ID: 1009528754

View in Genome Browser
Species Human (GRCh38)
Location 6:64782117-64782139
Sequence GGTTGGTATTCATAAGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009528754 Original CRISPR GGTTGGTATTCATAAGTTAT TGG Intronic
911698753 1:100925897-100925919 GGTTGGTATTCATCTGGCATTGG + Intronic
911737828 1:101357071-101357093 GGTTAGTATTCAAAATATATCGG - Intergenic
915643476 1:157248826-157248848 GTTTGTTTTCCATAAGTTATTGG - Intergenic
915906247 1:159879686-159879708 GGTTTGTATTCAGAACATATAGG + Intronic
917089157 1:171335605-171335627 GTATGCTATTTATAAGTTATTGG - Intronic
917462148 1:175241233-175241255 TGTTTGTTTCCATAAGTTATTGG - Intergenic
918771986 1:188573162-188573184 GGATGGTATACATAATTTATTGG + Intergenic
920882360 1:209892129-209892151 CCTTGGTATTCATAGGTGATTGG + Intergenic
923875826 1:238045917-238045939 TTTTTGTTTTCATAAGTTATTGG - Intergenic
1063242413 10:4184749-4184771 GTTTTGTTTTCATAGGTTATTGG - Intergenic
1068081055 10:52317637-52317659 GGTAGGTATTATTAATTTATTGG - Exonic
1071694137 10:87853930-87853952 TGTGGCTATTAATAAGTTATTGG - Intergenic
1074180137 10:111054173-111054195 GGCTGGAATTACTAAGTTATAGG + Intergenic
1075265177 10:120994840-120994862 TGTGAGTATTCTTAAGTTATGGG + Intergenic
1080112073 11:28579650-28579672 GGTTGGGAGTCAGAAGTTGTGGG + Intergenic
1080280307 11:30549550-30549572 AGTTGATATTCCTGAGTTATAGG - Intronic
1082705784 11:56493009-56493031 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1082706954 11:56503860-56503882 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1084406678 11:68978290-68978312 GGTTTGTAGTCAGAAGATATGGG + Intergenic
1086788205 11:90999375-90999397 AGTTGGTATTCCTGAGTTTTTGG - Intergenic
1095399276 12:41795936-41795958 GGCTGGTATTGATAAGTGTTTGG - Intergenic
1099437717 12:82663751-82663773 GGTTGCTATTAAAAAATTATGGG - Intergenic
1100419044 12:94412269-94412291 GTTTGGTTTTAAAAAGTTATTGG - Intronic
1106699127 13:32210219-32210241 AGTTGGTATTTAAAAGTGATAGG + Intronic
1106920027 13:34553320-34553342 GGTTGGTACTCCTCAGTTTTGGG - Intergenic
1111376260 13:87382063-87382085 GGTTGATATTCTCAAGTTAGTGG - Intergenic
1111603421 13:90503754-90503776 TTTTGGTATTTATAATTTATGGG + Intergenic
1112234048 13:97619224-97619246 GGTTTCAATTCATAAGGTATGGG - Intergenic
1112275305 13:98012347-98012369 GTTTTGTATTCAGAAGTTGTAGG - Intronic
1114463819 14:22906043-22906065 GGTTGGTATTCAAAATTTACTGG - Intronic
1124918251 15:33997886-33997908 AGTTGGTATTCATAAATTTAAGG - Intronic
1127969557 15:63947612-63947634 GATTGTTATTCCTAATTTATAGG - Intronic
1129025676 15:72571440-72571462 GGTTACTATACATCAGTTATGGG - Intronic
1129522890 15:76196957-76196979 GGCTGTAATTCATAAGTTATGGG - Intronic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1131996524 15:98138057-98138079 GATTGGAATTCATAATTTGTAGG - Intergenic
1134087076 16:11364755-11364777 GTTTGGTTTACATAAATTATTGG + Intronic
1142294966 16:89215196-89215218 TGTTGTTATTCTTGAGTTATAGG - Intergenic
1145028695 17:19488427-19488449 GGTTGGAATTCAAAAGTTGGAGG + Intergenic
1152331127 17:79673901-79673923 TGATGTTTTTCATAAGTTATAGG - Intergenic
1155733668 18:29194196-29194218 GCTTGGTTTTCATATGTTCTGGG + Intergenic
1155767067 18:29649214-29649236 GGTTTGTAGTCATTTGTTATAGG - Intergenic
1160243454 18:77138789-77138811 GTTTGGTAATCAGGAGTTATGGG + Intergenic
1164257193 19:23538572-23538594 GGGTGGTATGCCTCAGTTATAGG - Intronic
925683033 2:6443330-6443352 GGTTTGAATTCATATGTTTTGGG + Intergenic
926574097 2:14561340-14561362 GTTTGGAATTCCTAAGTTCTGGG + Intergenic
930481262 2:51951631-51951653 GGATTTTTTTCATAAGTTATAGG - Intergenic
930628266 2:53723338-53723360 TTTTGATTTTCATAAGTTATTGG + Intronic
930702650 2:54474514-54474536 GGTTGGATTAAATAAGTTATAGG + Intronic
931595920 2:63943443-63943465 GGTTGGAAAACATAAGTCATTGG - Intronic
931755124 2:65366919-65366941 GATTGGTAATCATAACTTACAGG - Intronic
931834193 2:66081859-66081881 GTTTGGTATTTATATGTTTTTGG + Intergenic
938450637 2:131416148-131416170 AGTCGGTTTTCATAAATTATTGG + Intergenic
942155955 2:173127768-173127790 GGTTGATATGCATGAATTATGGG - Intronic
942916705 2:181317679-181317701 GGATGGTAGTCATAAAATATGGG + Intergenic
944771015 2:202914160-202914182 GGTTGGTAATCATTTTTTATGGG + Intronic
945960260 2:216126277-216126299 GATTGTTAATCATAAGTTCTAGG + Intronic
947284454 2:228496892-228496914 GGTTGGAATCCATAACTTTTTGG - Intergenic
1170031659 20:11950298-11950320 GGCTGGACATCATAAGTTATGGG - Intergenic
952570428 3:34709443-34709465 TGTTTATATTCATAAGGTATTGG - Intergenic
961435090 3:126911443-126911465 GCTTGGTATTCCCAAGTTGTGGG + Intronic
962130061 3:132663027-132663049 GGTTCGTATTAATAACTGATAGG + Intronic
965613650 3:170570541-170570563 GGTTGGGATCCATTAGTTAATGG + Intronic
970066455 4:12099861-12099883 AGATGGTATTCATAAAATATTGG + Intergenic
970652043 4:18189558-18189580 GGATGATGTTCATAGGTTATAGG - Intergenic
974917061 4:68191119-68191141 GCTTGATATTCATAGCTTATTGG + Intergenic
975058708 4:69969878-69969900 GATTGCTATTCATAAGTGTTTGG + Intergenic
977439701 4:97048372-97048394 TGTTGTTATTAATAAATTATAGG - Intergenic
977833802 4:101624073-101624095 GGATAGTCTTCATAAGTTACTGG + Intronic
978995523 4:115146363-115146385 GCTTTGTATTCAGAAGTCATGGG + Intergenic
980783503 4:137522058-137522080 GGGTGGCATTCTAAAGTTATAGG - Intronic
982878776 4:160684408-160684430 TGTTAGTATACATAAATTATTGG + Intergenic
984480936 4:180301090-180301112 GGTTTTTATTCATAACATATGGG - Intergenic
989277491 5:39606845-39606867 AGTTGGTATTCATATTTTAATGG + Intergenic
990015722 5:51059794-51059816 GGTTGGTTGTCATTATTTATTGG - Intergenic
991552021 5:67848736-67848758 GGTTGGAATTTATATGGTATAGG - Intergenic
992216603 5:74530492-74530514 GGTTGGTATTCTTAATCTGTAGG + Intergenic
993727299 5:91382784-91382806 TTTTGTTATTCATAAGTCATTGG - Intronic
997206899 5:132055543-132055565 TATTGTTATTAATAAGTTATGGG - Intergenic
1000682543 5:164204103-164204125 GGTTTGTATTCACAAGTGAAGGG - Intergenic
1006175593 6:32119568-32119590 GGTTGGTCTCCATAAATTAAAGG - Intronic
1009528754 6:64782117-64782139 GGTTGGTATTCATAAGTTATTGG + Intronic
1011938722 6:92815419-92815441 AGTATGTATTCATGAGTTATAGG - Intergenic
1014179481 6:118369301-118369323 AGTTGGTAATAATAAGTAATGGG + Intergenic
1014672098 6:124317668-124317690 GGTTAATTTTCTTAAGTTATAGG + Intronic
1014903576 6:126999479-126999501 GGATGGTATTTATAGGTTAAAGG - Intergenic
1015833169 6:137390950-137390972 AGTTGGTTTTCATAAGGTCTAGG + Intergenic
1021133707 7:16942075-16942097 TGTTGTTGTTGATAAGTTATGGG + Intergenic
1022062766 7:26816368-26816390 TGTATGTATTCATAAGTGATAGG - Intronic
1022811472 7:33872956-33872978 GGTGGGTATAGATAAGTTAATGG + Intergenic
1026505884 7:70982817-70982839 GGTTGGTATTATTATTTTATGGG + Intergenic
1026505890 7:70982856-70982878 GGTTGGTATTATTATTTTATGGG + Intergenic
1026505896 7:70982895-70982917 GGTTGGTATTATTATTTTATGGG + Intergenic
1026505902 7:70982934-70982956 GGTTGGTATTATTATTTTATGGG + Intergenic
1026505908 7:70982973-70982995 GGTTGGTATTATTATTTTATGGG + Intergenic
1027952328 7:84832980-84833002 GGTTTGTATTCATAAAATATTGG + Intergenic
1031585791 7:123531287-123531309 GGTTGGTAATCATTTTTTATGGG - Intronic
1035914997 8:3609268-3609290 GATTGGTATTGAGAATTTATGGG - Intronic
1038463543 8:27738248-27738270 GTTTTGTTTCCATAAGTTATTGG - Intronic
1038733449 8:30148283-30148305 GGGTGGTATGCCTCAGTTATAGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058234824 9:102476783-102476805 GGTTTTTACTCATAAATTATAGG - Intergenic
1061767893 9:132893716-132893738 GCTTGGTATTCATAAATATTGGG - Exonic
1187005966 X:15232582-15232604 GGTTGTTTTTCATAAGCTGTTGG + Intergenic
1190788597 X:53678453-53678475 GGTTGATATTCATAAGTACTTGG - Intronic
1194426790 X:93748683-93748705 GGTTGGAATCCATAAGTTTGTGG + Intergenic
1195236752 X:102907035-102907057 GATTAGTATCCATAATTTATAGG + Intergenic
1195462850 X:105146812-105146834 GGTTGGGAGGCAGAAGTTATAGG + Intronic
1195958006 X:110354565-110354587 TCTTGGTATCCATAAGTGATTGG - Intronic