ID: 1009540791

View in Genome Browser
Species Human (GRCh38)
Location 6:64955660-64955682
Sequence GAATGCCTAAGCAAAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 2, 2: 8, 3: 19, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009540791_1009540795 8 Left 1009540791 6:64955660-64955682 CCATGGGTTTTGCTTAGGCATTC 0: 1
1: 2
2: 8
3: 19
4: 153
Right 1009540795 6:64955691-64955713 TAACTACGATGGAGTCACTATGG 0: 1
1: 0
2: 8
3: 16
4: 94
1009540791_1009540794 -3 Left 1009540791 6:64955660-64955682 CCATGGGTTTTGCTTAGGCATTC 0: 1
1: 2
2: 8
3: 19
4: 153
Right 1009540794 6:64955680-64955702 TTCTTGGGTAATAACTACGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009540791 Original CRISPR GAATGCCTAAGCAAAACCCA TGG (reversed) Intronic
901571070 1:10161072-10161094 AAATGCCACAGCAAATCCCAGGG - Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
909464109 1:75953560-75953582 AAAAGCCTAAGCAAAACTCTTGG + Intergenic
909840148 1:80310883-80310905 GGATGCCTCAGCTAACCCCAGGG + Intergenic
912439272 1:109686441-109686463 AAAGGCCTAAGCAAAACTCTTGG - Intronic
912442583 1:109710883-109710905 AAAGGCCTAAGCAAAACTCTTGG - Intergenic
912445653 1:109734170-109734192 GAGTGCCTAAGCAAAACCCATGG + Exonic
915321491 1:155058758-155058780 GAATGTCGAAGCAAATGCCATGG + Exonic
917095850 1:171398166-171398188 AAAAGCCTAAGCAAAACTCTTGG + Intergenic
917098088 1:171419806-171419828 AAAGGCCTAAGCAAAACTCATGG - Intergenic
918315256 1:183317720-183317742 GACTGCCTAAGATAACCCCAAGG + Intronic
918738592 1:188098125-188098147 GGATGCCTAAGTGAAACGCATGG + Intergenic
918821739 1:189265724-189265746 GAGTGCCTAAGTGAAACCCATGG + Intergenic
918822393 1:189271352-189271374 GAGTGCCTAAGTGAAACCCATGG + Intergenic
924587944 1:245376437-245376459 TAATGCCTAAGCCACACCCCAGG + Intronic
1065154096 10:22852100-22852122 GAATGCCTAAGAAAAGCACGTGG + Intergenic
1067614421 10:47749648-47749670 GAATGTGTAAGTAAAACCAATGG + Intergenic
1074241689 10:111645838-111645860 GAAGGCCAAAGAAATACCCAGGG + Intergenic
1087011245 11:93516075-93516097 GAATGCCTCAAGAAAATCCAAGG - Intronic
1087114505 11:94510751-94510773 GAAGGGCTTAGCAAAAGCCAAGG + Intergenic
1089268257 11:117282355-117282377 GAAAGCCTATGCTATACCCACGG - Intronic
1093841706 12:23910569-23910591 AAATGCCCAAGGAAATCCCAGGG + Intronic
1095756686 12:45775392-45775414 GATGCCCTAACCAAAACCCAAGG - Intronic
1096297629 12:50397197-50397219 AAATACTTAAGCAAAACCCCAGG - Intronic
1102879665 12:116474538-116474560 TAATGCCTAAGAAAATCCGAAGG + Intergenic
1106978952 13:35255338-35255360 GCATGCCTGAGCAAAACTCAGGG - Intronic
1110925071 13:81140815-81140837 AAATGCCTAGGCAAAACTCTTGG - Intergenic
1111466691 13:88622593-88622615 GAGTGCCTAAGTGAAACCTATGG - Intergenic
