ID: 1009543087

View in Genome Browser
Species Human (GRCh38)
Location 6:64990089-64990111
Sequence CTACCTACAGACAAATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009543082_1009543087 19 Left 1009543082 6:64990047-64990069 CCCAAATCCTAAATTTCCTATTT 0: 1
1: 0
2: 6
3: 57
4: 912
Right 1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 113
1009543085_1009543087 3 Left 1009543085 6:64990063-64990085 CCTATTTATTTTTTACTTTTAAT 0: 1
1: 7
2: 48
3: 603
4: 4538
Right 1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 113
1009543084_1009543087 12 Left 1009543084 6:64990054-64990076 CCTAAATTTCCTATTTATTTTTT 0: 1
1: 1
2: 30
3: 418
4: 3864
Right 1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 113
1009543083_1009543087 18 Left 1009543083 6:64990048-64990070 CCAAATCCTAAATTTCCTATTTA 0: 1
1: 0
2: 2
3: 29
4: 427
Right 1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009543087 Original CRISPR CTACCTACAGACAAATGAGG TGG Intronic
901073598 1:6537361-6537383 TTAACAACAGACAAATGAGATGG + Intronic
902388262 1:16088384-16088406 TTCCCTACAGAGAAGTGAGGAGG - Intergenic
902567644 1:17323083-17323105 CTACCAACAGCCATATGAGTGGG - Intronic
904716387 1:32470933-32470955 CTACCTGCAGATGAATGACGTGG + Exonic
904997005 1:34639151-34639173 CCATCTACAGACAAAAGAGAGGG + Intergenic
918611514 1:186497669-186497691 CTAGGTACAGATAAAAGAGGAGG + Intergenic
923500114 1:234557527-234557549 CTACCTCCAGAGAGAGGAGGGGG - Intergenic
1065285307 10:24181904-24181926 GTACCTACAGACCATTCAGGTGG + Intronic
1066253360 10:33655248-33655270 CTATCTACAAACAAATGTGCCGG - Intergenic
1068200611 10:53779644-53779666 CTACATACAGACAATTGCAGAGG + Intergenic
1072542491 10:96409014-96409036 CTAACTAGAGACAAATGACTAGG - Intronic
1076036742 10:127204913-127204935 CCACCCACAGTCAAATGGGGAGG - Intronic
1076265912 10:129109787-129109809 CTGCCTACACACAGATGAGGTGG - Intergenic
1077631301 11:3812809-3812831 CTACCCACTGACAAATCAGGAGG - Intronic
1080868314 11:36214450-36214472 CTTCCTTCTCACAAATGAGGTGG - Intronic
1081278762 11:41183359-41183381 CTTCCTACATACAATGGAGGTGG + Intronic
1088999337 11:115037944-115037966 ATAACTACAGAGAAATGAGATGG - Intergenic
1089615315 11:119691752-119691774 CTCCCTCCAACCAAATGAGGTGG - Intronic
1091760441 12:3083986-3084008 CTTCCTCCACACAAATGGGGTGG - Intronic
1092668830 12:10839245-10839267 CTGCCTAGAGAATAATGAGGTGG + Intronic
1092935500 12:13358992-13359014 ATAACTACAGAAAAATGAAGGGG - Intergenic
1093935440 12:24995513-24995535 CTAACCAAATACAAATGAGGTGG - Intronic
1097411608 12:59261058-59261080 CAACCTAGAAACAAATGATGGGG + Intergenic
1098837887 12:75443282-75443304 GAACCTACAGACTAAAGAGGTGG - Intergenic
1099223127 12:79937206-79937228 CTCCCTAAAGACAAAGTAGGTGG - Intergenic
1099333042 12:81315772-81315794 CTACTTAAAGACAGATGATGGGG + Intronic
1102235750 12:111293537-111293559 CTTGCTGCAGAGAAATGAGGCGG + Exonic
1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG + Intergenic
1108718539 13:53106182-53106204 CTATATAGAGACATATGAGGAGG - Intergenic
1109219186 13:59624295-59624317 AAACCTAGAGAGAAATGAGGGGG - Intergenic
1111619675 13:90707498-90707520 CAACCTTCAGACAAATGAAAAGG - Intergenic
1111847538 13:93530356-93530378 TTACCTGGAGAGAAATGAGGAGG - Intronic
