ID: 1009528641

View in Genome Browser
Species Human (GRCh38)
Location 6:64780913-64780935
Sequence CTCAAATAACAGTCTAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009528641 Original CRISPR CTCAAATAACAGTCTAATGT GGG Intronic
900923117 1:5686189-5686211 CTCTAATGACAGTCTCTTGTAGG - Intergenic
902960058 1:19957119-19957141 CTCAAATAAAGGTCTAAGGGAGG + Intergenic
904095417 1:27973082-27973104 CTCAAATCCCATTCTAAAGTAGG - Exonic
904298215 1:29537405-29537427 CTCTGATAACAGTGTACTGTGGG - Intergenic
905187389 1:36206315-36206337 CTCAAAAAAAAGTAAAATGTAGG + Intergenic
905320543 1:37113696-37113718 CTCACGTCACAGTCTGATGTGGG - Intergenic
906938623 1:50236228-50236250 CTCAAGAAGCAGTATAATGTGGG + Intergenic
909539660 1:76776970-76776992 CTCAGTTAAAAGTTTAATGTAGG + Intergenic
910794321 1:91082591-91082613 CTCAAATAACAGACTCATTCTGG + Intergenic
912417950 1:109523075-109523097 CTCGCATAACAGTTTAATGCAGG + Intergenic
912943403 1:114065204-114065226 CTCAGCTTACAGTCTATTGTGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915047898 1:153034176-153034198 CTCATATAAAAGTCCAATATGGG + Intergenic
916340407 1:163727361-163727383 TTCAAATAGCAGTTTACTGTAGG + Intergenic
917176430 1:172240561-172240583 CTTAAATAACAGTGTTATTTTGG - Intronic
919015416 1:192027178-192027200 ATCAAAAATCAGTATAATGTTGG + Intergenic
920713949 1:208321783-208321805 TTCATATCACAGTCCAATGTGGG + Intergenic
920752237 1:208689912-208689934 CTGAAATATAAGTCTAATGATGG + Intergenic
922075604 1:222240878-222240900 CACAAAGAATAGGCTAATGTGGG - Intergenic
1063855579 10:10248398-10248420 CTTATATGACAGTCTAATGGTGG + Intergenic
1065821066 10:29526019-29526041 CTCATATAACAGTAAAATGAAGG + Intronic
1066496335 10:35946019-35946041 CTCCAATAACCCTCTATTGTTGG + Intergenic
1068104528 10:52597246-52597268 CACAAATATCATTGTAATGTCGG - Intergenic
1071390123 10:85165727-85165749 CTCAAATGAGTGTCTAATGAGGG - Intergenic
1075368146 10:121911720-121911742 CTCACATAACAGTTCAGTGTGGG - Intronic
1075560257 10:123462945-123462967 TTCATTTAACAGTCTACTGTGGG + Intergenic
1079134977 11:17771331-17771353 CTCAGGTAACAGTTCAATGTGGG + Intronic
1081655597 11:44855344-44855366 GTCAAATAACAGGCTAGAGTTGG - Intronic
1083079902 11:60080550-60080572 TTCAAATAAAAGTCCAATGGAGG + Intergenic
1085343347 11:75748489-75748511 ATCAAATAATAGTCCATTGTAGG - Intergenic
1088822217 11:113466115-113466137 CTCAAAAACCAGGCTAATGCAGG - Intronic
1090562770 11:127950535-127950557 TTCAAATCATAGTCTCATGTTGG + Intergenic
1090621843 11:128567480-128567502 GTCAAAAAACAGTCTTTTGTTGG + Intronic
1093145707 12:15564052-15564074 CTCAAAAAACACTATCATGTTGG - Intronic
1098534946 12:71583779-71583801 CCCAATTAACAGTTTAATGGGGG - Exonic
1098792731 12:74846138-74846160 CCCAAATAACAGTTAAATGTGGG + Intergenic
1099073742 12:78079065-78079087 TTCAAATAACAGTTTTATTTTGG - Intronic
1100467524 12:94860156-94860178 CTCAAATAATGGTGTAATGGAGG - Intergenic
1100687225 12:96999903-96999925 CTAAATTAAGAGTCTAAAGTTGG - Intergenic
1100881460 12:99022350-99022372 TTCAAATTATAGTCCAATGTGGG - Intronic
1101316599 12:103634698-103634720 CTCATGTAACAGTCCAATGTGGG + Intronic
1105940871 13:25146783-25146805 ACCAATTAACAGTCTAATCTTGG + Intergenic
1108231047 13:48341270-48341292 TTCAAATAACATTCCATTGTAGG + Intronic