1111501741 13:89130463-89130485 GAGTGCCTAAGTAAAACTTATGG - Intergenic
1111516976 13:89346886-89346908 TTTTGCCTAAGCAAAACCCATGG + Intergenic
1111547213 13:89756056-89756078 GAGTGCCTAAGTGAAACTCAAGG - Intergenic
1112005240 13:95247820-95247842 GTAAGTTTAAGCAAAACCCATGG - Intronic
1112999879 13:105622181-105622203 AAGTGCCTAAGAAAAACCTAGGG + Intergenic
1116607224 14:47015707-47015729 GAAAGGGTAAGCAAGACCCAAGG + Intronic
1116779676 14:49223050-49223072 GCATGCGTATGCAAAACTCATGG + Intergenic
1117989364 14:61418674-61418696 TAATTCCAAGGCAAAACCCAGGG - Intronic
1120975062 14:90241067-90241089 GAATTCCTTAGCAAATCCAAAGG - Intergenic
1121647055 14:95525766-95525788 CAGTGGCTAAGCAAAACCCTAGG + Intergenic
1121982752 14:98468954-98468976 GAATGCATATGCAAAGGCCAAGG + Intergenic
1122647782 14:103206627-103206649 GAAGGCCTAGGCAAAACTCTCGG - Intergenic
1126192727 15:45895416-45895438 GAATGCCTAGACAGAACCTAAGG + Intergenic
1126645721 15:50873256-50873278 GAATTCCTAAGCAAACCCAAAGG + Intergenic
1127800061 15:62470357-62470379 TAATGCCTGAGCATAAGCCAGGG - Intronic
1130614684 15:85393441-85393463 GAATGCCCAAGCAAAAGCTTTGG - Intronic
1130625506 15:85510031-85510053 GACTGCCTGAGCAAAACGCAGGG - Intronic
1133143930 16:3769711-3769733 GAATGCCTAAGCACATCTGAAGG + Intronic
1133150015 16:3821016-3821038 TAATGCATAAGCAAAAACGACGG + Intronic
1137745319 16:50816215-50816237 TGATACCTGAGCAAAACCCAGGG - Intergenic
1138116428 16:54364264-54364286 GAAGCCCTTATCAAAACCCAAGG + Intergenic
1140703692 16:77606267-77606289 GAATGAGTAAGAAGAACCCAAGG + Intergenic
1141507186 16:84485537-84485559 GAATGCCAAAGGCAAACCCTGGG + Intronic
1143270699 17:5672627-5672649 GATTACCTAAGGAAAACTCAGGG + Intergenic
1145120310 17:20253490-20253512 GAATGCCTCTGTAAAAACCAGGG - Exonic
1146458431 17:33025027-33025049 CAAAGACTCAGCAAAACCCAGGG - Intronic
1149417178 17:56471346-56471368 GAATGCCTAAGCAGAAGAAAAGG - Intronic
1153184554 18:2471871-2471893 GAATTCCTAATCAAAAATCATGG + Intergenic
1156090452 18:33461758-33461780 AAATACCTAATAAAAACCCAAGG + Intergenic
1157932298 18:51836333-51836355 AAATGCCTAGGCAAAACTCTTGG + Intergenic
1159346800 18:67216314-67216336 GAATTCCCAAGCACAACCCAGGG - Intergenic
1159741874 18:72181549-72181571 GAGTGCCTAAGCAAAAACCATGG - Intergenic
1161914505 19:7218437-7218459 GAATCTCTGAGAAAAACCCATGG - Intronic
1164051477 19:21587973-21587995 GAATGCATAAGCCCACCCCAGGG - Intergenic
926758085 2:16252000-16252022 GAATTCCTGAGCAGAACCAAGGG - Intergenic
930897708 2:56464539-56464561 CTCTGCCCAAGCAAAACCCATGG + Intergenic
931571063 2:63669741-63669763 GAATGCATAAGCACAACACTGGG - Intronic
933613516 2:84460888-84460910 AAAGGCCTAGGCAAAACCCTTGG - Intergenic
