ID: 1009524996

View in Genome Browser
Species Human (GRCh38)
Location 6:64732600-64732622
Sequence CAATTTTACTATACGCCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009524996_1009524999 -4 Left 1009524996 6:64732600-64732622 CCTAGTGGCGTATAGTAAAATTG 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1009524999 6:64732619-64732641 ATTGTAGGCATAAGGATAAAAGG 0: 1
1: 0
2: 0
3: 13
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009524996 Original CRISPR CAATTTTACTATACGCCACT AGG (reversed) Intronic
908039158 1:60088786-60088808 CAATTTTAATCTAGACCACTCGG + Intergenic
909421752 1:75474991-75475013 CGATTTTACTTTATGCCATTTGG - Intronic
911536143 1:99103158-99103180 CTATTTTACTATAAGACAATAGG - Intergenic
912193216 1:107365660-107365682 TATTTTTTCTATATGCCACTTGG + Intronic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
918442172 1:184578499-184578521 CAATTATGCTAAATGCCACTTGG - Intronic
921123520 1:212157241-212157263 CAATTTTACCATAGGCTAATGGG - Intergenic
1065469288 10:26060586-26060608 CAATTCTAATATATGGCACTTGG + Intronic
1067798090 10:49335253-49335275 TATTTTTACTCTAAGCCACTAGG + Intergenic
1068411417 10:56660500-56660522 CAATTTTTCTAGACACCACTTGG - Intergenic
1072246654 10:93549650-93549672 CATTTTTGCTTTAAGCCACTAGG - Intergenic
1079551514 11:21704665-21704687 CAATTTTACTATAGGCTTTTTGG + Intergenic
1080202392 11:29688062-29688084 CAAATTTAATATAAGCCCCTTGG - Intergenic
1086367948 11:86126919-86126941 CAAATTTACTAAACCCAACTAGG - Intergenic
1093116232 12:15214838-15214860 CAATTTTATTTTAAGACACTGGG - Intronic
1094054421 12:26254935-26254957 GAATGTTTCTATATGCCACTTGG - Intronic
1109690259 13:65879004-65879026 CTATTTTACCATAAGCCAATTGG + Intergenic
1112313609 13:98341738-98341760 CCATTTTACTATCAGTCACTGGG + Intronic
1112716003 13:102186392-102186414 CAATATTAATATATGCCACTAGG + Intronic
1118085528 14:62411550-62411572 AAATTTTAGTACACGCCACTAGG - Intergenic
1120297102 14:82655851-82655873 CAATTTTGCTATATATCACTGGG - Intergenic
1125497062 15:40206686-40206708 CAATGGTACTATACTCCTCTCGG - Intronic
1130025283 15:80265792-80265814 CAAATTTACTAAAAGCCACTGGG - Intergenic
1145194484 17:20877464-20877486 AACTTTTACTAGACCCCACTGGG - Intronic
1148519845 17:48262313-48262335 CAATTTTAATATATGCCTTTTGG - Intronic
1155978283 18:32155267-32155289 CAATTTTACCATAGGCTAATTGG - Intronic
943537653 2:189172374-189172396 CAATTTAAAAATACACCACTAGG + Intronic
948112991 2:235471882-235471904 AAATTTTACTATATGGCACGTGG - Intergenic
948650166 2:239438320-239438342 CAATTTTACTATATGCTATTTGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1176267148 20:64215942-64215964 CAACTTTTCTATCTGCCACTGGG + Intronic
1177277455 21:18931569-18931591 AAAGTTTACTAGACCCCACTTGG - Intergenic
1181093397 22:20489624-20489646 CAATTTTAGAATACCCCAATGGG - Intronic
954284344 3:49608087-49608109 CAATTCCACTATTGGCCACTTGG - Intronic
958997079 3:100917076-100917098 TATTTTTACTATAGGCAACTAGG + Intronic
965033778 3:163407862-163407884 CAATTATAAAATAGGCCACTTGG + Intergenic
967258966 3:187623238-187623260 CAATTTTCCTTTAGGCCAATAGG - Intergenic
968508325 4:982622-982644 CACGTTTATTATAAGCCACTGGG + Intronic
971988519 4:33860837-33860859 GACTTTTACTAGACGCCATTGGG + Intergenic
975111936 4:70638230-70638252 CCTTTTTACTATACCACACTAGG + Intronic
976084245 4:81391139-81391161 TTATTTTACTATAGCCCACTTGG - Intergenic
976557601 4:86467240-86467262 CAATTTGATTATGCGACACTTGG - Intronic
976914688 4:90357484-90357506 CAATTTTACTATGTTCCATTTGG - Intronic
977956819 4:103037334-103037356 CAATTTTACCATAGGCCAATTGG - Intronic
988634950 5:32972846-32972868 CAATTTTTTTATCAGCCACTTGG - Intergenic
994354890 5:98783734-98783756 CAATTTTAATATATGCTATTGGG - Intronic
996241244 5:121205725-121205747 CAATTTTATTATACTGCATTTGG + Intergenic
1000903371 5:166935251-166935273 CTAATTTACAATAGGCCACTGGG - Intergenic
1008542697 6:52559049-52559071 GAATGTTACTATACACTACTTGG + Intronic
1009524996 6:64732600-64732622 CAATTTTACTATACGCCACTAGG - Intronic
1013857641 6:114593333-114593355 CAATTTTGCTATACCCCAGTGGG + Intergenic
1023589647 7:41767626-41767648 CAAGTTTTCTATAGGCCATTTGG + Intergenic
1024368104 7:48546619-48546641 CCATTTTAATATATGCAACTGGG + Intronic
1025592887 7:62885289-62885311 CTATTTTACAATAAGCCTCTAGG - Intergenic
1042770927 8:72381507-72381529 AAAGTTTTCTATATGCCACTCGG + Intergenic
1045903570 8:107314564-107314586 CAATTTTGCCTTAAGCCACTGGG + Intronic
1046139130 8:110066747-110066769 CTATTTTACTATATACCATTAGG + Intergenic
1203626046 Un_KI270750v1:24162-24184 AACTTTTACTAGACCCCACTGGG + Intergenic