1108534080 13:51355286-51355308 TTCTAATAACAGTCAAATTTGGG + Intronic
1111229351 13:85322238-85322260 CTTAAATTACAGTTTCATGTAGG - Intergenic
1112685656 13:101822930-101822952 CTTAAAAAAAAATCTAATGTGGG - Intronic
1113466042 13:110513875-110513897 TTCAAATAACATTATAAGGTAGG - Intergenic
1114764396 14:25354332-25354354 CCCAAGTAACATTCTAATCTCGG - Intergenic
1114854468 14:26421472-26421494 CTCAAATAACAGTTGTATTTTGG - Intergenic
1115802404 14:37009942-37009964 CTCAAATAATTGTCTAATCTAGG + Intronic
1117115969 14:52512595-52512617 CTGAAACAACAGAATAATGTTGG + Intronic
1117445348 14:55798938-55798960 CTCACATAACAGTCAAATGCAGG + Intergenic
1121442973 14:93960320-93960342 CTAAGATCACAGTCTAATGAGGG - Intronic
1124420550 15:29517445-29517467 TTCAAAGAACGGTATAATGTAGG - Intronic
1125223336 15:37366276-37366298 ATCAAACCACAGTCTAATGGTGG + Intergenic
1126492653 15:49256452-49256474 ATCAAATAACAATCAAATGATGG - Intronic
1126791844 15:52228845-52228867 CTCAATTTACAGTCTAATTTGGG + Intronic
1126908495 15:53393375-53393397 CTCAAATAACAGTGTCATATTGG + Intergenic
1131850489 15:96538019-96538041 ATCAAATAACTGTTTGATGTTGG + Intergenic
1132080781 15:98863661-98863683 TTCAAATAACATTCATATGTGGG - Intronic
1133402538 16:5499235-5499257 CTCAAATATCTGTCTTATTTTGG + Intergenic
1133736806 16:8622023-8622045 CTCAAAAAACAGTCACAGGTCGG - Intronic
1138330478 16:56211308-56211330 CTGAAAGAACAGTCTACGGTTGG + Intronic
1141343193 16:83222483-83222505 CTTAAATAACTCTCTAATATGGG - Intronic
1141383268 16:83595551-83595573 CTCACATCACAGTCTAAAGCAGG + Intronic
1145735652 17:27229321-27229343 ATTTAATAACAGTATAATGTTGG - Intergenic
1146981341 17:37164607-37164629 CTCAAATATCAGGATAATTTTGG + Intronic
1147060512 17:37873566-37873588 GACAAGTAACATTCTAATGTAGG + Intergenic
1148512372 17:48182721-48182743 CTCAAATAAATGTCTGATGAAGG - Intronic
1153708608 18:7773905-7773927 CTCCAAAAGCAATCTAATGTTGG - Intronic
1157069973 18:44394945-44394967 CTTAAATAACAGTATAATACTGG + Intergenic
1157239575 18:45997065-45997087 TTCAAATTTTAGTCTAATGTTGG - Intronic
1160829363 19:1095839-1095861 CTCAGTTAACCGTCTAAAGTAGG - Intergenic
1164013533 19:21231346-21231368 CTCAATTATCTGTCTAATATTGG - Intronic
1165147353 19:33739476-33739498 CTAAAACAACAGTGTAATTTAGG - Intronic
1168326117 19:55539302-55539324 CTGAAATAACAGTCTGGTGTTGG - Intergenic
928110540 2:28505295-28505317 TTTAAATAAAAGTCTAATTTTGG - Intronic
929549190 2:42878702-42878724 CTCACATAACAGTCCACTATGGG + Intergenic
933839900 2:86278015-86278037 CCCAAATAACAGACATATGTAGG - Intronic
937603639 2:123771022-123771044 CTAACATAACAATCCAATGTGGG + Intergenic
937876512 2:126829804-126829826 ATCAAACAATAGACTAATGTGGG + Intergenic
939210691 2:139171581-139171603 CTCTAAAAAGAGTCTAATATGGG - Intergenic
940289089 2:152060186-152060208 CTTGAAAAACAGTCTAGTGTGGG - Intronic
940550063 2:155142442-155142464 CTCAATTAAAAGTCTATTCTTGG + Intergenic
942392540 2:175510585-175510607 CTCAATTAGCAGTCCAATGCAGG - Intergenic
943318762 2:186420314-186420336 CTTAAATAACAGTTTATTGCAGG + Intergenic
945229708 2:207573433-207573455 ATCAAATAACAGTTTAGTGATGG + Intronic
945415041 2:209560350-209560372 CTGAAAGAACAGTGTAATTTAGG + Intronic
