 AGGTGATACCCGGCTGGGCGCGG - Intronic
1146860399 17:36293119-36293141 AAGTGATTTGAGGCTGGGCGTGG + Intronic
1147090727 17:38097215-38097237 AAGTGATTTGAGGCTGGGCGTGG + Intergenic
1147106486 17:38223311-38223333 AAGTGATTTGAGGCTGGGCGTGG - Intergenic
1147174529 17:38645715-38645737 AAGTGGTTAGTGGCCGGGCGCGG + Intergenic
1147227507 17:38991014-38991036 AAATGAGTCAAGGCCGGGCGCGG - Intergenic
1147243115 17:39103553-39103575 TAGTAATTCATGGCTGGGCGCGG + Intronic
1147437844 17:40428699-40428721 ATGTCTTTCTCGGCCGGGCGCGG - Intergenic
1147930569 17:43977907-43977929 AAGTGAATCTTGGCCGGGCACGG + Intronic
1147942918 17:44062594-44062616 AAGTGACTTAGGGCCGGGCATGG + Intronic
1147948458 17:44093512-44093534 AAGTGAGCCAGGCCCGGGCGGGG + Intronic
1148384868 17:47227144-47227166 AAATGCTTCCCGGCTGGGCGCGG - Intergenic
1148421110 17:47547734-47547756 AAATAATTTACGGCCGGGCGCGG + Intronic
1148423031 17:47565218-47565240 AAGTGATTTGAGGCTGGGCGTGG + Intronic
1149013088 17:51877852-51877874 CAGTGATTCTCGGCTGGGTGTGG + Intronic
1149325553 17:55526447-55526469 TAGTCTTTCTCGGCCGGGCGAGG - Intergenic
1149351044 17:55787643-55787665 AATATATTCACGGCCGGGTGTGG - Intronic
1149643513 17:58220740-58220762 AAATTATTTCCGGCCGGGCGCGG - Intronic
1149693197 17:58595892-58595914 AAGTTATTTCAGGCCGGGCGCGG + Intronic
1149733729 17:58972639-58972661 AAGTGAATCCTGGCCGGGCGCGG - Intronic
1149753781 17:59170967-59170989 AAGTAACACACGGCCAGGCGCGG + Intronic
1149768261 17:59298438-59298460 AAGGGAGTATCGGCCGGGCGCGG - Intergenic
1149770267 17:59315364-59315386 AAGGGATCCATGGCCGGGCGTGG + Intergenic
1150048604 17:61937165-61937187 AAGAGATACAAGGCCGGGCGCGG - Intergenic
1150049626 17:61948794-61948816 AAGTGAGTCACGGCCGGGCGCGG + Intronic
1150088794 17:62301235-62301257 AAGCCATTCTGGGCCGGGCGTGG + Intergenic
1150354097 17:64468577-64468599 AAGCGATTCAGGGCCGGGCACGG - Intronic
1150928981 17:69564070-69564092 AATTTATCCTCGGCCGGGCGCGG - Intergenic
1151607856 17:75151140-75151162 AAATGTTTCTTGGCCGGGCGCGG - Intronic
1151613784 17:75194590-75194612 AAGTGAGATAAGGCCGGGCGCGG + Intergenic
1151662893 17:75528403-75528425 AAGTTATTTAAGGCCGGGCGCGG - Intronic
1151808474 17:76421653-76421675 TAGTCACTCAGGGCCGGGCGTGG - Intronic
1151827769 17:76532825-76532847 AAGTCATTGTCGGCCGGGCGTGG - Intronic
1151951300 17:77355690-77355712 AAGTGCTCCCTGGCCGGGCGCGG + Intronic
1152105640 17:78327152-78327174 AAGAATTTCACGGCCGGGCCTGG + Intergenic
1152113754 17:78372185-78372207 AAGAGATTCTCGGCCAGGCATGG - Intergenic
1152486098 17:80594380-80594402 AAGAACTGCACGGCCGGGCGTGG - Intronic
1152576001 17:81141158-81141180 AAGTGACTTTCGGCCGGGCGCGG + Intronic
1152674264 17:81629476-81629498 AAATATTTCACGGCTGGGCGTGG - Intronic
1152675646 17:81639494-81639516 AAGTAATTCCAGGCCGGGCATGG - Intronic
1152687111 17:81700074-81700096 AAGTAAAACTCGGCCGGGCGCGG + Intronic
1152813870 17:82395529-82395551 AACTGCGACACGGCCGGGCGTGG + Intronic
1153108210 18:1552093-1552115 AAGAGACTCATGGCTGGGCGCGG - Intergenic
1153224489 18:2888423-2888445 GAGAGAATAACGGCCGGGCGCGG + Intronic
1154158985 18:11966031-11966053 AAGTGATTGTTGGCCGGGTGCGG - Intergenic
1154342790 18:13518022-13518044 AAGAAAGTCATGGCCGGGCGCGG - Intronic
1154352740 18:13599779-13599801 AGGAGACTCACGGCCGGGTGCGG - Intronic
1154996973 18:21649647-21649669 ATATGATTCAGGGCCGGGCGCGG + Intergenic
1155065056 18:22261901-22261923 CAGTTATTCATGGCCGGGCACGG + Intergenic
1155145359 18:23078670-23078692 AAGGGAATAACGGCCAGGCGTGG - Intergenic
1155278405 18:24212346-24212368 AAGTTTTTGAAGGCCGGGCGTGG - Intronic
1155287169 18:24301936-24301958 TAGTTAATCATGGCCGGGCGTGG + Intronic
1155732624 18:29180009-29180031 ATGTGATTCAGGGCCAGGCATGG - Intergenic
1155953878 18:31941150-31941172 TAGGAATTCAAGGCCGGGCGCGG + Intronic
1156739776 18:40310297-40310319 ATCTGAATCACGGCCGGACGTGG + Intergenic
1156761079 18:40591398-40591420 AAGGGATTGTAGGCCGGGCGCGG + Intergenic
1157229399 18:45900110-45900132 AATTGATTCATGGCCTGGCGTGG + Intronic
1157239178 18:45993383-45993405 AAGAGATTCATGGCTGGGAGCGG - Intronic
1157446303 18:47749055-47749077 AACTGCTTCGCTGCCGGGCGCGG - Intergenic
1157536934 18:48466546-48466568 AAGTATTTCTCGGCCAGGCGCGG - Intergenic
1157663070 18:49462546-49462568 AAGAGACTCAGGGCTGGGCGTGG + Intergenic
1158137937 18:54226141-54226163 AAGTCATTTGTGGCCGGGCGCGG + Intergenic
1158172043 18:54611169-54611191 AGGTGATTAACGGACGGTCGAGG + Intergenic
1158353769 18:56593634-56593656 AAGAAATCCAAGGCCGGGCGTGG + Intergenic
1158630980 18:59113793-59113815 ATCTGGTTCTCGGCCGGGCGCGG + Intergenic
1158749823 18:60245736-60245758 AAATGACTAAAGGCCGGGCGCGG + Intergenic
1158758828 18:60359632-60359654 AAGTTATCCAGGGCCGGGCACGG - Intergenic
1159226181 18:65538806-65538828 AAGTCATTCACTGCAGGGCTGGG - Intergenic
1159936561 18:74372874-74372896 AAGTGATTTTTGGCTGGGCGTGG - Intergenic
1160167932 18:76530216-76530238 AAGTGATATGTGGCCGGGCGCGG - Intergenic
1160181794 18:76643084-76643106 AAGAAACTCAAGGCCGGGCGCGG - Intergenic
1160307913 18:77758308-77758330 AAGACATTCAGGGCCGGGCGCGG + Intergenic
1160934710 19:1588489-1588511 AAGGGAAACAAGGCCGGGCGCGG + Intronic
1161065132 19:2233776-2233798 AAGCGATTCATGGCTGGGCAGGG + Exonic
1161099613 19:2415233-2415255 AAATGAAGCATGGCCGGGCGCGG - Intronic
1161177176 19:2851284-2851306 AAAAAATTCACGGCCAGGCGCGG - Intronic
1161205425 19:3038615-3038637 ATGTGAATCAGGGCTGGGCGTGG + Intronic
1161492544 19:4570180-4570202 AATTGGTTCTAGGCCGGGCGCGG - Intergenic
1161674476 19:5637052-5637074 AATTGATTTTCGGCCGGGCGTGG + Intronic
1161956165 19:7496504-7496526 AAGTGCTTTCTGGCCGGGCGTGG + Intronic
1162031488 19:7919304-7919326 AAGCGACACCCGGCCGGGCGCGG + Intergenic
1162214494 19:9121918-9121940 ACGAGTTCCACGGCCGGGCGCGG - Intergenic
1162410217 19:10501337-10501359 AAGATATTCTCGACCGGGCGTGG + Intronic
1162423386 19:10579124-10579146 AAGCAATTCTCGGCCGGGAGCGG + Intronic
1162682819 19:12359687-12359709 ATCTGATTCTCGGCCCGGCGTGG + Intronic
1162698069 19:12492467-12492489 TAGTGATTCTAGGCCGGGCGCGG - Intronic
1162844186 19:13379633-13379655 AAGTGTTACAGGGCCGGGCGCGG + Intronic
1162888116 19:13711728-13711750 AAATAAGTCACGGCCGGGCATGG + Intergenic
1163009442 19:14415779-14415801 AACTAAGTCACGGCCAGGCGCGG + Intronic
1163080690 19:14939702-14939724 AAGACATTTCCGGCCGGGCGCGG - Intergenic
1163181291 19:15605638-15605660 AAACAATTCAGGGCCGGGCGAGG - Intergenic
1163456628 19:17410045-17410067 AAGTAATGGAAGGCCGGGCGTGG - Intronic
1163461376 19:17439897-17439919 AAGTGGGTAACGGCTGGGCGAGG + Intronic
1163613557 19:18312928-18312950 AAATGATACTGGGCCGGGCGCGG + Intronic
1163866732 19:19779350-19779372 AAGTGAATAAAGGCCAGGCGTGG - Intergenic
1164211425 19:23100942-23100964 AAATGAATCACTGCCGGGCATGG - Intronic
1164215105 19:23137991-23138013 ATGGCTTTCACGGCCGGGCGCGG + Intronic
1164392004 19:27832111-27832133 AAGGGACTAACGGCTGGGCGTGG - Intergenic
1164482914 19:28628870-28628892 ATATGATTATCGGCCGGGCGCGG + Intergenic
1164874066 19:31670901-31670923 AAGAAATTCACGGCCGGGCACGG - Intergenic
1165189040 19:34047027-34047049 AAAACATTCTCGGCCGGGCGCGG + Intergenic
1165449897 19:35876063-35876085 AGGAGATTCTCGACCGGGCGCGG - Intronic
1165558379 19:36656273-36656295 AAGATATTCTAGGCCGGGCGCGG - Intronic
1165783833 19:38449167-38449189 AACAGAGACACGGCCGGGCGTGG + Intronic
1166605286 19:44136966-44136988 AAGTGATTCAAGGCAAGGCAGGG + Intergenic
1166789600 19:45390872-45390894 TAGTGAGTCTCGGCCGGGCGCGG - Intronic
1166977556 19:46613620-46613642 AAGTTTGGCACGGCCGGGCGCGG - Intergenic
1167013798 19:46826440-46826462 AAATCAAACACGGCCGGGCGCGG + Intergenic
