ID: 1009520950 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:64681604-64681626 |
| Sequence | TGATTCACGGCCGGGCGCGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009520944_1009520950 | -6 | Left | 1009520944 | 6:64681587-64681609 | CCTGGCCTCGCTAAAAGTGATTC | 0: 1 1: 0 2: 0 3: 3 4: 70 |
||
| Right | 1009520950 | 6:64681604-64681626 | TGATTCACGGCCGGGCGCGGTGG | No data | ||||
| 1009520943_1009520950 | 6 | Left | 1009520943 | 6:64681575-64681597 | CCGCAATGATCACCTGGCCTCGC | 0: 1 1: 0 2: 1 3: 6 4: 94 |
||
| Right | 1009520950 | 6:64681604-64681626 | TGATTCACGGCCGGGCGCGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009520950 | Original CRISPR | TGATTCACGGCCGGGCGCGG TGG | Intronic | ||