ID: 1009520951

View in Genome Browser
Species Human (GRCh38)
Location 6:64681610-64681632
Sequence ACGGCCGGGCGCGGTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5327
Summary {0: 6, 1: 94, 2: 540, 3: 1606, 4: 3081}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520946_1009520951 -5 Left 1009520946 6:64681592-64681614 CCTCGCTAAAAGTGATTCACGGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1009520951 6:64681610-64681632 ACGGCCGGGCGCGGTGGCTCAGG 0: 6
1: 94
2: 540
3: 1606
4: 3081
1009520944_1009520951 0 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520951 6:64681610-64681632 ACGGCCGGGCGCGGTGGCTCAGG 0: 6
1: 94
2: 540
3: 1606
4: 3081
1009520943_1009520951 12 Left 1009520943 6:64681575-64681597 CCGCAATGATCACCTGGCCTCGC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1009520951 6:64681610-64681632 ACGGCCGGGCGCGGTGGCTCAGG 0: 6
1: 94
2: 540
3: 1606
4: 3081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520951 Original CRISPR ACGGCCGGGCGCGGTGGCTC AGG Intronic
Too many off-targets to display for this crispr