ID: 1009520956

View in Genome Browser
Species Human (GRCh38)
Location 6:64681635-64681657
Sequence TGTAATCCCAACATTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821248
Summary {0: 1570, 1: 37199, 2: 335401, 3: 258215, 4: 188863}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520944_1009520956 25 Left 1009520944 6:64681587-64681609 CCTGGCCTCGCTAAAAGTGATTC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG 0: 1570
1: 37199
2: 335401
3: 258215
4: 188863
1009520952_1009520956 -2 Left 1009520952 6:64681614-64681636 CCGGGCGCGGTGGCTCAGGCCTG 0: 491
1: 34132
2: 89308
3: 152461
4: 169741
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG 0: 1570
1: 37199
2: 335401
3: 258215
4: 188863
1009520946_1009520956 20 Left 1009520946 6:64681592-64681614 CCTCGCTAAAAGTGATTCACGGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1009520956 6:64681635-64681657 TGTAATCCCAACATTTTGGGAGG 0: 1570
1: 37199
2: 335401
3: 258215
4: 188863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520956 Original CRISPR TGTAATCCCAACATTTTGGG AGG Intronic
Too many off-targets to display for this crispr