ID: 1009520952

View in Genome Browser
Species Human (GRCh38)
Location 6:64681614-64681636
Sequence CAGGCCTGAGCCACCGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446133
Summary {0: 491, 1: 34132, 2: 89308, 3: 152461, 4: 169741}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520952_1009520954 -5 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210
1009520952_1009520962 20 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520962 6:64681657-64681679 GCTGAGGCGGGCGCATCACAAGG 0: 5
1: 1096
2: 9548
3: 37940
4: 62710
1009520952_1009520958 4 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520958 6:64681641-64681663 CCCAACATTTTGGGAGGCTGAGG 0: 517
1: 12294
2: 113603
3: 239031
4: 344104
1009520952_1009520960 7 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520960 6:64681644-64681666 AACATTTTGGGAGGCTGAGGCGG 0: 343
1: 8592
2: 80484
3: 165949
4: 172125
1009520952_1009520961 8 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520961 6:64681645-64681667 ACATTTTGGGAGGCTGAGGCGGG 0: 362
1: 9066
2: 85589
3: 211909
4: 333105
1009520952_1009520953 -6 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520953 6:64681631-64681653 GGCCTGTAATCCCAACATTTTGG 0: 23
1: 1812
2: 35085
3: 267994
4: 282689
1009520952_1009520956 -2 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG 0: 1570
1: 37199
2: 335401
3: 258215
4: 188863
1009520952_1009520963 25 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520963 6:64681662-64681684 GGCGGGCGCATCACAAGGTCAGG 0: 13
1: 3996
2: 31256
3: 60247
4: 65701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520952 Original CRISPR CAGGCCTGAGCCACCGCGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr