ID: 1009526343

View in Genome Browser
Species Human (GRCh38)
Location 6:64751254-64751276
Sequence CACCAACTCCTCTGCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009526343_1009526349 19 Left 1009526343 6:64751254-64751276 CCTCCCACGCAGAGGAGTTGGTG 0: 1
1: 0
2: 1
3: 17
4: 104
Right 1009526349 6:64751296-64751318 CCACACTTAGATATCTCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009526343 Original CRISPR CACCAACTCCTCTGCGTGGG AGG (reversed) Intronic
903466317 1:23554751-23554773 CAGCGACTCCGCTGGGTGGGGGG + Intergenic
906524821 1:46487978-46488000 CACCATCTCCTCAGCTTGTGTGG + Intergenic
913070620 1:115295178-115295200 CTCCAACTCCTCTTCGTGGTTGG - Intronic
915622639 1:157095311-157095333 CACCAAATGCTCTGAGTGAGGGG + Intronic
918212155 1:182360638-182360660 CCACAACTCCTCTGCATGAGAGG - Intergenic
920681008 1:208072749-208072771 CACTTACTCCTATGAGTGGGAGG - Intronic
921839219 1:219810682-219810704 CAGCAACTCTTGTGCGTAGGAGG - Intronic
921855262 1:219975262-219975284 CACCCCCTCCTCTGCGTGAATGG - Intronic
923346382 1:233057331-233057353 AACCAACTCTTCTGCTTGGGGGG - Intronic
1063191031 10:3695251-3695273 CACCACTTCCTCTGGATGGGAGG - Intergenic
1065528778 10:26648189-26648211 CACCAACTCCACTGCTTTGGAGG + Intergenic
1067254681 10:44625171-44625193 CACCAACTCCTCTGCCCAGAAGG + Intergenic
1070302184 10:75211324-75211346 GACCACCTCCTCTGCGGAGGAGG + Intronic
1070774803 10:79103388-79103410 CGCCAGCTCCTTTGCCTGGGTGG - Intronic
1072395226 10:95032843-95032865 CCCCAAGTCCTCTGCATGGGTGG + Intergenic
1073180912 10:101582670-101582692 CCCCAACTCCTCAGCTGGGGAGG - Intronic
1075221625 10:120589835-120589857 CACCAAGTCTTCCACGTGGGAGG - Exonic
1076684337 10:132190324-132190346 CCCAGCCTCCTCTGCGTGGGTGG + Intronic
1078840452 11:15072612-15072634 CACCTGCTCCCCTCCGTGGGTGG + Intronic
1082799720 11:57405802-57405824 CACCAGTTCCTCTGCGTGGGTGG - Intronic
1083453343 11:62761509-62761531 CACCACCTCCTCCGCGAGGGCGG - Intergenic
1083687013 11:64382538-64382560 CTCCACCTCCTCTGCATCGGGGG - Intergenic
1083858899 11:65408976-65408998 CACCATCTTCTCTGCTGGGGAGG - Intronic
1084164224 11:67367467-67367489 CACCAACTCCGCAGCTTGGCTGG - Exonic
1086183912 11:83990505-83990527 CACCTCCTCCTCAGCGTAGGCGG - Intronic
1087381023 11:97405118-97405140 CTGCAACTCCACTGAGTGGGGGG - Intergenic
1089737692 11:120561416-120561438 CAGCAAGGCCTCTGCCTGGGAGG + Intronic
1096558126 12:52416438-52416460 CATCAGCTCATCTGCGTGGAGGG + Intergenic
1098081122 12:66786628-66786650 CACCAAATACTCTGCCTGGGAGG + Intronic
1102512657 12:113426073-113426095 ACCAAACTCCTCTCCGTGGGCGG + Intronic
1104292346 12:127482123-127482145 AGCCAACTCCTCTCGGTGGGTGG - Intergenic
1106144272 13:27037714-27037736 CACCAACTCCCCTGGGGTGGCGG + Intergenic
1108014198 13:46056705-46056727 CACCAACTTCTTTGCTTGGAAGG + Intronic
1110595868 13:77319876-77319898 CACCAACTGCTTTGGGTAGGAGG + Intronic
1114646473 14:24259165-24259187 CACCAACCCATCAGCGTGGGTGG - Exonic
1122692747 14:103538898-103538920 CACCAACGCCACTGCTTTGGAGG - Intergenic