1112713980 13:102162907-102162929 TAACCTACATACAAATGAGGGGG - Intronic
1113547220 13:111162946-111162968 CTAGATTCAGACAGATGAGGAGG + Intronic
1116751456 14:48890675-48890697 CTTCCTCCAGAGAAAAGAGGAGG - Intergenic
1118059836 14:62123520-62123542 CTACCCACAGACAGAAGGGGTGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123841387 15:24251184-24251206 CTACATACAGATAAGTGAGATGG - Intergenic
1124239123 15:28015457-28015479 CTACCTACAGTCACATTTGGAGG - Intronic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124800672 15:32829881-32829903 ATACCCACACAGAAATGAGGGGG + Intronic
1127042307 15:54990729-54990751 CTACCTCCAGCCAAGGGAGGTGG + Intergenic
1133586003 16:7196120-7196142 CTTCCTTTAGAAAAATGAGGAGG - Intronic
1142914800 17:3127543-3127565 CTTCCTACAGACAAATGGAGGGG - Exonic
1144368884 17:14571026-14571048 CAACCTACAATCAAATGTGGGGG - Intergenic
1147514660 17:41104500-41104522 GTACCTGCAGGAAAATGAGGAGG + Intronic
1148228033 17:45912928-45912950 CTACCTCTAGACAAAAGAGAGGG + Intronic
1149784042 17:59420829-59420851 CTACCTACAGGCAGATGTTGAGG - Intergenic
1154964007 18:21338604-21338626 CAATCAACAGACAAGTGAGGTGG - Intronic
1156097305 18:33551124-33551146 CTCCTTACTGCCAAATGAGGTGG + Intergenic
1160079189 18:75706720-75706742 ATACCCACAGACAAATGTGTAGG + Intergenic
1162885022 19:13690552-13690574 CCACCTAGAGACAAAGGAGAAGG + Intergenic
1164317293 19:24102849-24102871 CTAAATACAGACAGATGAGAAGG - Intronic
927519832 2:23692086-23692108 CCACCTACAGAGAAATGACACGG - Intronic
931638915 2:64364266-64364288 CTTCCTGCAAACAACTGAGGAGG - Intergenic
933036038 2:77399678-77399700 CTATCTTCATACAAATCAGGAGG + Intronic
936958827 2:118051587-118051609 CTACCTGCAGCCACACGAGGAGG + Intergenic
936982562 2:118277725-118277747 CAGCCTACAGTCAAACGAGGAGG - Intergenic
941911097 2:170765375-170765397 CTTCCTCCAGACATATAAGGAGG - Intergenic
942248947 2:174031667-174031689 CTGCCTGCAGAAAAGTGAGGAGG - Intergenic
942372513 2:175300460-175300482 CTACCTACAGAGAAGTGGGAGGG - Intergenic
943169654 2:184381794-184381816 CTACCTTCAGACACAGGAGGTGG + Intergenic
1173055448 20:39607884-39607906 ATACCTACACACAGATGAGGAGG + Intergenic
1173929300 20:46805451-46805473 CCATCTACAGACCAAGGAGGGGG - Intergenic
1175642829 20:60645372-60645394 CTACCTACAGGCAAAAAAGGAGG + Intergenic
1178786728 21:35660402-35660424 CTACATACACACAAATTAGCGGG + Intronic
1179527623 21:41993245-41993267 CTACAAACAGACAAAACAGGTGG + Exonic
1182383341 22:29912641-29912663 TTACCTCCAGGCAAATGGGGTGG - Intronic
1183318252 22:37148685-37148707 CTCCCTACAGCCCCATGAGGAGG + Intronic
951243892 3:20317747-20317769 CAACCTACGGGGAAATGAGGGGG - Intergenic
951306168 3:21065653-21065675 CATCCTAGAGACAAATGAGTAGG + Intergenic
952767664 3:36968970-36968992 CAACCTACAGACAAAGGATGGGG + Intergenic
955822145 3:62907587-62907609 CTACCTACAGGCCAAGGAGCTGG - Intergenic
956386585 3:68725618-68725640 CCACCCCCAGCCAAATGAGGTGG - Intergenic
960190846 3:114703848-114703870 CTACATATAGACAAATGAGTTGG - Intronic
962068782 3:132011509-132011531 GTACCTGCAAAGAAATGAGGAGG + Intronic
966289541 3:178339784-178339806 CTACCAACAGTAAAATGAGAGGG + Intergenic
968958251 4:3730060-3730082 CTATCCAGAGACAAATGGGGAGG + Intergenic
