ID: 1009520954

View in Genome Browser
Species Human (GRCh38)
Location 6:64681632-64681654
Sequence GCCTGTAATCCCAACATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780036
Summary {0: 1149, 1: 28422, 2: 260351, 3: 276904, 4: 213210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520946_1009520954 17 Left 1009520946 6:64681592-64681614 CCTCGCTAAAAGTGATTCACGGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210
1009520944_1009520954 22 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210
1009520952_1009520954 -5 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520954 6:64681632-64681654 GCCTGTAATCCCAACATTTTGGG 0: 1149
1: 28422
2: 260351
3: 276904
4: 213210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520954 Original CRISPR GCCTGTAATCCCAACATTTT GGG Intronic
Too many off-targets to display for this crispr