1125182061 15:36888633-36888655 CACCAACCCCGCTGGGTGGGCGG + Intergenic
1126995240 15:54435562-54435584 CACCAGGTCCTCTCGGTGGGTGG + Intronic
1127603393 15:60561807-60561829 CACCACCACCCCTGCATGGGGGG - Intronic
1127931417 15:63599900-63599922 CTTCATTTCCTCTGCGTGGGGGG - Intronic
1129153762 15:73704806-73704828 CAGGAACTCCTCTGAGTGGTAGG + Intronic
1131526928 15:93160015-93160037 CACCAACTCTGCTGCGGGTGAGG - Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1135921865 16:26657576-26657598 CACAAACTCCTCTGCTTCAGTGG - Intergenic
1137476254 16:48811839-48811861 GACCAGCACCTCTGCCTGGGAGG - Intergenic
1140479150 16:75253227-75253249 CACCCACTCCTCAGCCTGGCTGG + Intronic
1141756377 16:85993979-85994001 CACCAACTCCTGTGTGTTGGGGG + Intergenic
1143102752 17:4513335-4513357 CGCCAACGCCTGGGCGTGGGGGG - Intronic
1143766070 17:9138522-9138544 CACCAAGTGCCCTGCGTGGATGG + Intronic
1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG + Intronic
1151421669 17:74002303-74002325 TTACAACTCCTCTGGGTGGGAGG - Intergenic
1151736075 17:75941104-75941126 CCCCACCTCCTCTGTGAGGGCGG - Intronic
1152080822 17:78186468-78186490 CACCAAGTCCTCTGAGAAGGTGG - Intronic
1152391424 17:80006099-80006121 CACCAACACCCCTGCCTGGCGGG + Intronic
1153622287 18:6990425-6990447 CACCAACTCAGATGTGTGGGGGG + Intronic
1156936823 18:42719427-42719449 CACCAACTGCTCTTCTTGGCAGG + Intergenic
1159026097 18:63183339-63183361 CACCAACTCCTGGGTGGGGGTGG - Intronic
1160001835 18:75032117-75032139 AACCAACCCCTCAGTGTGGGGGG - Intronic
1160605404 18:80046073-80046095 CTCCAACTCCTCTGTGTCCGGGG - Exonic
1161389646 19:4014501-4014523 CACCAAGTCCTCTGTGTGCCTGG + Intronic
1162415464 19:10533828-10533850 CAACAACTGCTCTGCCTGGGAGG + Intergenic
1166046322 19:40233015-40233037 CACCCTCTCCTCTGCGGGGGTGG - Exonic
1166770690 19:45280362-45280384 CACCATCACCTCTGGGAGGGGGG - Exonic
928127608 2:28627213-28627235 AACCAACTCCTGTGTGTGGGAGG - Intronic
929316456 2:40484789-40484811 CACCAGCTCCTCTGTGTTAGTGG - Intronic
930037994 2:47099813-47099835 CACCAGCTGCTCTGAGTGTGGGG - Intronic
932763706 2:74457410-74457432 CAGCATCTCCTCTGTGAGGGCGG - Exonic
933787328 2:85853853-85853875 AACCACCTCTTCTGCGTGGAAGG + Intronic
937500653 2:122475024-122475046 CACCAAATAATCTGGGTGGGTGG + Intergenic
938610774 2:132945335-132945357 CTCCAACTCCTTTGCTTGGAAGG + Intronic
942025135 2:171903265-171903287 CACCAACTCTTTTGAGTAGGAGG + Intronic
944607300 2:201363611-201363633 TACCAAGACCTCTGCGTAGGAGG - Intergenic
1174853211 20:54017195-54017217 CAGCAACTCCTCTGCTTGAGGGG + Intronic
1175403620 20:58713952-58713974 CACCAACAGCGCTGAGTGGGAGG + Exonic
1177124783 21:17182254-17182276 CACCAACTCCTCTGTTGGGTAGG + Intergenic
1183590516 22:38776938-38776960 CACCAGCTCCTCGGGGTGGGTGG - Intronic
1185328491 22:50239857-50239879 CCCCAACTGCTCTGCCTGGCAGG + Intronic
1185383516 22:50521308-50521330 CCCCTACTCCTCTGGGAGGGTGG + Intronic
950088492 3:10278363-10278385 GACATACTCCTCTGCCTGGGAGG + Exonic