936758068 2:115738292-115738314 GAATGCCCATGCAAAACCAAAGG - Intronic
939042567 2:137208468-137208490 AAAGGCCTACGCAAAACCCTGGG + Intronic
939055194 2:137356782-137356804 GTAAGCCCAGGCAAAACCCAAGG + Intronic
939070246 2:137530707-137530729 GAATGCCGAAGCAGAACTCTAGG + Intronic
939106499 2:137954529-137954551 AAAGGCCTAAGCAAAACTCTTGG + Intergenic
941945337 2:171090590-171090612 GAATACCTAGGAAAATCCCAAGG - Intronic
942941926 2:181629214-181629236 GAATGCCTAACCAAAAAAAAAGG + Intronic
943717341 2:191166789-191166811 TGATGCCTGTGCAAAACCCAAGG + Intergenic
943764990 2:191651088-191651110 GATTGACTAAGCAATAACCAGGG + Intergenic
945097837 2:206236510-206236532 GGTTGCTTAAGCAATACCCAAGG - Intergenic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
946767846 2:223056660-223056682 GAATTTCTAAGCAGAACCTAAGG + Intronic
946818913 2:223610292-223610314 AAATGCCTAAGTACAAGCCAAGG + Intergenic
947345228 2:229183539-229183561 GAAGGCCTAAATAAAACCAATGG + Intronic
948092693 2:235308103-235308125 GAATGCTTAAATAACACCCAAGG + Intergenic
1169145002 20:3246691-3246713 TAGTGCCTCAGCACAACCCAGGG - Intergenic
1169316411 20:4594145-4594167 GTAGGCCTCAGGAAAACCCAGGG - Intergenic
1171136331 20:22698025-22698047 GGATGCCTAAGCACATCTCAAGG + Intergenic
1171727823 20:28641809-28641831 GAATGCCTGTGAAAATCCCAGGG - Intergenic
1172674856 20:36661599-36661621 GAAAGCATAAGCAAAGCCCCAGG + Intronic
1177197158 21:17915277-17915299 GAATTCCTCAGCAAAGCCTAAGG + Intronic
1177647828 21:23922219-23922241 GAGTGCCTAAGGGAAACCTATGG - Intergenic
1178531602 21:33380908-33380930 TAAAGCATAAACAAAACCCATGG + Intergenic
1181317191 22:21978436-21978458 TCATGCCTAAGCCAAAGCCATGG - Intronic
950309458 3:11944069-11944091 AAATGCCTTAGCAACACTCAGGG + Intergenic
951300577 3:20991036-20991058 AAAAGCCTAAGCAAAACTCTTGG + Intergenic
953437616 3:42891233-42891255 AAAGGCCTAGGCAAAACCCTTGG + Intronic
954564775 3:51590315-51590337 GTGTTCCTAAGCAAAACCCTTGG + Intronic
957733215 3:84170316-84170338 GATTGCCTAAGCAAAACGCATGG + Intergenic
958020586 3:87990218-87990240 AAAAGCCTAAGCAAAACTCTTGG + Intergenic
959736144 3:109661096-109661118 GAATCCCTACCCAAAGCCCAGGG - Intergenic
959863936 3:111244656-111244678 GAATCCCTCAGCAAAACACTGGG - Intronic
961395060 3:126580719-126580741 GAATGCCTAAGCAGTCCCCAGGG + Intronic
963793339 3:149606335-149606357 GACTGCCTTAGAGAAACCCAGGG - Intronic
963794024 3:149613368-149613390 GAATGCAGAGGCAAGACCCAGGG + Intronic
965240967 3:166196819-166196841 CAATGCCTAATCAGAAGCCAGGG - Intergenic
965591166 3:170361130-170361152 GAATGCCTAGGCAAATGTCAGGG + Exonic
968421543 4:489151-489173 GAGTGCCCAAGGGAAACCCACGG - Intronic
969316256 4:6383061-6383083 GCAGGCCAAAGCAAAACACAGGG - Intronic
970447393 4:16135587-16135609 GAATGCCCAAGCAGGTCCCAGGG - Intergenic
972266131 4:37461767-37461789 CAAAGCCTAAGCAACAACCAGGG - Intronic
972999962 4:44934894-44934916 GAATGCATAATCAGAAACCATGG + Intergenic
974207922 4:58730742-58730764 GAAAGGATAATCAAAACCCATGG - Intergenic
974594741 4:64000684-64000706 GAATTCCTTAGCAAATCCAAAGG + Intergenic
974617211 4:64305707-64305729 GAGTGCCTAAGTGAAACCCATGG - Intronic
974627559 4:64444059-64444081 GAATTCCTTAGCAAATCCAAAGG + Intergenic
974644080 4:64670743-64670765 GCAGGCCCAAGCAAAACTCAGGG - Intergenic
975250491 4:72173083-72173105 GAATTCCTTAGCAAACCCAAAGG - Intergenic
978708235 4:111743174-111743196 GAATCCCTAAGCAAATGACATGG + Intergenic
979047437 4:115886014-115886036 GAGTGCTTAAGCAAAACCCGTGG + Intergenic
980348579 4:131658560-131658582 AAGTGCCTAAGCAAAATTCATGG + Intergenic
980729292 4:136805953-136805975 GAGTGGCTAAGCAAAACCCATGG - Intergenic
982889599 4:160831171-160831193 GAGTGCCTAAGCAAAACCCATGG + Intergenic
983374366 4:166905632-166905654 GAAGTCCTAACCAAAACCTAAGG + Intronic
983847473 4:172537904-172537926 GAATGCCTCAGCGAAACACTTGG + Intronic
984065128 4:175038160-175038182 GAATACCTAAGCAAAACCGAGGG - Intergenic
984078452 4:175213563-175213585 GAGTGCCTAAGTGAAACCTATGG - Intergenic
984259355 4:177426277-177426299 GAATGACTTAACAAAAGCCAAGG - Intergenic
984579213 4:181491089-181491111 GAATGCCTAAAAAAAATCTATGG + Intergenic
985204326 4:187518182-187518204 GATTTCCTAACCAAAACACAAGG + Intergenic
987620810 5:20336901-20336923 GAGTGCCTGAGCAAAACCCATGG - Intronic
987622115 5:20347717-20347739 GAATGCTTAACCAAAATCCATGG - Intronic
988222505 5:28367207-28367229 GAATTACTAAGCAAAATCGAAGG - Intergenic
988651752 5:33159734-33159756 AAGTGCCTAAGCAAATACCAGGG + Intergenic
994186061 5:96816614-96816636 GAATGCCTAAGTGAAACCCATGG - Intronic
996999841 5:129746467-129746489 GGATGCCTAAGGAAAACTGAAGG + Intergenic
997366677 5:133329924-133329946 GAATGCCTTTGCCAAACCCGGGG - Intronic
999311086 5:150552666-150552688 GAATTAATAATCAAAACCCAAGG - Intronic
999679769 5:154045980-154046002 CAATGCCTCAGAAACACCCAGGG + Intronic
1003098408 6:3159100-3159122 AAATGCCTTGGTAAAACCCAAGG + Intergenic
1004455939 6:15791519-15791541 AAATGCCTACGCAAAACTCTTGG + Intergenic
1005741069 6:28790973-28790995 GAATGGGTTAGCAAAAGCCAGGG + Intergenic
1008523972 6:52389047-52389069 GAATGCCTAAGCAAAGACTTAGG - Intronic
1008629509 6:53349504-53349526 GAATCCCTAAGAAAAATACACGG - Intergenic
1009540791 6:64955660-64955682 GAATGCCTAAGCAAAACCCATGG - Intronic
1012440730 6:99260073-99260095 CAATGTCTAAGCAAAACCCTTGG - Intergenic
1013558259 6:111279178-111279200 GTAAGCCTAAGAAAAAACCACGG - Intergenic
1016046723 6:139488254-139488276 GAATGCCTAGGCAACACCAAGGG + Intergenic
