ID: 1009520979

View in Genome Browser
Species Human (GRCh38)
Location 6:64681782-64681804
Sequence CCTTTTAAGCTGTTTGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 3, 2: 6, 3: 28, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009520974_1009520979 5 Left 1009520974 6:64681754-64681776 CCGGCTCAGTCAGACTAGGGTCC 0: 1
1: 3
2: 1
3: 8
4: 107
Right 1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG 0: 1
1: 3
2: 6
3: 28
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009520979 Original CRISPR CCTTTTAAGCTGTTTGTGGC GGG Intronic
902122488 1:14178869-14178891 ACTTTTAAGCTCTTTTTGGAAGG + Intergenic
903530652 1:24027766-24027788 CCTTTAAAACTGTTCCTGGCCGG + Intergenic
903908496 1:26704559-26704581 CCTTTAATACTGTTTTTGGCCGG + Intronic
904188236 1:28722708-28722730 CTTTTTGAGCTCTTTGTGACTGG + Intergenic
904243142 1:29164208-29164230 CCTTTTCATCTGTTGGTGTCTGG - Intronic
906184004 1:43846578-43846600 CTTTTTAACCTGTTTGTGTCAGG + Intronic
906350059 1:45051038-45051060 CCTTTTAGGCTCTTTGTACCTGG - Intronic
906593527 1:47051265-47051287 ACTTTTACACTGTTGGTGGCAGG + Intergenic
908442802 1:64171534-64171556 CTTTTGAAGCTGATTCTGGCTGG - Intronic
908719873 1:67113835-67113857 CCTTTTAAGGTGTTTTCAGCAGG - Intronic
909343495 1:74557954-74557976 CCTTTTACACTGTTGGTGGGAGG + Intergenic
909470260 1:76019912-76019934 GCTTTTAAACTGTTTGCTGCTGG - Intergenic
911774954 1:101797254-101797276 CCTTTTAAGCTTTTTTTCCCTGG + Intergenic
913529234 1:119721704-119721726 CTATTAATGCTGTTTGTGGCAGG + Intronic
913975964 1:143455818-143455840 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914070361 1:144281440-144281462 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914108794 1:144684914-144684936 CATTTGAAACTGTTTTTGGCAGG + Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
919024830 1:192154302-192154324 GTTTTCAAGCTGTTTATGGCAGG - Intergenic
919469283 1:197958600-197958622 CCTGCTCAGCTGATTGTGGCTGG - Intergenic
920139416 1:203796847-203796869 CCTTTTAAAATGTGAGTGGCTGG - Exonic
920227766 1:204450593-204450615 GCTTTGAAGCTGTTTGGGGGTGG - Intronic
920806156 1:209235828-209235850 CAATTTAAGCTGGTTGTGGCTGG + Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
923508515 1:234627987-234628009 CCATTTAAGGTGTCTGTGCCTGG - Intergenic
1063274858 10:4554408-4554430 GCTCTTAAGATGTGTGTGGCGGG + Intergenic
1063841386 10:10075890-10075912 CCTTTAAAGCTCCTTGTGGATGG + Intergenic
1063972953 10:11394235-11394257 CCTTTTAAGCTCTTTACGGTGGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065709311 10:28500176-28500198 CCTTTTAAACTCTTTAAGGCCGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067808464 10:49409282-49409304 TTTTTTAAGTTGTTTGTGCCGGG + Intergenic
1068143123 10:53030132-53030154 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1069552224 10:69372486-69372508 CATTTTACCCTCTTTGTGGCAGG + Intronic
1070340969 10:75498285-75498307 CCTTTTAAGTTCTGTATGGCAGG + Intronic
1075828010 10:125377146-125377168 CCTTCTAAGCCCTTTGTGGGTGG + Intergenic
1076998238 11:309635-309657 CCTTTTAATCTCTTTAAGGCGGG + Intronic
1079650257 11:22919706-22919728 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1081043234 11:38237606-38237628 GCTTATACGCTGTTTGTGGAGGG - Intergenic
1082949001 11:58790203-58790225 CCTTTTAAACTCTTTTAGGCGGG + Intergenic
1083206598 11:61153555-61153577 GCTTTTTAGTTTTTTGTGGCAGG - Intronic
1083848357 11:65350299-65350321 CTATTTAAGCTGGCTGTGGCTGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1084288279 11:68145870-68145892 CCCTTTAAGCTGGATGAGGCTGG + Intergenic