973090635 4:46132015-46132037 CTACAGTGAGACAAATGAGGGGG - Intergenic
973685887 4:53369530-53369552 CTAGCTATGGACAAATGATGAGG + Intergenic
974184595 4:58430194-58430216 CTACCTTAAGACTAATGAAGGGG - Intergenic
977881931 4:102214896-102214918 CTGCCTAAAGACAAATGAAAAGG - Intergenic
978896234 4:113890902-113890924 CCACCTACAGCCAAAGGATGAGG + Intergenic
981222298 4:142251613-142251635 CAGCCTACAGCCAAATGAGATGG - Intronic
983633578 4:169875378-169875400 CTGACTACAGACACATGAGCAGG + Intergenic
986365971 5:7032034-7032056 ATACCTACATACAAAAAAGGTGG - Intergenic
987632708 5:20495594-20495616 CTACCTACAGAAACAGGAAGCGG + Intronic
987730118 5:21759348-21759370 CTACTTAAAGACTAATGAAGAGG - Intronic
992877934 5:81076263-81076285 GTACCTAGAGGCAAATGAAGAGG + Intronic
994901327 5:105774097-105774119 CTACCTACATTCAAAGGAGATGG - Intergenic
997908531 5:137844793-137844815 CTTCCTAAAGACAAATGAAGGGG + Intergenic
998129058 5:139642216-139642238 CTCCAGACAGACTAATGAGGAGG - Intergenic
1001870862 5:175154649-175154671 CAAAATGCAGACAAATGAGGTGG + Intergenic
1004203220 6:13569479-13569501 ACACCTCAAGACAAATGAGGAGG + Intergenic
1009038635 6:58149819-58149841 TTACCTATAGACAATTGAAGTGG + Intergenic
1009214523 6:60904682-60904704 TTACCTATAGACAATTGATGTGG + Intergenic
1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG + Intronic
1013499290 6:110731860-110731882 CTTCATAAAGACAAATGAGAAGG + Intronic
1014384725 6:120786231-120786253 CTACCTACAGACCATTCAGCAGG + Intergenic
1016280294 6:142409636-142409658 TAACCTACAGATAAATGAGTAGG + Intronic
1023651644 7:42376342-42376364 CCACCTACACACAAAAGAAGGGG + Intergenic
1028222167 7:88210499-88210521 GTGCCCCCAGACAAATGAGGTGG + Intronic
1028272093 7:88804204-88804226 CTTCTTACTGACAAATGTGGAGG - Intronic
1032265766 7:130368851-130368873 CTACCTTCAGGAAAATAAGGGGG + Intergenic
1032941747 7:136801040-136801062 CAACCTACAGAAACATGATGTGG - Intergenic
1033571376 7:142632156-142632178 CTACACACAGACAAATAAGAAGG + Intergenic
1039550554 8:38440141-38440163 CTCCCCAGAGATAAATGAGGGGG + Intronic
1041158984 8:55018165-55018187 CTCCCTCCAGACAAATGACAAGG + Intergenic
1043170028 8:76954242-76954264 CTGCTCATAGACAAATGAGGAGG + Intergenic
1046587937 8:116170454-116170476 CTAAATACTGACAAATTAGGAGG + Intergenic
1051367449 9:16331226-16331248 CTAACTCCAGCCAGATGAGGGGG + Intergenic
1052092698 9:24348572-24348594 CTACCAAAAGAATAATGAGGAGG - Intergenic
1052883759 9:33623605-33623627 CGACAGACAGACAAATAAGGAGG + Intergenic
1053307754 9:36995955-36995977 CTTCCTAAAGGCAAAGGAGGAGG + Intronic
1054901710 9:70375854-70375876 CTACCTACAGGTAAATGAGAAGG + Intergenic
1055818771 9:80237915-80237937 ATACCTCCAGACAAGGGAGGCGG + Intergenic
1059700302 9:116769461-116769483 GTAGCTAAAGGCAAATGAGGAGG + Intronic
1060255420 9:122025242-122025264 CTTCCTAAAGACTAATGATGTGG - Intronic
1188545103 X:31296592-31296614 CTACCTAAAGGCAGATGAGTGGG + Intronic
1190438095 X:50447947-50447969 CAACCTCCAGATAAATGTGGTGG + Intronic
1195425391 X:104723637-104723659 CTACCCACAGAGAAATGACAAGG + Intronic
1199308303 X:146293027-146293049 CCACCTCCAGCCAAAAGAGGTGG - Intergenic
1200981501 Y:9266952-9266974 ATACCTACAGCCAAATGGAGTGG - Intergenic