950427900 3:12934564-12934586 CACCAACTCCCCTGGGCTGGTGG - Intronic
951334698 3:21406410-21406432 CACCACTTCCTGGGCGTGGGGGG - Intergenic
953422397 3:42764689-42764711 CAGCCACTCCTCTACCTGGGAGG + Intronic
954104134 3:48399982-48400004 CACCAACTCACCAGCATGGGTGG + Intronic
955078954 3:55640107-55640129 CACAGACTTCTCTGCGGGGGAGG - Intronic
960031506 3:113059106-113059128 CACCAACTCCTGTGTGTCTGAGG - Intergenic
960071013 3:113431027-113431049 CTCCAACTTCTCTGCTTGGGTGG + Intronic
965165854 3:165194137-165194159 CACCAACTCCTCGCCGGGAGGGG + Intronic
965839459 3:172887187-172887209 CAGCCACTCCTCTGCTTGGGAGG + Intergenic
969077465 4:4591462-4591484 CACCAACTCTTCTGCCTCTGTGG + Intergenic
975848945 4:78552008-78552030 CCCCAACCCAGCTGCGTGGGTGG + Intronic
977470722 4:97438364-97438386 CACCAGCTGCTCTGAGTGCGGGG + Intronic
980393009 4:132170086-132170108 CACCAACTCCCTTGGCTGGGGGG + Intergenic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
985365077 4:189221867-189221889 CACCAGCTGCTCTGAGTGGCTGG - Intergenic
990812626 5:59746465-59746487 CACAAACTCCTCTGCTGGGATGG - Intronic
992817379 5:80457415-80457437 CTCCAACTCCTCTTAGTTGGTGG + Intronic
999737482 5:154523534-154523556 GACCAACTCCTCTGTGTCAGAGG + Intergenic
1000220548 5:159209669-159209691 CACCGCCTCCGGTGCGTGGGCGG + Intronic
1001494082 5:172175599-172175621 CACCACTTCCTCTGCATGAGAGG + Intronic
1002787231 6:411608-411630 CAGACACTCCTCTGTGTGGGAGG - Intergenic
1005882563 6:30072194-30072216 CCCCAATTCCTGTGGGTGGGTGG - Intronic
1007681927 6:43640013-43640035 CAGCATCTCCTCTGCCTGTGAGG - Exonic
1009526343 6:64751254-64751276 CACCAACTCCTCTGCGTGGGAGG - Intronic
1017251413 6:152284098-152284120 TACCAGCTCCTCTGCGAGAGAGG + Exonic
1021312678 7:19112616-19112638 CACGGTCTCCCCTGCGTGGGTGG - Intronic
1023261558 7:38363517-38363539 CACCAACCCTTCTGGGAGGGAGG - Intergenic
1023497672 7:40815552-40815574 CACCAAGTTCTCTGCTCGGGAGG + Intronic
1025104154 7:56157146-56157168 CAGCACCTCCTCTGCTTGGGAGG - Intergenic
1029058120 7:97768076-97768098 TACCACCTCCTCTGCCTGGAAGG - Intergenic
1040370145 8:46762315-46762337 TACCACCTCCTCTGCCTGGAAGG + Intergenic
1043489101 8:80730037-80730059 CACCAACACCTATGCATAGGTGG + Intronic
1047835194 8:128681687-128681709 CACAAACTCCTCCGCCTGGCTGG + Intergenic
1048256852 8:132911415-132911437 CAACAACTCCTCTGTGCAGGTGG + Exonic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1051398715 9:16656334-16656356 CAGAAACTCCTCAGCATGGGTGG - Intronic
1058920428 9:109609373-109609395 CACCACCACCTCTACCTGGGAGG + Intergenic
1061248136 9:129411987-129412009 CACCACCAGCTCTGCGTGGACGG + Intergenic
1062217817 9:135398810-135398832 CACGCATTCCTCTGCCTGGGTGG - Intergenic
1186868957 X:13750487-13750509 CACCAACTCCTTAGCCAGGGAGG - Intronic
1189330615 X:40142578-40142600 CTCCAGCTCCTGTGCGTGAGGGG + Intronic
1199056163 X:143297494-143297516 CAACAACTCCACTGGGTTGGTGG + Intergenic
1201789241 Y:17819994-17820016 CACCAACTCCCCAGCCAGGGAGG - Intergenic
1201812312 Y:18085993-18086015 CACCAACTCCCCAGCCAGGGAGG + Intergenic