1085558626 11:77449262-77449284 CTTTTTAAGCTGTTTCTGTGTGG - Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086844479 11:91731175-91731197 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1087794773 11:102444081-102444103 ACTTTTACGCTGTTGGTGGGAGG + Intronic
1088629727 11:111763164-111763186 TCTTTCAAGCTTTCTGTGGCTGG - Intronic
1091356953 11:134944520-134944542 ATGTTTAAGCTGCTTGTGGCTGG - Intergenic
1092164767 12:6336164-6336186 CCTTTAAGGCTGTCTGGGGCTGG - Intronic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092357449 12:7808466-7808488 CCTTTTTAGTTGTTTTTGGTAGG + Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093072043 12:14715760-14715782 CCTTTTAAACTCTTTCAGGCGGG + Intergenic
1093491161 12:19706383-19706405 CCTTTTAAGCTCTTTGAGAAAGG - Intronic
1094275296 12:28668592-28668614 CCTTTTAAGCTCTCTGGGGGAGG + Intergenic
1095369186 12:41446057-41446079 CCTTTTAAGCTTTTTGTTGAGGG - Intronic
1095878323 12:47105751-47105773 GCTTTAATGCTGTTTGTGGAAGG + Intronic
1097363572 12:58685576-58685598 CCTTTTAAACTGTTCCTGTCTGG + Intronic
1098956220 12:76692609-76692631 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1098956953 12:76697513-76697535 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1099040287 12:77645025-77645047 TTTTTTAAGCTGTTTTTGGGAGG - Intergenic
1100054601 12:90493359-90493381 CCTTTTCAGGTGAATGTGGCAGG + Intergenic
1102215148 12:111155900-111155922 TTTTTTAAGCTGTTTCAGGCAGG - Intronic
1103376892 12:120463619-120463641 CCATTTAAGCTGGTTGTGAATGG + Exonic
1104679192 12:130737386-130737408 CCTGTTCAGCTGTTTCTTGCTGG + Intergenic
1105223275 13:18353918-18353940 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1105831948 13:24170405-24170427 CCTTTTAAAATTTTTGTGGGTGG + Intronic
1106803185 13:33277915-33277937 ACTTTTAAAGTATTTGTGGCTGG + Intronic
1106858632 13:33880769-33880791 CATTATAAGATGTTAGTGGCTGG + Intronic
1107474551 13:40722671-40722693 CATTTTTACCTGTTTGTTGCTGG + Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107623125 13:42254043-42254065 CCTCTTAAGATGTTTCTGGTGGG + Intronic
1107912366 13:45117532-45117554 CCTATTAAGCAGGTTGGGGCTGG + Intergenic
1108510255 13:51149012-51149034 CCTTTCAAACTGTGTGGGGCAGG - Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1111337158 13:86839450-86839472 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
1112166341 13:96924244-96924266 GCTTTTATGCTGTTGGTGGGAGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114242127 14:20877727-20877749 CCTCTTAGGTTTTTTGTGGCTGG + Intergenic
1114248997 14:20941343-20941365 CCTTTTAGGTTTTTTGTGGCTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115869563 14:37784874-37784896 CCTTTGAAGCTTTGTTTGGCTGG + Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1118006647 14:61569414-61569436 CCTTGTAAGCTGTATCTGGCTGG - Intronic
1118722838 14:68606640-68606662 CCTCTTTAACTCTTTGTGGCTGG - Intronic
1119205007 14:72787699-72787721 ACTAATAAGCTGTTTGTGGTGGG + Intronic
1119536549 14:75407681-75407703 GCTTTTATACTGTTGGTGGCAGG - Intergenic
1119956449 14:78803454-78803476 CCTTTTAATCTGTGTGACGCTGG - Intronic
1120177554 14:81311177-81311199 CTTCTTAACCTGTTGGTGGCTGG - Intronic
1120352885 14:83386042-83386064 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1120527112 14:85590091-85590113 CCTTTTGAGCTCTTTGTTGTAGG + Intronic
1121321397 14:92993762-92993784 CTTTTTAAGCACTTTGGGGCAGG - Intronic
1121756734 14:96408989-96409011 CCTTGTAATCTGTGTGTGGAGGG + Intronic
1123576123 15:21671090-21671112 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1123612744 15:22113564-22113586 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1128121048 15:65146818-65146840 CCTTTTAAATTGTTGGGGGCAGG - Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130605497 15:85312879-85312901 ACTGGTAAGCTGTTTGTGCCTGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132072636 15:98792574-98792596 CATTTTAAGATGATTATGGCTGG + Intronic