1167053246 19:47092924-47092946 AGATGATTTGCGGCCGGGCGCGG + Intronic
1167086185 19:47311219-47311241 AACTCATTCTCGGCCAGGCGCGG + Intronic
1167156936 19:47744306-47744328 AAGGGATCCATGGCAGGGCGTGG - Intergenic
1167205121 19:48096290-48096312 AAAACATTCATGGCCGGGCGTGG + Intronic
1167209709 19:48126313-48126335 AAATTATTCAAGGCCAGGCGTGG + Intronic
1167231792 19:48289690-48289712 AAGTCATTCTTGGCCGGGCGTGG + Intergenic
1167243793 19:48361506-48361528 AAGTGGTTCAAGGCCAGGCATGG - Intronic
1167243841 19:48361815-48361837 AAGTGGTTCAAGGCCGGGCGCGG - Intronic
1167246617 19:48376868-48376890 AAGTGCTTCCTGGCCGGGCACGG - Intergenic
1167272726 19:48515241-48515263 AAGAGATGTGCGGCCGGGCGCGG + Intergenic
1167388067 19:49176212-49176234 AAATGAATTAAGGCCGGGCGCGG - Intronic
1167488468 19:49777343-49777365 AAGAGATTTCCAGCCGGGCGCGG + Intronic
1167747923 19:51363737-51363759 TAGTGATTCTCGGCCAGGCGCGG - Intronic
1167806026 19:51786333-51786355 AAGAGATTCTAGGCAGGGCGCGG - Intronic
1167939015 19:52931426-52931448 AATTGACTAACGGCCGGGCACGG + Intronic
1167986131 19:53317840-53317862 GAGTGAGGCAAGGCCGGGCGCGG - Intergenic
1168006095 19:53488707-53488729 AATTGACTAACGGCTGGGCGCGG - Intronic
1168042510 19:53769678-53769700 AAGAGAATGATGGCCGGGCGCGG - Intergenic
1168356913 19:55706359-55706381 AAGTGAAAGAGGGCCGGGCGTGG + Intronic
1168560981 19:57382832-57382854 AAGTAATTCTGGGCCGGGCGTGG - Intronic
1168594673 19:57665627-57665649 AATTAATCCAAGGCCGGGCGCGG + Intergenic
1168607427 19:57771009-57771031 TGGGGTTTCACGGCCGGGCGCGG + Intronic
925412768 2:3649529-3649551 AAGTGTTTGGGGGCCGGGCGCGG - Intergenic
925557549 2:5148081-5148103 GAGTGCTTCATGGCCGGGCGCGG + Intergenic
925632853 2:5913347-5913369 AAGTGATATAAGGCCGGGCATGG + Intergenic
926060562 2:9802167-9802189 AAGTCTTTCTAGGCCGGGCGTGG + Intergenic
926177546 2:10609295-10609317 AAGGACTTCATGGCCGGGCGCGG + Intronic
926309663 2:11666408-11666430 AAGTGAATCTAGGCCGGGCGTGG + Intronic
926573892 2:14559354-14559376 AATGGAGTCACGGCCGGGTGCGG + Intergenic
926606614 2:14904757-14904779 AAGTAACTCTAGGCCGGGCGCGG + Intergenic
926964320 2:18393247-18393269 AGATCTTTCACGGCCGGGCGCGG - Intergenic
928497622 2:31850332-31850354 AAATTATTCCTGGCCGGGCGTGG + Intergenic
928634372 2:33228093-33228115 AAGAGCTTCTTGGCCGGGCGTGG - Intronic
928657756 2:33470667-33470689 AAATAATTCTTGGCCGGGCGTGG - Intronic
928662642 2:33519324-33519346 TAGTGTTTCTCGGCCAGGCGCGG + Intronic
929136495 2:38628667-38628689 ACCTGATTCCAGGCCGGGCGTGG - Intergenic
929153923 2:38772634-38772656 AAGAGATTAAGGGCCGGGCGCGG - Intronic
929336350 2:40751318-40751340 AAATAATTCCCGGCCGGGCGCGG - Intergenic
929660678 2:43781074-43781096 AAGTGATTTAAGGCCAGGCGTGG + Intronic
930129986 2:47840231-47840253 AAGTCTTCCACGGCTGGGCGTGG - Intronic
930291066 2:49493024-49493046 AAATACTTCAAGGCCGGGCGCGG + Intergenic
930465980 2:51750166-51750188 AAATGCTTAACGGCCGGGCGCGG - Intergenic
930621151 2:53644812-53644834 AAGAGTCTTACGGCCGGGCGCGG - Intronic
930736959 2:54789221-54789243 ATGTGCTTTCCGGCCGGGCGCGG + Intronic
931018426 2:58013579-58013601 AAAAGATACAGGGCCGGGCGCGG + Intronic
931049383 2:58393585-58393607 AATTAATTCCTGGCCGGGCGCGG - Intergenic
931355277 2:61532415-61532437 AACTGAGTGCCGGCCGGGCGCGG - Intronic
931606888 2:64061619-64061641 AAGGGACACAAGGCCGGGCGCGG - Intergenic
931741236 2:65247296-65247318 AAGAAAATCATGGCCGGGCGCGG + Intronic
931778553 2:65560645-65560667 AAGTGAGTCTAGGCCAGGCGTGG + Intergenic
931884885 2:66606229-66606251 AAGCAATTGAGGGCCGGGCGCGG - Intergenic
932041362 2:68303134-68303156 AAATGTTTTTCGGCCGGGCGCGG - Intronic
932098582 2:68875138-68875160 AAGAGATTCTCGGCCAGGTGCGG + Intergenic
932544969 2:72699187-72699209 AAGTCAAACATGGCCGGGCGCGG + Intronic
932795968 2:74696486-74696508 AAGAGAGGCAGGGCCGGGCGCGG - Intergenic
932919910 2:75900590-75900612 AAATGAAGCACCGCCGGGCGCGG + Intergenic
933143024 2:78817088-78817110 AAATGATTGAGGGCCGGGCATGG - Intergenic
933144174 2:78830846-78830868 AAGAAACTCATGGCCGGGCGCGG - Intergenic
933471604 2:82732940-82732962 AAGTGACTGTTGGCCGGGCGCGG + Intergenic
933538890 2:83614300-83614322 GAGAGATTCTAGGCCGGGCGCGG + Intergenic
934061816 2:88301612-88301634 AAGTAGGTCTCGGCCGGGCGCGG - Intergenic
934088989 2:88534563-88534585 AAGTTAATCTCGGCCGGGCGCGG - Intergenic
934114460 2:88772439-88772461 GTATCATTCACGGCCGGGCGTGG - Intergenic
934670051 2:96206508-96206530 AAGTGGAACACGGCCGGGCGCGG + Intronic
935226367 2:101056484-101056506 AAATAATTCTAGGCCGGGCGCGG - Intronic
935241702 2:101184217-101184239 ATGTGAGTCCCGGCTGGGCGCGG + Intronic
935242965 2:101193980-101194002 AGGGGGTTCTCGGCCGGGCGCGG - Intronic
935862445 2:107347730-107347752 AAGAGATTCTTGGCTGGGCGCGG - Intergenic
936341982 2:111641898-111641920 AAGTAAATCTGGGCCGGGCGCGG + Intergenic
936706291 2:115079088-115079110 AAGAAATCCTCGGCCGGGCGCGG + Intronic
936835615 2:116706124-116706146 AAGAGATTTCTGGCCGGGCGTGG + Intergenic
937137933 2:119571428-119571450 AAGTGGTTGTTGGCCGGGCGTGG - Intronic
937377703 2:121348948-121348970 AAGTGGTACTCGGCCGGGCGCGG + Intronic
938243576 2:129761082-129761104 AAAAGACTCGCGGCCGGGCGCGG + Intergenic
938479249 2:131646259-131646281 AAGAAATTCTTGGCCGGGCGCGG - Intergenic
938733563 2:134165483-134165505 AAATTATCCAGGGCCGGGCGCGG + Intronic
938762604 2:134439404-134439426 AAGTAACACAAGGCCGGGCGCGG + Intronic
938852197 2:135272891-135272913 AAGTTATTATTGGCCGGGCGCGG + Intronic
939372083 2:141314499-141314521 AATTGACCTACGGCCGGGCGCGG + Intronic
939935535 2:148288108-148288130 AAGTGATTTCTGGCCGGGCGCGG + Intronic
940208959 2:151236708-151236730 ATGAGATTTAGGGCCGGGCGTGG + Intergenic
940213809 2:151284065-151284087 AATTGATTTCTGGCCGGGCGCGG + Intronic
941211300 2:162643516-162643538 AAATGATTAACCGCCGGGCGAGG + Intronic
941521533 2:166550402-166550424 ATGTGGTACATGGCCGGGCGCGG - Intergenic
941629418 2:167867214-167867236 AAGAGCTTCTCGGCCGGGCGCGG - Intergenic
941802149 2:169671759-169671781 AAGAAGTTCACGGCTGGGCGCGG - Intronic
942265979 2:174225902-174225924 ATGAGCTTCTCGGCCGGGCGCGG + Intronic
942463555 2:176186573-176186595 AAATTATTTAGGGCCGGGCGCGG + Intergenic
942481612 2:176394239-176394261 AATGGATTGACGGCCGGGCGTGG + Intergenic
942651334 2:178171906-178171928 AAGTGATTATTGGCCAGGCGCGG + Intergenic
942678520 2:178452000-178452022 AAGTGATTTATGGGCGGGCGCGG + Intronic
942858835 2:180585354-180585376 AATTGATTGGCGGCCGGGCGCGG - Intergenic
943622299 2:190163142-190163164 AACTGAGTCTTGGCCGGGCGCGG + Intronic
943755165 2:191549825-191549847 AAGTGCATCAGAGCCGGGCGCGG + Intergenic
944074561 2:195714219-195714241 AAGTATTTGTCGGCCGGGCGCGG - Intronic
944561626 2:200944828-200944850 TAGTGATTCACCGCTGGGCGTGG - Intronic
944763260 2:202839208-202839230 AAGTGAGTCTTGGCTGGGCGCGG + Intronic
944805497 2:203277056-203277078 AAGTGTTTCTTGGCCGGGCGTGG + Intronic
945176404 2:207048084-207048106 TAGTTGTTCTCGGCCGGGCGCGG - Intergenic
945228037 2:207552904-207552926 CAGACATTCACAGCCGGGCGCGG - Intronic
945336956 2:208603796-208603818 AAGAGAATATCGGCCGGGCGTGG + Intronic
945550059 2:211210182-211210204 AAGTGCATCTGGGCCGGGCGCGG - Intergenic
945886862 2:215385269-215385291 AAGTGATACAAGGCCGGGCGTGG + Intronic
946077735 2:217089008-217089030 AAATTATTCCCGGCCGGGCACGG - Intergenic
946590755 2:221244655-221244677 AAATTATTCTTGGCCGGGCGCGG + Intergenic
946746070 2:222847274-222847296 GATTGAGTGACGGCCGGGCGTGG + Intergenic
947220879 2:227791414-227791436 AAGTGATTCTGGGCTGGGTGTGG + Intergenic
947323098 2:228944638-228944660 TATTAATTCAGGGCCGGGCGCGG - Intronic
947417112 2:229908452-229908474 AAGAGATTTTAGGCCGGGCGCGG + Intronic
947477189 2:230460911-230460933 AACAGATTACCGGCCGGGCGCGG - Intronic
947583750 2:231338515-231338537 AAGTGAATTGGGGCCGGGCGAGG - Intronic
947668411 2:231921497-231921519 AAATTAATGACGGCCGGGCGTGG - Intergenic
948138147 2:235652599-235652621 AAGTGATCCTAGGCCGGGTGCGG + Intronic
948872327 2:240809018-240809040 AAGTTAGTGACGGCTGGGCGTGG - Intronic
949014638 2:241702328-241702350 AGGTGCGTCACGGCGGGGCGGGG + Intronic
1169013841 20:2275070-2275092 AAGTGTTTCACGGCCACACGTGG + Intergenic
1169459829 20:5784738-5784760 AAATAATTCTGGGCCGGGCGCGG - Intronic
1169674315 20:8136334-8136356 AAGTTATTGTCGGCCGGGCGCGG + Intronic
1169898442 20:10529296-10529318 AAGTGATTCTGGACCAGGCGCGG + Intronic
1169970001 20:11259565-11259587 AAGTGATTAAGGGTCGGGTGTGG - Intergenic
1170039246 20:12022922-12022944 AAGTGAGTGGGGGCCGGGCGGGG - Intergenic
1170101553 20:12705750-12705772 TAGTGAGTAAGGGCCGGGCGTGG - Intergenic
1170238171 20:14131839-14131861 AAGAGATTCTCGGCCGCGCGCGG + Intronic
1170274905 20:14574719-14574741 TAAATATTCACGGCCGGGCGCGG + Intronic
1170343664 20:15358096-15358118 AAATGACTGAGGGCCGGGCGCGG - Intronic
1170394364 20:15909811-15909833 AATTGTATTACGGCCGGGCGCGG - Intronic
1170576008 20:17661970-17661992 AAATCACTCTCGGCCGGGCGCGG + Intronic
1171285506 20:23934879-23934901 AAGTGGTTGACGGCCGGACACGG - Intergenic
1171348193 20:24482357-24482379 TAAAGATGCACGGCCGGGCGTGG - Intronic
1171555550 20:26080183-26080205 AAATTATTCACGGCCGGGCGCGG + Intergenic
1172209753 20:33188607-33188629 AAGAGAAACACGGCCGGGCATGG - Intergenic
1172246770 20:33450840-33450862 AAGTGGGTCTAGGCCGGGCGGGG - Intergenic
1172509116 20:35487642-35487664 AAGTCACTCAGGGCTGGGCGTGG + Intronic
1172544418 20:35748355-35748377 ATGTAATTTACGGCCGGGCGCGG + Intergenic
1172676422 20:36675948-36675970 ATGAGATTAACGGCTGGGCGCGG + Intronic
1172910499 20:38405839-38405861 AAGTGATTTCTGGCTGGGCGTGG + Intergenic
1173163131 20:40667028-40667050 AAGAGAGTGAAGGCCGGGCGCGG + Intergenic
1173397817 20:42696743-42696765 AGATCATTCATGGCCGGGCGGGG - Intronic
1173548073 20:43914615-43914637 CAGGGATGCAGGGCCGGGCGGGG + Intergenic
1173916364 20:46711147-46711169 AGTTAATTCAGGGCCGGGCGCGG - Intronic
1173938449 20:46889289-46889311 AAGTGAGTCCTGGCTGGGCGAGG - Intergenic
1173985148 20:47255416-47255438 AAGAGAGACAGGGCCGGGCGTGG + Intronic
1174010297 20:47444178-47444200 AAGATATACACGGCCGGGCATGG + Intergenic
1174241259 20:49136982-49137004 AAGTGGTTTCCCGCCGGGCGTGG - Intronic
1174350376 20:49963304-49963326 AAAAAATTCACGGCCGGGCGCGG - Intergenic
1174431889 20:50476120-50476142 AAGTGATCGACGGCCGGGCGTGG + Intergenic
1175667879 20:60875949-60875971 AAGTGATTGTGGGCCAGGCGCGG - Intergenic
1175720375 20:61282066-61282088 AAGAAATTCACGGCTGGGCATGG + Intronic
1175828875 20:61951236-61951258 AAACCACTCACGGCCGGGCGCGG + Intergenic
1176017224 20:62940637-62940659 AAGAGAGTTGCGGCCGGGCGCGG - Intronic
1176187123 20:63786798-63786820 AAGTTATCCGAGGCCGGGCGGGG - Intronic
1176282470 20:64322004-64322026 AAGGGAATCAGGGCCAGGCGTGG - Intergenic
1176420833 21:6513672-6513694 AAGTGGTTTACGGCCTGGCATGG - Intergenic
1176886983 21:14268924-14268946 AAGAAATGCACGGCCAGGCGTGG + Intergenic
1177220128 21:18181678-18181700 ATGTGATTCTTGGCTGGGCGCGG - Intronic
1177885702 21:26742768-26742790 AAATTATTCAGGGCCGGGCATGG - Intergenic
1177923924 21:27189781-27189803 AAAATATTCAAGGCCGGGCGCGG - Intergenic
1178032376 21:28542614-28542636 AAGAAATTCTCAGCCGGGCGTGG - Intergenic
1178079070 21:29044222-29044244 AAGTGGTGGTCGGCCGGGCGCGG - Intronic
1178083898 21:29093779-29093801 AGGTCCTTCTCGGCCGGGCGCGG - Intronic
1178189322 21:30262602-30262624 AAGTTAATCAAGGCTGGGCGTGG - Intergenic
1178295051 21:31402653-31402675 AACTGACTAAAGGCCGGGCGTGG + Intronic
1178354410 21:31898555-31898577 AAAAAATCCACGGCCGGGCGTGG - Intronic
1178354882 21:31902218-31902240 AAGTTGGCCACGGCCGGGCGCGG + Intronic
1178369728 21:32017507-32017529 AGGTGAAACAGGGCCGGGCGCGG - Intronic
1178577267 21:33805911-33805933 AAGAGTTTTAAGGCCGGGCGCGG + Intronic
1178863612 21:36309605-36309627 AAGGGAGACCCGGCCGGGCGCGG - Intergenic
1178926370 21:36778567-36778589 AATTGATTCAAGGCCAGGCACGG - Intronic
1179341190 21:40511699-40511721 AAAGTATTCTCGGCCGGGCGCGG + Intronic
1179682082 21:43029719-43029741 AACTGTTTCTGGGCCGGGCGCGG - Intronic
1179682332 21:43032148-43032170 ATGTCATTCTCGGCCGGGCGCGG - Exonic
1179696324 21:43121991-43122013 AAGTGGTTTACGGCCTGGCATGG - Intergenic
1180517913 22:16165268-16165290 AACTCACTCAAGGCCGGGCGCGG - Intergenic
1180792741 22:18585572-18585594 AAGTATGTCCCGGCCGGGCGCGG + Intergenic
1180850046 22:19013594-19013616 AATTTATTCTGGGCCGGGCGCGG - Intergenic
1181228995 22:21409747-21409769 AAGTATGTCCCGGCCGGGCGCGG - Intergenic
1181249656 22:21525118-21525140 AAGTATGTCCCGGCCGGGCGCGG + Intergenic
1181279562 22:21709483-21709505 AAGAGATTCCTGGCTGGGCGTGG + Intronic
1181443855 22:22953324-22953346 AAGTGCTTCAGGGCCGGGCGCGG + Intergenic
1181793485 22:25286118-25286140 AAATGTTTCATGGCCGGGTGCGG + Intergenic
1181833463 22:25581990-25582012 AAGTGTTTCATGGCTGGGCGCGG + Intronic
1181851394 22:25752475-25752497 AATTAATTAAAGGCCGGGCGCGG - Intronic
1182222236 22:28767900-28767922 AAGAGAGTCATGGCCGGGCGTGG - Intergenic
1182425659 22:30270705-30270727 AAGTAATTAAGGGCCGGGTGCGG - Intergenic
1182571308 22:31240710-31240732 AGGTGATTCTAGGCCAGGCGCGG - Intronic
1182687913 22:32135025-32135047 AACCCATTCAAGGCCGGGCGTGG + Intergenic
1182846906 22:33438918-33438940 AGATGATACAAGGCCGGGCGCGG + Intronic
1182949828 22:34363115-34363137 AAGAGACTCAGGGCTGGGCGCGG - Intergenic
1183157551 22:36086747-36086769 AAATGATTCCCGGCCGGGCACGG - Intergenic
1183289245 22:36989234-36989256 AAGTCATTCCTGGACGGGCGTGG + Intergenic
1183460094 22:37944608-37944630 TAGTGTTTCTAGGCCGGGCGCGG + Intronic
1183863900 22:40689172-40689194 AAGTTAATCAGGGCTGGGCGCGG - Intergenic
1183890877 22:40927582-40927604 AAATGATTTCTGGCCGGGCGTGG + Exonic
1183946825 22:41331145-41331167 AAGTGATTCTCAGCTGGGCGCGG - Intronic
1183998298 22:41652960-41652982 AAGTGAATTATGGCCGGGCATGG - Intronic
1184593376 22:45500397-45500419 AAGTGATTCTGGGCAGGGCGTGG - Intergenic
1184770215 22:46592536-46592558 CAGTCATTCACAGCCGGGAGGGG + Intronic
1184788646 22:46685359-46685381 AAATGTTTCCCGGCTGGGCGCGG - Exonic
1184990598 22:48166561-48166583 AGAGTATTCACGGCCGGGCGCGG - Intergenic
1185034654 22:48466326-48466348 AAAAGTTTCTCGGCCGGGCGCGG - Intergenic
1185042549 22:48512628-48512650 AAGAGAGAGACGGCCGGGCGCGG + Intronic
1185358560 22:50390708-50390730 AAGAAATTCAGGGCCGGGCGCGG + Intronic
949324717 3:2850276-2850298 AAGTGATTGCTGGCCAGGCGCGG - Intronic
949362026 3:3242373-3242395 GAGTTAATCTCGGCCGGGCGCGG - Intergenic
949389643 3:3544786-3544808 AGTTCAATCACGGCCGGGCGCGG - Intergenic
949519643 3:4838339-4838361 AAATGTTTCACGGCGGGGGGCGG - Intronic
949558236 3:5177742-5177764 AAGAAATTCATGGCCGGGCACGG - Intronic
949575893 3:5338934-5338956 AAGTTATTCATGGCCAGGCGGGG - Intergenic
949984487 3:9529315-9529337 TGGTGATTCATGGCCGGGCGCGG - Intronic
950026314 3:9822355-9822377 AAAGGACTCATGGCCGGGCGCGG - Intronic
950218880 3:11179328-11179350 AAGTCAGCCAGGGCCGGGCGCGG + Intronic
950252707 3:11480219-11480241 AATTGATTCCAGGCCGGGTGCGG - Intronic
950390780 3:12694804-12694826 AAGTGAGGTACAGCCGGGCGTGG - Intergenic
950488987 3:13290702-13290724 AACTGACTTTCGGCCGGGCGCGG - Intergenic
950865637 3:16186973-16186995 TAGTGATTTCAGGCCGGGCGTGG + Intronic
950922398 3:16707878-16707900 AATGGATTCCCGGCCGGGCGCGG + Intergenic
951180061 3:19649209-19649231 AGGCAATTCCCGGCCGGGCGCGG - Intergenic
951220482 3:20063829-20063851 TTGTGAATCTCGGCCGGGCGTGG - Intronic