947233506 2:227915280-227915302 CTCAAATGACAATCTATTATGGG + Intronic
947654663 2:231816579-231816601 TTCAATTTACAGTCTTATGTGGG + Intergenic
947781558 2:232769862-232769884 ATTAAATAACAGTCTAGTGGTGG + Intronic
1169798240 20:9488531-9488553 GGCAATTAACAGTCTAATTTGGG + Intergenic
1174850404 20:53988400-53988422 ATCAAATAAAAGTTTAAAGTTGG - Intronic
1177500469 21:21948203-21948225 CTCAGATAAGACTCTAGTGTTGG + Intergenic
1180792844 22:18586194-18586216 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1181228892 22:21409125-21409147 CTCAATTAAAAGTCAAATGAGGG - Intergenic
1181249759 22:21525740-21525762 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1182491444 22:30674844-30674866 CACAAATAAAAGTACAATGTGGG - Intergenic
1183223090 22:36529661-36529683 CTAAACTAACAGTCTGATCTAGG - Intergenic
949768687 3:7554615-7554637 CTCATGTCACAGTCTAGTGTGGG + Intronic
954521049 3:51226836-51226858 CTAAAATGCCAGTCCAATGTAGG + Intronic
956671476 3:71695577-71695599 GCCAAATAACAGTAAAATGTTGG + Intronic
959186032 3:103049296-103049318 CTCAAATAGAAGCCTGATGTTGG + Intergenic
959927079 3:111934973-111934995 CTCAAATAAAAGTTTGATTTTGG - Intronic
961742344 3:129040640-129040662 CTCTAATGACAGTCTAAGTTAGG - Exonic
962141112 3:132791851-132791873 CTCAAGTAAGAGTCCAATGCAGG + Intergenic
965462914 3:168990966-168990988 CTCAAAGAACAGAGTAAAGTAGG - Intergenic
967365707 3:188684140-188684162 GTCAATAAACAGTCTAATCTCGG + Intronic
967631820 3:191752427-191752449 CTCCAATAATATTCTAATGCTGG - Intergenic
971035835 4:22692011-22692033 CTCAAATAACTGTCTGATAAAGG - Intergenic
972743439 4:41910278-41910300 CTCAAAAAAAAATCTACTGTAGG - Intergenic
973768436 4:54185258-54185280 CTCTGATAACTGGCTAATGTAGG - Intronic
974359608 4:60860015-60860037 CTCAAATAAAAATATATTGTGGG + Intergenic
978495420 4:109354567-109354589 CTCATATAACAGTCTAAATTGGG - Intergenic
979136806 4:117120054-117120076 CTCACAGAAAAGTATAATGTTGG + Intergenic
982610367 4:157566681-157566703 CTTAAATAAATGTCTAAGGTAGG - Intergenic
983124684 4:163936133-163936155 CGCACACAACAGTCTTATGTAGG + Intronic
986758975 5:10862774-10862796 CTCAGATCTCATTCTAATGTGGG - Intergenic
988324914 5:29751720-29751742 GTCAAAATACAGTCTAATATAGG - Intergenic
990514267 5:56517429-56517451 CTCCAATGACTGTCTGATGTGGG + Intronic
990607094 5:57422290-57422312 CTCAAATCACAGTATATTTTTGG + Intergenic
991406704 5:66306898-66306920 CTCAAATTATATTCTAATGTGGG + Intergenic
994193956 5:96901143-96901165 CTCAAATAACAGTAGAATCCAGG - Intronic
996416816 5:123219789-123219811 CCCATATCACAGTCCAATGTGGG + Intergenic
996803792 5:127432097-127432119 ATGAAATAAAAGTCTATTGTTGG + Intronic
996837503 5:127810196-127810218 TTCAAATAACAGTCCATTGTGGG + Intergenic
997397681 5:133577450-133577472 CTTAAAGAACAGTCAAAGGTGGG + Intronic
997573621 5:134955249-134955271 CTTAAATTACACTCTAATTTTGG + Intronic
999824362 5:155259880-155259902 CTTACATAACAGTCCAATGGTGG - Intergenic
1001736255 5:174005835-174005857 TTAAAATAAGAGTCTAATGCTGG + Exonic
1004044065 6:12009789-12009811 TTCAAATAAAAGTTTAATATCGG + Intronic
1004748696 6:18538830-18538852 CTCATATAACTGTCTAATGAGGG + Intergenic
1005731207 6:28698632-28698654 CTCAAAATATAGGCTAATGTTGG + Intergenic
1007317651 6:41002446-41002468 TCCAAATCAAAGTCTAATGTAGG + Intergenic