1017203532 6:151780385-151780407 GACTGCCAAAGCAAAAGGCAGGG - Intronic
1020548370 7:9565225-9565247 AAAATCCTAAGCAAATCCCACGG + Intergenic
1024765269 7:52650239-52650261 AAATTCCTAGACAAAACCCAAGG + Intergenic
1025797492 7:64753074-64753096 GAAGGCCTAGGCAAAACTCTTGG + Intergenic
1026143342 7:67724639-67724661 AAAGGCCTAAGCAAAACTCTTGG - Intergenic
1027956695 7:84887713-84887735 GAAAGCCTAAGAAAAACTCATGG - Intergenic
1031540021 7:122983942-122983964 GCATTCTTAAGCAAAGCCCAAGG - Intergenic
1034467021 7:151235801-151235823 GAACCCCTAAGCAAGACCAAAGG + Intronic
1037011164 8:13844423-13844445 GAATTCCTCAGGAAAACCGAGGG - Intergenic
1037483322 8:19325219-19325241 GACTGATGAAGCAAAACCCAAGG - Intronic
1042381071 8:68114850-68114872 GAATGCCTGGGCAAAACCCAAGG + Intronic
1047429409 8:124777900-124777922 AAATGACTAAGAAAAACCAATGG + Intergenic
1050968186 9:11835183-11835205 TAGTGCCTAAGCGAAATCCATGG - Intergenic
1051937559 9:22461524-22461546 GAATCCCTAAGCAAATCTTACGG - Intergenic
1053490523 9:38497614-38497636 GACTGCCTAAACAAAACTCAAGG - Intergenic
1053784193 9:41641523-41641545 AAGTGCCTAAGCAAAATTCATGG - Intergenic
1054172148 9:61851651-61851673 AAGTGCCTAAGCAAAATTCATGG - Intergenic
1054447009 9:65380673-65380695 AAGTGCCTAAGCAAAATTCATGG - Intergenic
1054665389 9:67729156-67729178 AAGTGCCTAAGCAAAATTCATGG + Intergenic
1055545114 9:77363225-77363247 GGATGTCTAGGAAAAACCCAGGG - Intronic
1057670839 9:97086869-97086891 GACTGCCTGAACAAAACTCAAGG - Intergenic
1058747823 9:108008939-108008961 GAAGGCCTAAGCAAATGCCCTGG + Intergenic
1058984783 9:110200565-110200587 GAATGCCTTAGCAATGCCCAGGG - Exonic
1059106107 9:111513012-111513034 GCAAGCCTAAGTAAAACCTAAGG - Intergenic
1059290597 9:113220946-113220968 GAATGCAAAAGGCAAACCCAGGG + Intronic
1060010653 9:120040474-120040496 GAATGCCTAAGACACACCTATGG + Intergenic
1060719435 9:125965470-125965492 CAATGCCTCAGCGAAACCCAGGG - Intronic
1060905923 9:127305500-127305522 GAATACTTAACCAAAACACAGGG - Intronic
1203421737 Un_KI270521v1:7050-7072 GAATGCCTGTGAAAATCCCAGGG + Intergenic
1188167569 X:26880548-26880570 GAAGGCCTAGGCAAAACTCTTGG + Intergenic
1188909594 X:35830201-35830223 GAATGCCAAAGAATAACTCAGGG - Intergenic
1189307460 X:39997575-39997597 GAGTGCATGAGCAAAAACCAAGG - Intergenic
1189520849 X:41766189-41766211 GAATGCACAATCAAAACCCTGGG - Intronic
1191750998 X:64542526-64542548 AAATGACAAAGGAAAACCCACGG + Intergenic
1191807945 X:65155494-65155516 AAATGACAAAGGAAAACCCACGG - Intergenic
1196929629 X:120668576-120668598 GAAGGCCTCAGCCAACCCCATGG - Intergenic
1200757508 Y:7003676-7003698 GAGTGCCTATGAAAAACACAAGG - Intronic
1202018955 Y:20444363-20444385 GAGTGTCTAAGCAAAACCCATGG + Intergenic