951227278 3:20135362-20135384 AAGTGATTAGTGGCCGGGCGCGG + Intronic
951333641 3:21394956-21394978 AGGTGAGTCAAGGCCGGGCGCGG - Intergenic
951356023 3:21667450-21667472 AAGTAATTTAGGGCCGGGCATGG - Intronic
951665981 3:25124082-25124104 ATGTGAGTCCAGGCCGGGCGCGG + Intergenic
951696269 3:25448755-25448777 AAAAGATTCTCGGCCGGGCACGG - Intronic
952307545 3:32159338-32159360 AATTGATGCTAGGCCGGGCGTGG + Intronic
952379118 3:32790767-32790789 AAAGGATTCAAGGCTGGGCGAGG + Intergenic
952847500 3:37700638-37700660 AAGTCATTCCAGGCCGGGTGTGG - Intronic
953125025 3:40083845-40083867 AAGACATTCTCGGCCGGGCGCGG + Intronic
953762402 3:45699810-45699832 AAGTTTTTCTCGGCTGGGCGCGG - Intronic
954561598 3:51561533-51561555 AAGGGAATTTCGGCCGGGCGTGG - Intronic
954590862 3:51780108-51780130 AACTGAGTCTAGGCCGGGCGCGG - Intergenic
955321028 3:57974448-57974470 AAGAAATTCCCGGCCGGGCGTGG + Intergenic
955575445 3:60357533-60357555 AAGTGATATTGGGCCGGGCGTGG - Intronic
955781498 3:62489448-62489470 AAGTCAAACACGGCCGGGTGCGG - Intronic
955911896 3:63865599-63865621 AAGTAATTGTCGGCCGGGCGCGG + Intronic
956475660 3:69617419-69617441 TAGTGAGTTTCGGCCGGGCGCGG - Intergenic
956588128 3:70885367-70885389 AACTGATCCAGGGCCGGGCGCGG + Intergenic
956661499 3:71602712-71602734 AAGTAAGACCCGGCCGGGCGCGG + Intergenic
957225646 3:77442020-77442042 ATCAGATTTACGGCCGGGCGCGG + Intronic
957346849 3:78972054-78972076 AAAAGATTTAAGGCCGGGCGCGG - Intronic
957452819 3:80401906-80401928 AAATGACTACCGGCCGGGCGTGG + Intergenic
957521654 3:81326398-81326420 AAGGCATTCAAGGCCAGGCGCGG + Intergenic
957579904 3:82058468-82058490 AAGTGAGTATAGGCCGGGCGCGG + Intergenic
958001302 3:87752241-87752263 AACAAACTCACGGCCGGGCGCGG - Intergenic
958472813 3:94542599-94542621 AAGTAAATGTCGGCCGGGCGCGG - Intergenic
958968747 3:100587908-100587930 AAGTGATTTGTGGCCGGGCGCGG + Intergenic
959480657 3:106868423-106868445 AAATGATTAGAGGCCGGGCGCGG + Intergenic
959597433 3:108143601-108143623 AAGAAGTTCACGGCCGGGCGCGG - Intergenic
959705119 3:109332389-109332411 AAGTGATTTTAGGCTGGGCGCGG - Intronic
959966071 3:112356969-112356991 AAGTGCCTAATGGCCGGGCGCGG + Intronic
960285027 3:115818870-115818892 AAGTGATTGGAGGCTGGGCGCGG + Intronic
960618094 3:119614311-119614333 AAGTGAATCCTGGTCGGGCGTGG + Intronic
960896978 3:122515397-122515419 AAATAATTAAGGGCCGGGCGCGG + Intergenic
960977563 3:123190363-123190385 AACTCATTTAAGGCCGGGCGTGG + Intronic
961073936 3:123964117-123964139 AAAAGGTTTACGGCCGGGCGCGG - Intergenic
961694937 3:128698185-128698207 ATGTGATTCGCGGCCGGGCGTGG - Intergenic
961719164 3:128880675-128880697 AACTGAGTCTTGGCCGGGCGCGG - Intronic
961774355 3:129273312-129273334 AAGTTATTTTAGGCCGGGCGCGG - Intronic
962190909 3:133309988-133310010 AACTCACTCAAGGCCGGGCGCGG - Intronic
962544188 3:136415545-136415567 AAGTGGTTGAGGGCCGGGTGCGG + Intronic
962796282 3:138852350-138852372 AAGTGATTCTCGGCCTGGCACGG + Intergenic
963147240 3:142007062-142007084 AAGTCATTTAGGGCCAGGCGTGG - Intronic
963394363 3:144713959-144713981 AAAGAATTCAAGGCCGGGCGCGG + Intergenic
963413969 3:144971029-144971051 AAATGCATCAGGGCCGGGCGTGG + Intergenic
963431802 3:145216488-145216510 AATGGAGTCAGGGCCGGGCGTGG - Intergenic
963640074 3:147850304-147850326 AAGTGAGAATCGGCCGGGCGCGG + Intergenic
963829551 3:149992439-149992461 ATGTGATTATTGGCCGGGCGCGG - Intronic
963943162 3:151115635-151115657 AATTGTTTCCAGGCCGGGCGCGG - Intronic
964054255 3:152433458-152433480 AAGTTTTTTGCGGCCGGGCGCGG + Intronic
964199938 3:154107929-154107951 AAATGCTTCTCGGCCGGGCGCGG + Intergenic
964246016 3:154654989-154655011 AAATTACTCAAGGCCGGGCGCGG + Intergenic
964266728 3:154905528-154905550 AAAATATTCAAGGCCGGGCGCGG + Intergenic
964351495 3:155807541-155807563 AAGTAAATAACAGCCGGGCGTGG + Intergenic
964633053 3:158833301-158833323 AAATGTTTTCCGGCCGGGCGCGG + Intergenic
965096373 3:164232318-164232340 AAGATATTCATGGCCGGGCATGG - Intergenic
965172358 3:165282423-165282445 AAGAGATTCAGGGCCAGGCCTGG - Intergenic
965224083 3:165965182-165965204 ATTTTATTAACGGCCGGGCGCGG - Intergenic
965287315 3:166833231-166833253 AAGAAATACTCGGCCGGGCGCGG + Intergenic
965386779 3:168055506-168055528 AGGTGACTCAGGGCCGGGCGCGG + Intronic
965779045 3:172264285-172264307 AAATGATGCAGGGCTGGGCGTGG - Intronic
965784015 3:172317472-172317494 AATTAATCCCCGGCCGGGCGTGG - Intronic
965817443 3:172651847-172651869 AAAAGATTCTCGGCCGGGCGCGG - Intronic
965950341 3:174300931-174300953 AAGAAAATCAGGGCCGGGCGCGG + Intergenic
966052887 3:175642788-175642810 AAAAGATTTGCGGCCGGGCGCGG - Intronic
966112532 3:176419818-176419840 AATTTATTGTCGGCCGGGCGCGG - Intergenic
966419529 3:179723860-179723882 AAGTGACTCAGGGCCTGGCATGG + Intronic
966461820 3:180184747-180184769 AGGTGATTAACGGCCAGGCGCGG - Intergenic
966741494 3:183238705-183238727 AAAAGACTCTCGGCCGGGCGCGG + Intronic
966864901 3:184252650-184252672 AAGTGAATGATGGCCGGGCAGGG + Intronic
966999678 3:185321892-185321914 AACTCAGTCACGGCCGGGCGTGG - Intronic
967007010 3:185393745-185393767 AAGATATTTACGGCTGGGCGCGG - Intronic
967071984 3:185970269-185970291 AAGAAATTCCCGGCCGGGCGAGG - Intergenic
967327930 3:188260740-188260762 AAGTGTTTCTGGGCTGGGCGCGG + Intronic
967345163 3:188447319-188447341 AAGTGACTCTTGGCTGGGCGTGG + Intronic
967683151 3:192389067-192389089 AATTAATACATGGCCGGGCGCGG + Intronic
967793810 3:193576559-193576581 GATTGATTCAAGGCCGGGCGCGG - Intronic
967847570 3:194056467-194056489 AAGTGCATCTAGGCCGGGCGCGG - Intergenic
967848367 3:194062727-194062749 CAGTAATTTTCGGCCGGGCGCGG - Intergenic
968065834 3:195758859-195758881 AACTGATTCAAGGCTGGGCGCGG - Intronic
968072752 3:195796950-195796972 AAGTGCATCATGGCCGGGCGCGG + Intronic
968077265 3:195823286-195823308 AAGTGAATCTTGGCCAGGCGTGG - Intergenic
968185856 3:196633166-196633188 AAGGACTTCTCGGCCGGGCGCGG + Intergenic
968194199 3:196693502-196693524 AAGGAAGTCAAGGCCGGGCGTGG - Intronic
968644378 4:1731922-1731944 AAGGGGTTCTGGGCCGGGCGCGG - Intronic
968738376 4:2312436-2312458 AAGTGTTTTGGGGCCGGGCGCGG + Intronic
969228353 4:5813495-5813517 AAGTGATTTCTGGCCGGGCGCGG - Exonic
969411902 4:7033930-7033952 AGATGAGACACGGCCGGGCGGGG + Intergenic
969412813 4:7040760-7040782 AAGTGATTTTGGGCCGGGCTAGG - Intergenic
969425887 4:7123460-7123482 AAGAGTTTCTCCGCCGGGCGTGG - Intergenic
969639082 4:8386274-8386296 AAGTGACTTGCGGCCGGGCGTGG + Intronic
970426336 4:15949573-15949595 AAGTGCCACACGGCCGGGTGCGG + Intergenic
971412931 4:26394315-26394337 AAGTGAATCCAGGCTGGGCGTGG - Intronic
971491139 4:27213458-27213480 AATTTATTTAGGGCCGGGCGTGG + Intergenic
971809413 4:31405054-31405076 AAATTATTTTCGGCCGGGCGCGG + Intergenic
971839950 4:31837990-31838012 AAGGAATTCTCTGCCGGGCGCGG - Intergenic
971949772 4:33329841-33329863 AAGTTAACCTCGGCCGGGCGCGG - Intergenic
972244429 4:37229835-37229857 AAATGACTCAAGGCCGGGCGCGG + Intergenic
972298660 4:37764660-37764682 ATGTGATTTCTGGCCGGGCGCGG + Intergenic
972349340 4:38222270-38222292 AAGTTAATCTCGGCCAGGCGCGG + Intergenic
972450997 4:39198266-39198288 AAGACATTAACGGCCGGGAGTGG + Intronic
972515755 4:39809249-39809271 AAATAACTAACGGCCGGGCGCGG - Intergenic
972540991 4:40039311-40039333 TAATAATTCACGGCCGGGCATGG + Intergenic
972612309 4:40667341-40667363 CAGTGATTGCCGGCTGGGCGCGG + Intergenic
972620764 4:40746295-40746317 AGAAGATTCAGGGCCGGGCGCGG - Intergenic
972652601 4:41033071-41033093 AAATGAATCTTGGCCGGGCGCGG - Intronic
972700231 4:41487147-41487169 CACAGATTCTCGGCCGGGCGTGG - Intronic
972821626 4:42708402-42708424 AACTGATTCTGGGCCGGGCACGG - Intergenic
973245399 4:48005404-48005426 AAGCAAGTCAGGGCCGGGCGTGG - Intronic
973535629 4:51879314-51879336 AAGTGATTGACGGCTGGGCGCGG + Intronic
973761195 4:54117267-54117289 AATGGACTCAAGGCCGGGCGCGG - Intronic
973989224 4:56387341-56387363 AAGTGAGTCGCGGCAGGGCGCGG - Exonic
974052467 4:56953637-56953659 AAGTGAATCCAGGCCGGGCACGG - Intergenic
974256653 4:59465255-59465277 AAATAATTTTCGGCCGGGCGCGG + Intergenic
975200108 4:71577547-71577569 AAATCATTCCTGGCCGGGCGTGG + Intergenic
975342966 4:73261500-73261522 AAGTTAATCACGGCCAGGCTCGG - Intergenic
975355775 4:73401944-73401966 AAAAGATTCTTGGCCGGGCGCGG + Intronic
975469815 4:74752667-74752689 AAGTGATTCCCGGCCAGTCACGG - Intronic
975567359 4:75772525-75772547 ATGTACTTCTCGGCCGGGCGCGG - Intronic
975760787 4:77617843-77617865 AAATTATTTCCGGCCGGGCGCGG - Intergenic
975783008 4:77859261-77859283 AATGGATTCTCGGCCGGGCGTGG - Intergenic
975886347 4:78970241-78970263 AAATTCTTCAGGGCCGGGCGCGG - Intergenic
975912571 4:79284578-79284600 GAATGATTGAGGGCCGGGCGCGG + Intronic
976056197 4:81070366-81070388 AATAGCTTTACGGCCGGGCGCGG + Intergenic
976216437 4:82719791-82719813 AAGAAAATCATGGCCGGGCGCGG - Intronic
976506818 4:85856758-85856780 AAGTAATTTCCAGCCGGGCGCGG - Intronic
976537298 4:86232661-86232683 AATTGACTCTAGGCCGGGCGTGG - Intronic
976560445 4:86494553-86494575 AAATGCTTCACGGCTGGGCGTGG + Intronic
976748730 4:88432427-88432449 AGGTGATTCATGGCCAGGTGCGG + Intronic
977817934 4:101438110-101438132 AAGTGATGACAGGCCGGGCGCGG + Intronic
978428339 4:108605460-108605482 AAGTCATTTAGGGCCAGGCGTGG + Intergenic
978463966 4:108987662-108987684 AAGGTATGCACGGCCGGGCGCGG - Intronic
978820948 4:112964857-112964879 ATGTGGTACATGGCCGGGCGCGG - Intronic
978896299 4:113892211-113892233 AAATAATTCAAGGCCGGGCGCGG + Intergenic
979297626 4:119051479-119051501 CATTGCTTCCCGGCCGGGCGCGG - Intronic
979611935 4:122698431-122698453 AAGTAATTCAGGGCCGGGCTTGG - Intergenic
979806050 4:124972402-124972424 AAAGCAGTCACGGCCGGGCGCGG - Intergenic
979837867 4:125395607-125395629 AAGTGAATAATGGCCGGGCGCGG - Intronic
979859135 4:125671886-125671908 AAGTGAATGCTGGCCGGGCGCGG - Intergenic
980274986 4:130638712-130638734 AAGATATTTATGGCCGGGCGCGG - Intergenic
980916732 4:139040328-139040350 AAATGATACAAGGCTGGGCGCGG - Intronic
981725395 4:147842224-147842246 AAGGGTTTCACGGCCAGGCATGG - Intronic
981989076 4:150893967-150893989 AATTGTTTCGAGGCCGGGCGCGG - Intronic
982126904 4:152191574-152191596 AAGTGGTTCCTGGCCGGGCATGG - Intergenic
982349553 4:154400011-154400033 TAGGCTTTCACGGCCGGGCGCGG + Intronic
982642828 4:157984441-157984463 AAGTGAATCATGGCTGGGTGTGG + Intergenic
983038271 4:162893801-162893823 AAGAAATTCCAGGCCGGGCGCGG - Intergenic
983641444 4:169947221-169947243 AACTGCTTTATGGCCGGGCGAGG - Intergenic
984108859 4:175583318-175583340 AGTTGATTGCCGGCCGGGCGCGG - Intergenic
984294678 4:177839288-177839310 AGGTCATATACGGCCGGGCGTGG - Intronic
984516743 4:180750743-180750765 ACGAAATTAACGGCCGGGCGCGG - Intergenic
985279330 4:188270148-188270170 ATGTTATTTAAGGCCGGGCGCGG - Intergenic
985378743 4:189370572-189370594 AAATGACTCCGGGCCGGGCGCGG - Intergenic
985545455 5:506775-506797 AAGTTATTGGGGGCCGGGCGCGG + Intronic
985548669 5:522467-522489 TAGATATTCACGGCCGGGCGCGG + Intronic
985684552 5:1275082-1275104 AAGCGAGTCTCGGCCGGGCGCGG + Intronic
986340700 5:6786814-6786836 AAATGATTCACGGCCAGGTGTGG + Intergenic
986404435 5:7411783-7411805 AAGAGAAGCACGGCCGGGCGCGG + Intronic
986688088 5:10291370-10291392 AAGCAATCCTCGGCCGGGCGCGG + Intronic
987342661 5:16952424-16952446 ATGTGATACAAGGCCGGGCACGG - Intergenic
987352869 5:17036749-17036771 AAGAAAGTCACGGCCAGGCGCGG + Intergenic
987438309 5:17924708-17924730 AGGTTATTTTCGGCCGGGCGCGG - Intergenic
987570144 5:19646629-19646651 AATTAATTTAAGGCCGGGCGTGG - Intronic
987722247 5:21651770-21651792 AAATTATTTTCGGCCGGGCGCGG - Intergenic
987893181 5:23910317-23910339 AAATCATTCTCGGCCGGGCGCGG + Intergenic
988422079 5:31018709-31018731 AAGTCATGGCCGGCCGGGCGTGG + Intergenic
988461832 5:31446154-31446176 AAATAATTCCAGGCCGGGCGTGG + Intronic
988489396 5:31693528-31693550 AAGTGCTTTTCGGCCAGGCGCGG - Intronic
988611577 5:32731949-32731971 AATCCATTCTCGGCCGGGCGCGG + Intronic
988901285 5:35734998-35735020 AAGCAATTCATGGCCGGGCGTGG - Intronic
988996061 5:36715854-36715876 AATTGAGGCATGGCCGGGCGCGG - Intergenic
989031151 5:37119693-37119715 AAGCCATTCAAGGCCGGGCGTGG + Intronic
989094004 5:37764452-37764474 AAGAGTTTCAAGGCCGGGCATGG + Intergenic
989462571 5:41717569-41717591 AAGAAATTTACGGCCGGGCGTGG + Intergenic
989850740 5:46206769-46206791 AAGTTTTTCTGGGCCGGGCGCGG + Intergenic
989963405 5:50441341-50441363 AACTGATGGAGGGCCGGGCGCGG - Exonic
990191712 5:53267249-53267271 AAGTTCTCCAGGGCCGGGCGTGG + Intergenic
990223431 5:53621988-53622010 TAATAATTTACGGCCGGGCGCGG - Intronic
990376795 5:55178205-55178227 AAGTGTTGAAAGGCCGGGCGCGG - Intergenic
990575680 5:57121351-57121373 AATCTACTCACGGCCGGGCGCGG + Intergenic
990586768 5:57219083-57219105 AAGGGATTTGAGGCCGGGCGTGG + Intronic
990707788 5:58549423-58549445 TACTGTTTCTCGGCCGGGCGCGG + Intronic
991299417 5:65114429-65114451 AATCGATTCCTGGCCGGGCGAGG - Intergenic
991315565 5:65300919-65300941 AAAGGACTTACGGCCGGGCGCGG - Intronic
991601604 5:68356427-68356449 AAATTATTCAAGGCCGGGCGTGG - Intergenic
992033045 5:72743240-72743262 AACTGATTTATGGCCGGGCGCGG + Intergenic
992406357 5:76461166-76461188 AAGTGAATCAAGGCCAGGTGCGG - Intronic
992510893 5:77434037-77434059 AAGAGAAACAGGGCCGGGCGTGG + Intronic
992882945 5:81128846-81128868 AAGTGGTTTAGGGCTGGGCGTGG + Intronic
993209796 5:84933677-84933699 CAATGCTTCTCGGCCGGGCGTGG - Intergenic
993722887 5:91338823-91338845 AATTTATTCTCGGCCGGGCGCGG - Intergenic
994225310 5:97245170-97245192 AGGCAAATCACGGCCGGGCGCGG - Intergenic
994477644 5:100290891-100290913 GAGTGAGTCCCGGCCGGGCGCGG - Intergenic
994501725 5:100587833-100587855 ATGTTATTAGCGGCCGGGCGCGG + Intergenic
994772596 5:104002290-104002312 AAGTCATGCAGGGCTGGGCGTGG + Intergenic
995216810 5:109604742-109604764 AAATCAGTCATGGCCGGGCGCGG - Intergenic
995453164 5:112325149-112325171 AAGAGAGTCAGGGCCGGGCGCGG + Intronic
995680973 5:114718839-114718861 AAGAAATTGTCGGCCGGGCGTGG - Intergenic
995722221 5:115148697-115148719 AACAGATTTACGGCCGGGCGCGG - Intronic
995875627 5:116786348-116786370 AAGAAATTCAAGGCCGGGTGTGG - Intergenic
996042414 5:118830465-118830487 AAGTGTTTTAAGGCCAGGCGCGG - Intergenic
996219258 5:120909703-120909725 TAGGGATTGGCGGCCGGGCGCGG - Intergenic
996611099 5:125381655-125381677 AGATCATTCACGGCCGGGCGCGG + Intergenic
996660567 5:125997639-125997661 AATTAACTCAAGGCCGGGCGTGG + Intergenic
996666348 5:126064597-126064619 AAATGAAGCTCGGCCGGGCGCGG - Intergenic
996737950 5:126775036-126775058 AAGTATTTCATGGCCAGGCGCGG + Intergenic
997110450 5:131068614-131068636 ATATCATTCTCGGCCGGGCGCGG + Intergenic
997123596 5:131202202-131202224 AAGTAATTCATGGCTGGGTGTGG + Exonic
997553066 5:134770519-134770541 AAGTATTTTAAGGCCGGGCGAGG + Intronic
998309799 5:141117259-141117281 AAGGGATTTGAGGCCGGGCGCGG + Intronic
998485447 5:142498026-142498048 AAGTTAGTCCAGGCCGGGCGTGG - Intergenic
998736247 5:145144649-145144671 AAATAATTTATGGCCGGGCGCGG + Intergenic
998777085 5:145615614-145615636 AAGAGACTCACGGCTGGGCGCGG - Intronic
998922122 5:147081321-147081343 CAGTGATTCACAGCAGGACGTGG - Intronic
999187175 5:149720351-149720373 ATGCCATTCTCGGCCGGGCGCGG + Intergenic
999412022 5:151358681-151358703 TGTTGATTCTCGGCCGGGCGCGG + Intergenic
999472915 5:151871852-151871874 AATCGTCTCACGGCCGGGCGCGG - Intronic
999907902 5:156163728-156163750 AAATCATTTTCGGCCGGGCGCGG + Intronic
1000031818 5:157408158-157408180 AAGAATTTCACGGCCGGGCGCGG + Intronic
1000970265 5:167706722-167706744 AAGGGTTGCCCGGCCGGGCGCGG + Intronic
1001066747 5:168540920-168540942 AAAAGATTCAGGGCCGGACGTGG + Intergenic
1001143894 5:169167564-169167586 AAGTGCTTAGAGGCCGGGCGCGG - Intronic
1001437217 5:171709412-171709434 AACTAATTGAGGGCCGGGCGCGG - Intergenic
1001504652 5:172268498-172268520 AAGTCAATGTCGGCCGGGCGTGG + Intronic
1001612807 5:173017241-173017263 AAGTGATTCCCTGCTGGGCGTGG + Intronic
1001917906 5:175576887-175576909 AAGCACTTGACGGCCGGGCGCGG + Intergenic
1002141639 5:177144789-177144811 AAGTAATACTTGGCCGGGCGCGG + Intronic
1002274075 5:178092823-178092845 AAGAAATTCACAGCCGGGCACGG + Intergenic
1002378242 5:178804377-178804399 ACATGTTTCTCGGCCGGGCGCGG + Intergenic
1002498446 5:179632014-179632036 AAGGGCGTCTCGGCCGGGCGCGG + Intronic
1002551049 5:179992430-179992452 CAATGATTTAGGGCCGGGCGTGG - Intronic
1002647318 5:180666172-180666194 AAGCCAGTCAGGGCCGGGCGCGG + Intergenic
1002773774 6:311388-311410 AAGTTAGGCAAGGCCGGGCGCGG + Intronic
1002836262 6:867806-867828 ATGTGAATCTAGGCCGGGCGCGG + Intergenic
1002999439 6:2317597-2317619 AGGTGATTAACGGACGGTCGAGG - Intergenic
1003110520 6:3248843-3248865 AAGTGAGTCATGGCTGGGTGCGG + Intronic
1003209662 6:4050314-4050336 AACTGTTTCCTGGCCGGGCGCGG - Intronic
1003359910 6:5415105-5415127 AAGTTAGTCATGGCCGGGTGCGG - Intronic
1003900272 6:10648430-10648452 AAGTCATTCAAGGCTGGGTGTGG - Intergenic
1003919502 6:10819820-10819842 ACAGGATTCATGGCCGGGCGCGG + Intronic
1003989001 6:11467144-11467166 AAGATAATCAGGGCCGGGCGTGG - Intergenic
1004224885 6:13776235-13776257 AAGAGACTCTAGGCCGGGCGCGG + Intergenic
1004360166 6:14963953-14963975 AAATGAGTCCTGGCCGGGCGTGG + Intergenic
1004362412 6:14982935-14982957 TAGGGTCTCACGGCCGGGCGTGG - Intergenic
1004366120 6:15014133-15014155 ACTAGATTCATGGCCGGGCGTGG - Intergenic
1004617008 6:17300366-17300388 AAGAGGTTTACGGCCGGGCACGG + Intergenic
1004960888 6:20786783-20786805 AAGGGAGTCAAGGCCGGGAGCGG - Intronic
1004995873 6:21192309-21192331 AAATGAATTATGGCCGGGCGCGG - Intronic
1005065699 6:21815547-21815569 AACTGATTCAAGGCCGGGTGTGG - Intergenic
1006495451 6:34419866-34419888 AAATAAATCAGGGCCGGGCGCGG - Intronic
1006783468 6:36648720-36648742 AAGTGCTTCATGGCCAGGTGTGG - Intergenic
1006974772 6:38089416-38089438 AAGTGAGTCAAGGCTGGGTGTGG - Intronic
1007456533 6:41981977-41981999 AAGTCAATCATGGCCGGGCACGG + Intronic
1007460347 6:42013781-42013803 GAATGACTCAGGGCCGGGCGTGG + Intronic
1007560113 6:42800452-42800474 AAATGATTTAAGGCCGGGCGTGG - Intronic
1007724784 6:43908774-43908796 AATGGATTTAGGGCCGGGCGCGG + Intergenic
1008019370 6:46558705-46558727 AGGTGATTGTCGGCCGGGCACGG + Intronic
1008107446 6:47454419-47454441 AACTAATTCATGGCCGGGCTTGG - Intergenic
1008307684 6:49925037-49925059 ATGTGATACATGGCCGGGCACGG + Intergenic
1008777353 6:55056683-55056705 ATATAGTTCACGGCCGGGCGCGG - Intergenic
1009520949 6:64681601-64681623 AAGTGATTCACGGCCGGGCGCGG + Intronic
1010238614 6:73596564-73596586 AAGAAACACACGGCCGGGCGTGG + Intronic
1010280070 6:74013300-74013322 AAATGGCACACGGCCGGGCGCGG - Intergenic
1010308874 6:74359463-74359485 GAGTTATTTATGGCCGGGCGCGG + Intergenic
1010440288 6:75885734-75885756 AAGAGATTCTCGGCCGGGCGCGG - Intronic
1011106275 6:83785188-83785210 AAGAGTTTCTCGGCTGGGCGCGG - Intergenic
1011175818 6:84559284-84559306 AGGTGTTAGACGGCCGGGCGCGG - Intergenic
1011616211 6:89200550-89200572 AAATCATTCTCGGCCGGGCATGG - Intronic
1011629166 6:89308103-89308125 AAGTGAATGAAGGCCGAGCGCGG - Intronic
1011685469 6:89820064-89820086 AGCTGATTCTCGGCCGGGCGCGG + Intergenic
1011763537 6:90594294-90594316 AAGTTAAACATGGCCGGGCGCGG + Intergenic
1012258157 6:97057470-97057492 AAAAGATACTCGGCCGGGCGCGG - Intronic
1012513085 6:100026823-100026845 AACTGTTTTACGGCCGGGCGCGG - Intergenic
1012711263 6:102609280-102609302 AAGAAATTCACGACCTGGCGCGG + Intergenic
1013310572 6:108889896-108889918 CAGTGGTTCCGGGCCGGGCGCGG + Intronic
1013513929 6:110868763-110868785 ATGTAATTCAAGGCCAGGCGCGG + Intronic
1013953263 6:115810711-115810733 AAGTGAGTGAAGGCCGGGCGTGG + Intergenic
1014046995 6:116900543-116900565 AATAGATTCAAGGCCGGGCACGG - Intronic
1014845495 6:126271071-126271093 AAGTGAATCACAGCTGGGTGTGG + Intergenic
1015087231 6:129310187-129310209 AAATGATTATCGGCCGGGCGCGG - Intronic
1015407021 6:132849233-132849255 AAAAGATTCACGGCTGGGCGCGG - Intergenic
1016057985 6:139599024-139599046 AAGAAACTCATGGCCGGGCGCGG + Intergenic
1016282529 6:142434609-142434631 AAGTTCTTCAGGGCCGGACGCGG - Intronic
1016452385 6:144196399-144196421 AAGTAAGTCAGGGCCGGGCGTGG + Intergenic
1016465668 6:144322646-144322668 AAGTGGATTTCGGCCGGGCGCGG + Intronic
1016468269 6:144348134-144348156 GAGTGAGTCACGGCTGGGCATGG - Intronic
1016943936 6:149510451-149510473 AAATGAAACAGGGCCGGGCGCGG + Intronic
1017235633 6:152114599-152114621 AAGCAAGTCAAGGCCGGGCGCGG + Intronic
1017423440 6:154296537-154296559 AAATGAATATCGGCCGGGCGTGG + Intronic
1017661391 6:156677555-156677577 AATGCATTCAAGGCCGGGCGCGG - Intergenic
1017728641 6:157294638-157294660 AAATGACTTGCGGCCGGGCGCGG - Intronic
1017927600 6:158923739-158923761 AAGTGATTGGGGGCCTGGCGCGG - Intergenic
1018249523 6:161854792-161854814 AAGTGGTTCTCGGCCGGGCGCGG + Intronic
1018265352 6:162018314-162018336 AAGTTATTATGGGCCGGGCGCGG - Intronic
1019213156 6:170422532-170422554 AAGAGGGTCAGGGCCGGGCGCGG + Intergenic
1019475429 7:1241840-1241862 AAGGGAGTCACGGCTGGGCGAGG - Intergenic
1019744381 7:2691450-2691472 AAGTGATTTTGGGCCGGGCGCGG + Intronic
1019839962 7:3431189-3431211 AAGTGATAAAAGGCCAGGCGTGG - Intronic
1020036391 7:4965833-4965855 AAGGGAGTCAAGGCCGGGCGGGG - Intergenic
1020053614 7:5101004-5101026 AGATCCTTCACGGCCGGGCGCGG - Intergenic
1020394963 7:7704463-7704485 AATTGCTTCTGGGCCGGGCGCGG + Intronic
1020585466 7:10060144-10060166 AAGAGAAGAACGGCCGGGCGCGG - Intergenic
1020952944 7:14704143-14704165 AAATGTTTGCCGGCCGGGCGCGG + Intronic
1021128997 7:16888288-16888310 ATGTTAATCAAGGCCGGGCGTGG + Intergenic
1021129676 7:16896666-16896688 AAGTGATGAGAGGCCGGGCGCGG + Intergenic
1021240159 7:18190233-18190255 AAGTTATTTATGGCCGGGCGTGG - Intronic
1022562545 7:31364771-31364793 AAGCGAGTCTCGGCCGGGTGCGG + Intergenic
1022720754 7:32940246-32940268 AAGAGGTTCTCTGCCGGGCGCGG - Intergenic
1023179747 7:37469890-37469912 AAGACATACCCGGCCGGGCGCGG - Intergenic
1023438429 7:40162184-40162206 AATCACTTCACGGCCGGGCGCGG - Intronic
1023957508 7:44898655-44898677 AAGAGGTTCAGGGCCGGGTGAGG - Intergenic
1024515810 7:50254528-50254550 AAAGGATTCCTGGCCGGGCGCGG + Intergenic
1024726778 7:52207160-52207182 AAGACATATACGGCCGGGCGCGG + Intergenic
1024731268 7:52256258-52256280 AAGCCATTCACGGCCGGGCGCGG - Intergenic
1025077357 7:55954435-55954457 AGGTGATTCTAGGCTGGGCGCGG + Intronic
1025291312 7:57727032-57727054 TATGGATTCTCGGCCGGGCGCGG - Intergenic
1025763872 7:64422545-64422567 AAGAATTTCATGGCCGGGCGCGG - Intergenic
1025914056 7:65851551-65851573 AAGTTATTTTTGGCCGGGCGAGG - Intergenic
1025946331 7:66107696-66107718 AAGTGAGTCAGGGCCAGACGTGG + Intronic
1026075833 7:67167177-67167199 AAGAAAGTCATGGCCGGGCGCGG + Intronic
1026156502 7:67830677-67830699 AAATGATACAGGGCCGGGCATGG + Intergenic
1026271583 7:68841594-68841616 AACTGAGTTCCGGCCGGGCGCGG + Intergenic
1026313615 7:69209434-69209456 GACTGATTCTCGGCCGGGCACGG - Intergenic
1026453095 7:70546486-70546508 AAATCATTCAGGGCCAGGCGTGG + Intronic
1026563744 7:71472396-71472418 AAGTTATTTAGGGCTGGGCGCGG + Intronic
1026810197 7:73457466-73457488 AAATGAGTCCCGGCCGGGCGTGG - Intronic
1026859414 7:73775867-73775889 AAGAAATTGAGGGCCGGGCGCGG + Intergenic
1027450880 7:78330325-78330347 GATTCCTTCACGGCCGGGCGCGG + Intronic
1027464205 7:78494245-78494267 AAGTGATTCAGGGCCAGGCACGG - Intronic
1027611658 7:80368840-80368862 GATTCATTCACGGCCGGGCGCGG + Intergenic
1027865292 7:83638819-83638841 CAGAGATTCCTGGCCGGGCGCGG + Intronic
1027899930 7:84099358-84099380 AAAAAATTCAAGGCCGGGCGCGG - Intronic
1028643579 7:93071114-93071136 AACTCACTCAAGGCCGGGCGCGG - Intergenic
1028852110 7:95549585-95549607 AATGGAGTCTCGGCCGGGCGCGG - Intergenic
1029269600 7:99369216-99369238 AAGTTATTTGAGGCCGGGCGCGG + Intronic
1029543316 7:101197476-101197498 ATGTGAGTCCCGGCTGGGCGTGG - Intronic
1029624378 7:101710865-101710887 AAGTGACTTCCGGCCGGCCGCGG + Intergenic
1029645782 7:101855023-101855045 AATTGAGTCCAGGCCGGGCGAGG - Intronic
1030067549 7:105671995-105672017 AAGAGAGGCACGGCCGGGCGTGG + Intronic
1030224156 7:107130207-107130229 AAGTTATGCCGGGCCGGGCGTGG + Intronic
1030294091 7:107903106-107903128 AAGAGAATATCGGCCGGGCGCGG + Intronic
1030532781 7:110730813-110730835 AAGCCAGTCCCGGCCGGGCGCGG - Intronic
1030627499 7:111859855-111859877 AATTAACACACGGCCGGGCGCGG - Intronic
1030941389 7:115654212-115654234 ATGTAAATCACGGCCGGGCACGG - Intergenic
1031851249 7:126866878-126866900 AATTGAGTCAAGGCAGGGCGCGG - Intronic
1032014898 7:128372766-128372788 AAGTTCTTTTCGGCCGGGCGCGG - Intergenic
1032031749 7:128489916-128489938 AAGAAATTGCCGGCCGGGCGCGG - Intronic
1032113414 7:129096405-129096427 AATTCATTCCAGGCCGGGCGCGG - Intergenic
1032225747 7:130030488-130030510 AGCTGATTCAGGGCTGGGCGTGG - Intronic
1032655303 7:133922554-133922576 AATTTATACATGGCCGGGCGCGG + Intronic
1032830743 7:135622985-135623007 AACTGATTCACGGCTGGGTGTGG + Intronic
1033210707 7:139458085-139458107 AAAAGATTCACGGCCAGGCATGG + Intronic
1033447060 7:141432443-141432465 TAGTGATGCAGGGCTGGGCGTGG - Intronic
1033859999 7:145613096-145613118 AACTCACTCAAGGCCGGGCGCGG - Intergenic
1034104142 7:148476252-148476274 AAATAATTTATGGCCGGGCGCGG - Intergenic
1034153977 7:148939090-148939112 TACTGATTAAAGGCCGGGCGCGG - Intergenic
1034655824 7:152729117-152729139 TAGTGTTTTTCGGCCGGGCGAGG - Intergenic
1034783351 7:153902542-153902564 AAGTGCTTATAGGCCGGGCGTGG + Intronic
1035418982 7:158711451-158711473 AAAAAATTCACGGCCGGGCGCGG + Intergenic
1035574981 8:698507-698529 ATGTAATTCAGGGCCGGGCACGG - Intronic
1036068923 8:5418638-5418660 AAGGTATTCTCGGCCGGGCGCGG + Intergenic
1036156810 8:6349724-6349746 AAGATATTATCGGCCGGGCGCGG - Intergenic
1036166556 8:6439690-6439712 ACATGATTCACGGCCAGGAGCGG - Intronic
1036514364 8:9430075-9430097 AAGTGCTTCCCAGCCAGGCGCGG - Intergenic
1036850609 8:12198274-12198296 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1036871974 8:12440539-12440561 AAGAGAATGAGGGCCGGGCGTGG + Intergenic
1036954243 8:13170438-13170460 ATGTGTTTCCGGGCCGGGCGCGG + Intronic
1037963862 8:23118421-23118443 AAGAATTTCAAGGCCGGGCGCGG + Intergenic
1037970041 8:23165161-23165183 ATGTGAGCCAGGGCCGGGCGCGG + Intergenic
1038030417 8:23634137-23634159 AAGAGTTGCACGGCCGGGCGCGG - Intergenic
1038039361 8:23710879-23710901 TAGAGGTTCAGGGCCGGGCGCGG - Intergenic
1038507505 8:28097684-28097706 AAATGAATGACGGCCGGGTGCGG - Intronic
1038568463 8:28639224-28639246 AAATGATTCCTGGCCAGGCGCGG - Intronic
1038897781 8:31805536-31805558 AAGTGAATACCGGCCGGGCGCGG + Intronic
1039045684 8:33447156-33447178 CAGTGATTCCAGGCCGGGCGCGG + Intronic
1039108165 8:34012378-34012400 AAGTGATTGAGAGCCGGGCATGG + Intergenic
1039310883 8:36316862-36316884 AACTGAGCCAAGGCCGGGCGCGG + Intergenic
1039460748 8:37742051-37742073 AAGTGAGGATCGGCCGGGCGCGG + Intronic
1040023954 8:42764615-42764637 AATTGCTTTAAGGCCGGGCGTGG - Intronic
1040068996 8:43173923-43173945 GAGTGATTTGGGGCCGGGCGCGG + Intronic
1040365775 8:46713439-46713461 AAGTGAGTCCCGGCCAGGCGTGG - Intergenic
1040465182 8:47688410-47688432 AAGCAAAACACGGCCGGGCGTGG - Intronic
1040838768 8:51761161-51761183 AAGTGATTTCAGGCCGGCCGCGG - Intronic
1040844721 8:51825402-51825424 AAGATATTTATGGCCGGGCGCGG + Intronic
1041501844 8:58547386-58547408 GAAAGACTCACGGCCGGGCGCGG - Intergenic
1041783319 8:61602900-61602922 AAGAAATTCACAGCTGGGCGTGG + Intronic
1042007262 8:64194763-64194785 AGGTGAGTCTAGGCCGGGCGCGG - Intergenic
1042011777 8:64254288-64254310 AAGTTTTTCTAGGCCGGGCGCGG + Intergenic
1042237128 8:66624501-66624523 AACTTATTCTCGGCCGGGCTTGG - Intergenic
1042318115 8:67445972-67445994 TAGTCATTTACGGCCGGGGGCGG + Intronic
1042320526 8:67470318-67470340 ACATGATCCAAGGCCGGGCGTGG - Intronic
1042372518 8:68007897-68007919 AAGTAACTGAGGGCCGGGCGCGG - Intronic
1043549168 8:81349377-81349399 AATTCATTCTAGGCCGGGCGCGG - Intergenic
1043699360 8:83265775-83265797 ATGTAATTCAGGGCCGGGCATGG + Intergenic
1043808493 8:84704132-84704154 AATTTATTCATGGCCGGGCATGG + Intronic
1043883009 8:85565943-85565965 AAGTCAGTCATGGCCGGGCACGG - Intergenic
1044069346 8:87737695-87737717 AATTATTTCTCGGCCGGGCGCGG - Intergenic
1044416309 8:91944209-91944231 AATTAAGTCATGGCCGGGCGCGG + Intergenic
1044684032 8:94809946-94809968 TAGTGCTTCTCGGCCGGGTGTGG + Intergenic
1045389845 8:101704624-101704646 AAGTGAATGGGGGCCGGGCGCGG + Intronic
1045418196 8:101987862-101987884 AAGCAACTCATGGCCGGGCGCGG + Intronic
1045482423 8:102602685-102602707 AAGAAATGTACGGCCGGGCGCGG + Intergenic
1045552066 8:103181560-103181582 AAGATATTCCTGGCCGGGCGAGG - Intronic
1047223230 8:122935823-122935845 GAGTGACTCTCGGCCGGGCGTGG - Intronic
1047404376 8:124573035-124573057 AAGTAATCCACAGCCGGGTGTGG - Intronic
1047611913 8:126529388-126529410 AAATTATTCTAGGCCGGGCGTGG + Intergenic
1047704850 8:127487703-127487725 CAGTGAATTAGGGCCGGGCGCGG - Intergenic
1048568646 8:135630956-135630978 AAGTGTTTTTCGGCCGGGCGCGG + Intronic
1048605059 8:135959706-135959728 AAGAAATTGCCGGCCGGGCGCGG + Intergenic
1048793536 8:138127556-138127578 AAGTAAAACACGGCCGGGTGAGG + Intergenic
1049507411 8:143010690-143010712 AAGTGATAGGCGGCCAGGCGCGG + Intergenic
1049520708 8:143088463-143088485 AAGATATTCACAGCCGGGCATGG - Intergenic
1049715890 8:144091484-144091506 AAATAATTCTTGGCCGGGCGCGG - Intergenic
1050275725 9:3997055-3997077 AATTGAGTTGCGGCCGGGCGCGG + Intronic
1050408256 9:5332905-5332927 ATGAGAATCATGGCCGGGCGCGG - Intergenic
1050804199 9:9653050-9653072 AAGTGCCTCATGGCCGGGCGCGG + Intronic
1050809563 9:9727163-9727185 AAATTATTCTTGGCCGGGCGTGG + Intronic
1050874595 9:10618177-10618199 AAATGATCCAAGGCCAGGCGCGG + Intergenic
1050891351 9:10828415-10828437 AAGTCACTCAAGGCCGGGCGCGG - Intergenic
1051240888 9:15054809-15054831 AAGACATTTATGGCCGGGCGTGG + Intergenic
1051304372 9:15692844-15692866 AAATGATTCTAGGCCGGGCATGG + Intronic
1051436057 9:17033380-17033402 AAGTGGTTCTCGGCTGGGCACGG - Intergenic
1051649314 9:19304837-19304859 AAAAAATTCATGGCCGGGCGCGG - Intronic
1051656649 9:19388385-19388407 ATATAATTCACGGCCGGGCGTGG + Intergenic
1052285608 9:26781511-26781533 TAGTGGTTTGCGGCCGGGCGCGG - Intergenic
1052426708 9:28314222-28314244 AATCAATTCTCGGCCGGGCGCGG - Intronic
1052464081 9:28807312-28807334 AAGATTTTCACGGCCGGGCATGG - Intergenic
1052712040 9:32068836-32068858 AATTGATTCATGGCCGGGCATGG - Intergenic
1052756628 9:32549017-32549039 AAGTCATCTATGGCCGGGCGTGG + Intronic
1052967723 9:34353486-34353508 AATAGAATCACGGCCGGGTGTGG + Intergenic
1052972633 9:34386303-34386325 ATGTAATTCCCGGCTGGGCGTGG + Intronic
1053071769 9:35106128-35106150 AAGTGAGTCAGGGCCAGGTGAGG - Intronic
1053220617 9:36309592-36309614 AGATGCTTGACGGCCGGGCGCGG - Intergenic
1053360335 9:37482092-37482114 AAGCTATTCTCGGCCGGGCGCGG + Intergenic
1053373025 9:37578527-37578549 AAGCAATTCACGGCTGGGCGTGG + Intronic
1055074328 9:72198103-72198125 AAGTAATGCATGGCTGGGCGCGG + Intronic
1055140131 9:72867698-72867720 AAGTGTGTAGCGGCCGGGCGTGG + Intergenic
1055384030 9:75741763-75741785 AAGTGATCCATGGCAGGGAGAGG + Intergenic
1055571236 9:77618921-77618943 AATATATTCAAGGCCGGGCGCGG - Intronic
1055762648 9:79625307-79625329 AATAGATTTAAGGCCGGGCGCGG - Intronic
1055935849 9:81603709-81603731 AAGTGATACAAGGTCAGGCGTGG + Intronic
1056205163 9:84312827-84312849 AGGTAATTCAGGGCCGGGCACGG - Intronic
1056521863 9:87409108-87409130 AAGTGATTCATGGCCAGGTGTGG + Intergenic
1056937619 9:90928704-90928726 AAATGCTTTAGGGCCGGGCGCGG - Intergenic
1057801628 9:98194714-98194736 AAGACATTCAAGGCCAGGCGTGG - Intergenic
1058277794 9:103067221-103067243 AAGTGGTGTACGGCCGGGCGTGG - Intergenic
1058656353 9:107225078-107225100 AACTGCTTCAAGGCCGGGCGCGG + Intergenic
1059093941 9:111391948-111391970 AAGTCCTTTCCGGCCGGGCGCGG + Intronic
1059188488 9:112300460-112300482 ACGTCAGTCACGGCCGGGCGTGG + Intronic
1059492151 9:114676904-114676926 AAGTGAATAAAGGCCAGGCGCGG - Intergenic
1059562354 9:115347697-115347719 ATTTGATTGCCGGCCGGGCGCGG - Intronic
1059886461 9:118749867-118749889 AAGGAATTCAAGGCCGGGAGTGG + Intergenic
1060008493 9:120022070-120022092 TCTTGAATCACGGCCGGGCGTGG + Intergenic
1060092260 9:120753741-120753763 AACTCATGCTCGGCCGGGCGCGG + Intronic
1060125420 9:121039925-121039947 AAGGCATTCAAGGCCGGGCGCGG - Intronic
1060535323 9:124381967-124381989 AAGTGATTTTCAGCCGGGCATGG + Intronic
1060696677 9:125714863-125714885 AAATTCTTCACCGCCGGGCGCGG - Intergenic
1061030211 9:128077235-128077257 AAGCCAGTCGCGGCCGGGCGCGG + Intronic
1061507625 9:131040465-131040487 AAGTGCTTCTGGGCCAGGCGCGG - Intronic
1061606047 9:131711646-131711668 AAGTGATGAAGGGCTGGGCGTGG - Intronic
1062249100 9:135585307-135585329 AAATCACTCATGGCCGGGCGCGG + Intergenic
1062310391 9:135932375-135932397 TAATGAATCTCGGCCGGGCGCGG - Intergenic
1062422726 9:136491221-136491243 ATCTCATTCACGGCCGGGCGTGG + Intergenic
1185491973 X:524809-524831 AAGGGACTCAAGGCCGGGCGCGG + Intergenic
1185571045 X:1135080-1135102 AAGTGATATTAGGCCGGGCGCGG - Intergenic
1185651706 X:1652687-1652709 AACATATTCAGGGCCGGGCGCGG + Intergenic
1185681135 X:1889138-1889160 AAGAGATTTACGGCTGGGCGCGG - Intergenic
1185716771 X:2348982-2349004 AAGAGACCCACAGCCGGGCGCGG - Intronic
1185724053 X:2405196-2405218 AAAAGAATCAAGGCCGGGCGCGG + Intronic
1185781712 X:2853495-2853517 AAGTCATGCAAGGCCTGGCGCGG - Intronic
1185869348 X:3650586-3650608 ATGTTATTCAAGGCCGGGCACGG + Intronic
1186326166 X:8478815-8478837 AAGGGATTCGTGGCCCGGCGCGG - Intergenic
1186421406 X:9429835-9429857 TAGTGTTTGTCGGCCGGGCGCGG - Intergenic
1186534247 X:10330322-10330344 AAGTGAGTCAGGGCCGAGCAGGG - Intergenic
1186834567 X:13424950-13424972 AATAGACACACGGCCGGGCGTGG + Intergenic
1186865204 X:13713525-13713547 AAATATTTCATGGCCGGGCGTGG + Intronic
1187380237 X:18795017-18795039 AAGTGATTTTCCGCTGGGCGTGG + Intronic
1187433154 X:19243114-19243136 AATTGTTTCCGGGCCGGGCGCGG + Intergenic
1187476012 X:19611642-19611664 AAGTTATTCTGGGCCGGGCTCGG - Intronic
1187707496 X:22022923-22022945 AAATATTTCTCGGCCGGGCGTGG - Intergenic
1187880510 X:23842716-23842738 AGGTGGTTCTCGGCAGGGCGTGG + Intronic
1188372590 X:29386831-29386853 AATTCATTCACGGCTGGGCAGGG - Intronic
1188402645 X:29766038-29766060 AAATGATTCCCGGCTGGGCGCGG + Intronic
1188499558 X:30810456-30810478 AAAAAATTCACGGCCGGGCGCGG - Intergenic
1188751000 X:33905734-33905756 AAGCCATTCCCGGCCGGGCACGG + Intergenic
1188884017 X:35527823-35527845 AAAGGATTCATGGCTGGGCGTGG + Intergenic
1188884933 X:35537898-35537920 CAATGATTCTGGGCCGGGCGTGG + Intergenic
1189325967 X:40111001-40111023 GGTTGATTCTCGGCCGGGCGTGG - Intronic
1189461466 X:41246642-41246664 AAATGATTTAAGGCCGGGCACGG - Intergenic
1189526738 X:41830528-41830550 AAGTGATAGATGGCCGGGTGCGG + Intronic
1189587654 X:42477107-42477129 AAGGTATATACGGCCGGGCGTGG - Intergenic
1189853246 X:45197524-45197546 AAGTGATTACCAGCCAGGCGAGG - Intronic
1189921802 X:45909664-45909686 GAGTAATTTTCGGCCGGGCGCGG + Intergenic
1190021588 X:46883043-46883065 AAGAGTTTCTGGGCCGGGCGAGG - Intergenic
1190097840 X:47496326-47496348 AAATGAATCAGGGCCAGGCGCGG - Intergenic
1190233043 X:48597215-48597237 AAGTGGTGTAGGGCCGGGCGCGG - Intronic
1190475361 X:50821794-50821816 AAGTGTATCTCGGCCGGGTGTGG + Intergenic
1190668691 X:52719204-52719226 TAGAGATTCATGGCCTGGCGTGG + Intergenic
1190670726 X:52739200-52739222 TAGAGATTCATGGCCTGGCGTGG - Intergenic
1191612473 X:63132290-63132312 AAATGTTGCATGGCCGGGCGCGG + Intergenic
1191623824 X:63246636-63246658 AAATGTTGCATGGCCGGGCGCGG - Intergenic
1192349746 X:70347683-70347705 GAATGATTTAGGGCCGGGCGCGG + Intronic
1192431765 X:71117360-71117382 AAGTAATTCAAGGCGGGGAGTGG - Intergenic
1192470054 X:71390703-71390725 AAATGTCTCACGGCCGGGCGCGG + Intronic
1192746931 X:73948442-73948464 ACATGCTTCCCGGCCGGGCGCGG - Intergenic
1193115413 X:77771085-77771107 AAGCCTTTCTCGGCCGGGCGTGG + Intronic
1193754773 X:85394971-85394993 AAGTTAAACACAGCCGGGCGCGG - Intergenic
1194063859 X:89238326-89238348 AAGAGATTCTGGGCCGGGCGCGG - Intergenic
1194235798 X:91381928-91381950 ATGTAATTGACGGCCGGGCACGG + Intergenic
1194288831 X:92042927-92042949 AAATGATCAACGGCCGGGCGCGG - Intronic
1195023636 X:100853850-100853872 AAATGTTTCAAGGCCGGGTGCGG + Intronic
1195048582 X:101077081-101077103 ATGTGATGCATGGCCAGGCGTGG - Intergenic
1195123525 X:101781781-101781803 AAAAGATTCTTGGCCGGGCGCGG + Intergenic
1195323603 X:103740674-103740696 AAGAGATTCCCGGCCAGGCACGG + Intergenic
1195458730 X:105099754-105099776 AAGTGTGTGGCGGCCGGGCGCGG - Intronic
1195927231 X:110038279-110038301 AAATGAGTCCAGGCCGGGCGCGG - Intronic
1195949989 X:110259871-110259893 AAAAGATTCCTGGCCGGGCGCGG - Intronic
1196144003 X:112296905-112296927 AAGGGATTCTCAGCCAGGCGCGG - Intergenic
1196441302 X:115722341-115722363 AAGGGACTTGCGGCCGGGCGCGG - Intergenic
1196444831 X:115840330-115840352 AAGGGACTTGCGGCCGGGCGCGG - Intergenic
1197172600 X:123451208-123451230 AAGTGATTGTAGGCCGGGCATGG + Intronic
1197204374 X:123777218-123777240 AAGTAGATCACGGCCAGGCGTGG - Intergenic
1197620620 X:128743561-128743583 AAATAATTAATGGCCGGGCGCGG + Intergenic
1197797500 X:130313463-130313485 AAGTCACACACGGCCGGGCGCGG - Intergenic
1198078901 X:133220029-133220051 CAGTGGCTCACAGCCGGGCGTGG - Intergenic
1198169590 X:134092676-134092698 AAGACATTCTTGGCCGGGCGCGG - Intergenic
1198258212 X:134943791-134943813 AAGAAGTTCAAGGCCGGGCGTGG - Intergenic
1198391631 X:136181031-136181053 AAGTCAATCAGGGCCGGGCGCGG - Intronic
1198550710 X:137742480-137742502 AAGAAATTTCCGGCCGGGCGCGG + Intergenic
1198828837 X:140727581-140727603 AAATTGTTCACGGTCGGGCGTGG - Intergenic
1199024855 X:142924374-142924396 GATTGAATGACGGCCGGGCGCGG - Intergenic
1199053212 X:143261971-143261993 AACCTATTCATGGCCGGGCGCGG + Intergenic
1199145255 X:144358653-144358675 AAGACATTCTCGGCCAGGCGCGG + Intergenic
1199774605 X:150999994-151000016 AAGTGAGTCCAGGCCGGGCATGG + Intergenic
1200233297 X:154456610-154456632 AAGAGATTCTCGGCCGGGCGCGG + Intergenic
1200606350 Y:5267494-5267516 AAATGAGCAACGGCCGGGCGCGG - Intronic
1200718033 Y:6572431-6572453 AAGAGAGTCTGGGCCGGGCGCGG - Intergenic
1200807261 Y:7445687-7445709 AAGAGATACACGGCCAAGCGTGG - Intergenic
1200837450 Y:7746835-7746857 AAGCAATGCAGGGCCGGGCGTGG + Intergenic
1200886904 Y:8280035-8280057 ACGTGATTCTCAGCTGGGCGAGG + Intergenic
1200902463 Y:8446399-8446421 AAGTTATTACCGGCCGGGCGCGG - Intergenic
1202599172 Y:26575069-26575091 AAGTGACTCATGGCTGGGCACGG + Intergenic