1008473283 6:51908586-51908608 CTAAAATAAAAGTTGAATGTAGG - Intronic
1009528641 6:64780913-64780935 CTCAAATAACAGTCTAATGTGGG + Intronic
1015043490 6:128749830-128749852 CTCAAGTAATAGTTTAATATAGG + Intergenic
1016704591 6:147091901-147091923 CTCAATTAATAGTTAAATGTAGG + Intergenic
1017698781 6:157047086-157047108 CTCAAAAAATGGTGTAATGTTGG + Intronic
1018500504 6:164405675-164405697 CTCAAATAACACAATCATGTTGG - Intergenic
1018565970 6:165153417-165153439 CTAAAATAACACTGTAATGTTGG + Intergenic
1021344748 7:19511876-19511898 CTGAAATAACAATTTAATTTAGG - Intergenic
1023954555 7:44873844-44873866 CTAAACTAACAGTCTGATTTTGG - Intergenic
1024301261 7:47889451-47889473 CTCAAATAACAGTCAGTAGTCGG + Intronic
1027471752 7:78582643-78582665 CTCAAGCAACAGTCAAATGCAGG - Intronic
1028618330 7:92795948-92795970 CTCAAATAACACTTAAATGTAGG - Intronic
1028697044 7:93726344-93726366 CTCACAGAACAGTCTAGTGGGGG - Intronic
1030835678 7:114281534-114281556 ATCAAAGAAAAGTCTAATGCTGG - Intronic
1033976545 7:147109859-147109881 CTCAAATTACTGTTTTATGTGGG + Intronic
1037268705 8:17100431-17100453 CTCAATTATTATTCTAATGTGGG - Intronic
1037910972 8:22743401-22743423 CTCATAAAACAGGCTAATGACGG + Intronic
1038047964 8:23782560-23782582 ATCAATTAACAGTATACTGTGGG - Intergenic
1038352986 8:26797760-26797782 CTCAATAAACACTCAAATGTAGG - Intronic
1040139891 8:43897504-43897526 CTCCAAGAAAAGTGTAATGTTGG + Intergenic
1040713196 8:50214701-50214723 CTCTAATAACAGTGTTATTTGGG + Intronic
1042089308 8:65141333-65141355 CTAAAATAACAGTGCAATTTTGG - Intergenic
1042500620 8:69504570-69504592 ATAAAATAAGTGTCTAATGTTGG + Intronic
1043888367 8:85628812-85628834 CTCACTTAACAGTCCAATGAAGG + Intergenic
1044399246 8:91751076-91751098 CTCACATAATAGTTTAATGCAGG - Intergenic
1051887388 9:21907872-21907894 CTCAAATAATAGACTGATCTTGG + Intronic
1052414844 9:28165048-28165070 CAGGAAGAACAGTCTAATGTAGG - Intronic
1053479203 9:38403440-38403462 CTTATGTAACAGTCTAATGCAGG + Intergenic
1054724280 9:68634764-68634786 CTCACATCACAGTCCAATGAGGG + Intergenic
1056195166 9:84221647-84221669 CACAAACATCAGTCTAATGGCGG + Intergenic
1058809847 9:108629061-108629083 CTCTAATAATAGTATATTGTAGG - Intergenic
1059498146 9:114727327-114727349 CTCATATAACTCTTTAATGTAGG + Intergenic
1060242519 9:121916735-121916757 TACAAATCACACTCTAATGTGGG - Intronic
1186815411 X:13232798-13232820 CTCAAATAAATGTTTCATGTTGG - Intergenic
1187402224 X:18971081-18971103 CACATATAACAGTCCATTGTGGG - Intronic
1187750768 X:22462329-22462351 TTCATATAACAGTCTAATGCAGG + Intergenic
1188171221 X:26929770-26929792 TTCAAATATCAGTCAAATGAAGG + Intergenic
1189557751 X:42163190-42163212 CTCCAAGAAAAGTGTAATGTTGG - Intergenic
1190703107 X:53002801-53002823 CTCAAATAATACTCGAATATGGG - Intergenic
1190781850 X:53604457-53604479 CTAAAAGAACAGTCCAATTTAGG - Intronic
1193567782 X:83099602-83099624 CTCAAATATCAGTTTGTTGTAGG - Intergenic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1197298123 X:124744657-124744679 CTCAAACTAAAGTCTTATGTAGG + Intronic
1197578031 X:128245928-128245950 TTCATATAACAGTCCAATATTGG - Intergenic
1197589329 X:128389274-128389296 ATCAAAAAACAGTAGAATGTTGG + Intergenic
1201166269 Y:11211882-11211904 CCCAAATAATAGTCAAATTTAGG - Intergenic