1202984991 15_KI270727v1_random:405335-405357 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1133107331 16:3520990-3521012 CCTTTTTGGATGTTGGTGGCTGG + Intronic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1153174129 18:2351493-2351515 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1154992063 18:21606767-21606789 CTATTGAAACTGTTTGTGGCCGG - Intergenic
1156531141 18:37816423-37816445 ACTTTTAACCCATTTGTGGCTGG - Intergenic
1156547344 18:37977801-37977823 CCTTTTAATATGATGGTGGCTGG + Intergenic
1159610483 18:70519776-70519798 TCTTTTAAGTTTTTGGTGGCTGG + Intergenic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1164142372 19:22484250-22484272 ACTTTTAAGCGTTTTGTGGTGGG + Intronic
1164476100 19:28577103-28577125 CCTTTGAAGCTGTGTGTGAGGGG - Intergenic
1164966506 19:32489485-32489507 TCTTTTAAACTGTCTGTGGTAGG - Intergenic
1165603873 19:37082061-37082083 TCTTTTAACCTGTTTGTGTTTGG + Intronic
1167396629 19:49233743-49233765 CCTTTTTAGATGTGTGTGTCGGG - Intergenic
925807080 2:7661084-7661106 CCTTTAAAGCTTTTTGCAGCTGG - Intergenic
925864661 2:8216565-8216587 CCTTTGTAGCTTTTTTTGGCAGG - Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
928744769 2:34399050-34399072 CCTTTTCATCTTTTTGTGCCAGG + Intergenic
930250447 2:49028748-49028770 CCTTTTTAGCTGTTGGTTGGAGG + Intronic
933294527 2:80473985-80474007 GCATTGAAGCTGTGTGTGGCTGG - Intronic
934020622 2:87947873-87947895 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
934180662 2:89616803-89616825 CATTTGAAACTGTTTTTGGCAGG - Intergenic
934290962 2:91691059-91691081 CATTTGAAACTGTTTTTGGCAGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
939085255 2:137710635-137710657 CCTTTTAAACTCTTTGAGGTGGG + Intergenic
940741176 2:157509777-157509799 GATTTTTAGCTGTTTATGGCAGG - Intergenic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
944133537 2:196372885-196372907 CCTTTTTAGCTGTGTGAGGTTGG + Intronic
944231303 2:197395686-197395708 TCTTTTTAGCTTTTTGTTGCAGG - Intronic
946076346 2:217076867-217076889 CATTTTATGCTGTTGGTGACAGG + Intergenic
946348413 2:219130082-219130104 CCTTTTAAACTGGATGTGCCTGG - Intronic
948196574 2:236101230-236101252 CCTTTTAATCTGCTTGTGGTGGG - Intronic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1171101524 20:22388302-22388324 CCTTTTAAGTTGCTTGGGGATGG + Intergenic
1172157067 20:32834520-32834542 CCTTTTAAGCCATTTTTGGGGGG + Intronic
1173598193 20:44273625-44273647 CCTGTGAAGCTATATGTGGCTGG + Intronic
1173960380 20:47066794-47066816 CCTCTTAAGGTGATGGTGGCAGG - Intronic
1175595678 20:60230609-60230631 ACTTATGAGCTGTTTGTGGGAGG - Intergenic
1176731826 21:10506354-10506376 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1176815082 21:13592169-13592191 CCTTTTACACTGTTGGTGGGAGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1180862392 22:19092595-19092617 CCATTGAAGCTATTTGTGCCTGG - Intronic
1183084737 22:35479765-35479787 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
1183693175 22:39402846-39402868 CCTTAGAACCTCTTTGTGGCCGG - Intronic
949643539 3:6067228-6067250 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
952415771 3:33090605-33090627 CCTTTTTGTTTGTTTGTGGCCGG - Exonic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
953492099 3:43361298-43361320 CCTTGTAAGCCGTTTGCTGCAGG - Intronic
953559313 3:43972252-43972274 CATTTCAAGTTGTTTGTTGCTGG + Intergenic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
957445158 3:80307459-80307481 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
958100253 3:88999591-88999613 ACACTTAAGCTGTCTGTGGCTGG + Intergenic
958429453 3:94020607-94020629 CCTTGAAATCTGTTTGTGTCAGG + Intronic
962157289 3:132961418-132961440 CCTTTTACACTGTTGGTGGGAGG + Intergenic
963820289 3:149884215-149884237 CCTTTTAATTTTGTTGTGGCTGG + Intronic
964216839 3:154294629-154294651 CCTTTTAATATTTTTGTTGCTGG - Intronic
964373863 3:156030209-156030231 ATTTTAAAGCTGTCTGTGGCCGG - Intergenic
965099935 3:164283254-164283276 CATTTTAATCTATTTGTGGAGGG - Intergenic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
966269352 3:178085793-178085815 CCTTCCAAGCTGTCTGTGACTGG + Intergenic
967576891 3:191104968-191104990 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
967622404 3:191649921-191649943 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
969271200 4:6104642-6104664 ACTTTGAAGCTGTGTGGGGCAGG - Intronic
970084095 4:12325782-12325804 TCTTTTTAGCTTTTTATGGCAGG + Intergenic
971853141 4:32010225-32010247 CCTTTCAAGCTCCTTGTGGGAGG + Intergenic
971980116 4:33741167-33741189 CCTTTTAAACTCTTTAAGGCAGG - Intergenic
972049833 4:34715643-34715665 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
972058670 4:34838153-34838175 GCTTTTACGCTGTTGGTGGGAGG - Intergenic
972249745 4:37287325-37287347 CCTTTTGAGCTTTTTGCGACGGG + Intronic
972880704 4:43418413-43418435 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
972971878 4:44586275-44586297 CCTTTTAATCTTTTTGAGGTAGG - Intergenic
973119549 4:46503695-46503717 CTTTTTTAGCTTTTTGTGGGGGG - Intergenic
974520979 4:62979288-62979310 CCTTTTAAGCTCTTTAAGGTGGG + Intergenic
974697367 4:65393499-65393521 CCTTCTTAGCTGACTGTGGCTGG + Intronic
974825001 4:67116980-67117002 CCTTTTATACTGTTGGTGGGGGG + Intergenic
974957731 4:68663772-68663794 GCTTTTAAGGTGTTTTTGGGGGG - Intronic
974994722 4:69140586-69140608 CCTTTTAAACTCTTTAAGGCGGG - Intronic
975001228 4:69224858-69224880 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
975004209 4:69267426-69267448 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
977419684 4:96782936-96782958 ACTTTTAAGATTTTTGTGGTTGG + Intergenic
980185974 4:129461883-129461905 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
980392361 4:132163157-132163179 CCTTTTAAGCTCTTTAAGGCGGG - Intergenic
980571233 4:134622855-134622877 CCTTTTAAACTCTTTAAGGCGGG + Intergenic
980864808 4:138542376-138542398 CCTTTTAAGCTCCTTGTGGGAGG + Intergenic
985268282 4:188170578-188170600 GCTAATTAGCTGTTTGTGGCTGG - Intergenic
986173879 5:5335340-5335362 CCATTTATGATGTTTGTGGAAGG - Intergenic
988216953 5:28287293-28287315 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
994908638 5:105872947-105872969 CCTTTTAAGCTTTTTAAGGTGGG - Intergenic
997788514 5:136735975-136735997 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
999219774 5:149965184-149965206 ACTTACAAGCTGTGTGTGGCTGG + Intronic
999743253 5:154573093-154573115 ACTTTGAAGCTGTTTTTAGCAGG - Intergenic
1000511696 5:162190640-162190662 CCTATCAAGCTGTTTTTGCCCGG - Intergenic
1002412922 5:179097980-179098002 CCTTTTTAGCTGTTTTCAGCAGG - Intergenic
1002917300 6:1539739-1539761 CCTTGAAAGGTGATTGTGGCCGG - Intergenic
1003075948 6:2983763-2983785 TCTTTTAAAATGTTTGTTGCTGG - Intergenic
1008741535 6:54614952-54614974 CCTTTTGAGCTCCTTGTGGGAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1009763704 6:68040408-68040430 CCTTTTAAACTCTTTAAGGCCGG + Intergenic
1010285146 6:74068261-74068283 CCTCTTAAGATGTTTCTGGTTGG + Intergenic
1014201859 6:118617588-118617610 CCTTTTAAACTCTTTAAGGCGGG - Intronic
1014203191 6:118626592-118626614 CCTTTTAAACTCTTTAAGGCGGG - Intronic
1015082072 6:129239231-129239253 ACTTTTTAGCTGTGTGTGACAGG - Intronic
1015207156 6:130652793-130652815 CCATTTAAGATCTTTGTGGCTGG - Intergenic
1016516982 6:144905247-144905269 TATTTTAAGCTCTTTGAGGCAGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017421676 6:154279201-154279223 ACTTTCAAACTGTTGGTGGCTGG - Intronic
1017895227 6:158673732-158673754 CCTTCAAAGCTGTTCCTGGCGGG - Intronic
1018287839 6:162259839-162259861 CCTTTTAATCTCTTTGAGGATGG - Intronic
1018634216 6:165846669-165846691 TCCTTTAAGCGGTTTGTGGAAGG + Intronic
1021083024 7:16385993-16386015 ACATTTAAGCTGTCTGTGGACGG - Intronic
1021217009 7:17928656-17928678 GATTTTAAGATGTTAGTGGCGGG - Intronic
1021956113 7:25826097-25826119 CATTTTAAGATGATTATGGCAGG - Intergenic
1022448039 7:30485952-30485974 CTTTTTAACCTGTCTATGGCAGG + Intergenic
1024049868 7:45611826-45611848 CCTTTTCTGCTGTTTTTTGCTGG + Intronic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1026459351 7:70599789-70599811 CCTTCTAAGTTGTCTGTGGTGGG + Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1032180631 7:129673841-129673863 TTTTTTAAGCTGTTTTTGGCTGG + Intronic
1032661973 7:133994100-133994122 CCTAGTTAGCTGTTTGTGGCAGG - Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1033122132 7:138675674-138675696 ACTTTTTAGCTGTTTGGGGAGGG + Intronic
1033976665 7:147110982-147111004 GCTTTTATGCTGTTGGTGGGAGG - Intronic
1034597766 7:152215097-152215119 CATTTAAAACTGTTTTTGGCAGG - Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1035585721 8:771847-771869 CCTTCTAAACTGATTGTGTCTGG + Intergenic
1037253070 8:16919802-16919824 CCTTGGAAGCTGAATGTGGCTGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039630143 8:39102244-39102266 CTTTTTTAGCTGTTTTTGACGGG - Intronic
1039899567 8:41741422-41741444 ACTTTTAAGATTTTGGTGGCTGG + Intronic
1040846691 8:51850447-51850469 CCATTTTATCTGTTTGTGGTAGG - Intronic
1043223872 8:77699659-77699681 CCATTTGAGCTCTTTGTGGGAGG - Intergenic
1045434189 8:102144144-102144166 CCTCTTAAGCTATGTTTGGCAGG + Intergenic
1045928435 8:107597575-107597597 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1046048434 8:108990381-108990403 ACTTTTACACTGTTTGTGGTTGG + Intergenic
1046337820 8:112813267-112813289 CCTTTTAAACTCTTTAAGGCAGG + Intronic
1052247139 9:26349356-26349378 CCTTTTAAACTCTTTAAGGCGGG - Intergenic
1052372674 9:27683327-27683349 CCTTGAAAACTGTTTGTGACAGG + Intergenic
1054873843 9:70074911-70074933 TCTTTGCAGCTCTTTGTGGCTGG - Intronic
1061319801 9:129821595-129821617 CCATAAAAGCTGTTTGCGGCTGG + Intronic
1061858525 9:133456060-133456082 CCTTTTCAGGTGCCTGTGGCAGG + Exonic
1062351137 9:136139348-136139370 TTTTAAAAGCTGTTTGTGGCTGG - Intergenic
1203532277 Un_GL000213v1:157261-157283 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186520755 X:10204796-10204818 CCTTTTTAGGGGTTTGCGGCTGG + Intronic
1186887084 X:13924595-13924617 CCGTTGAAGGTGGTTGTGGCCGG - Intronic
1187362105 X:18638027-18638049 CCTTGTAAGCTGTTTGTCAGTGG + Intronic
1190362533 X:49662573-49662595 CATTTGAAACTGTTTGTAGCAGG + Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1193462294 X:81805925-81805947 CCTTTTAAACTTTTTAAGGCGGG + Intergenic
1193463020 X:81812006-81812028 CCTTTTAAACTTTTTAAGGCGGG + Intergenic
1193941023 X:87681207-87681229 CCTTTTCAACTCTTTGAGGCGGG - Intergenic
1197204255 X:123776352-123776374 CCTTTAAAGCTTCTTGGGGCCGG + Intergenic
1198536527 X:137591859-137591881 CCTTTTCTCCTGTTTCTGGCAGG + Intergenic
1199033048 X:143023199-143023221 CATTTTAAGCTGTCTAAGGCAGG - Intergenic
1199123899 X:144091256-144091278 CCTTTTAAACTCTTTAAGGCAGG + Intergenic
1201427708 Y:13872563-13872585 CCTTTTAAAATGTGTGTGGGGGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201749654 Y:17419074-17419096 CCTTTTAAACTCTTTAGGGCGGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic