ID: 1009547102

View in Genome Browser
Species Human (GRCh38)
Location 6:65033915-65033937
Sequence CCAATCTGTGAGAGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 10, 3: 62, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009547100_1009547102 3 Left 1009547100 6:65033889-65033911 CCTGGAAAAGCTGCAAGAATTCA 0: 1
1: 1
2: 53
3: 365
4: 1361
Right 1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG 0: 1
1: 0
2: 10
3: 62
4: 317
1009547099_1009547102 9 Left 1009547099 6:65033883-65033905 CCTGTGCCTGGAAAAGCTGCAAG 0: 1
1: 10
2: 33
3: 93
4: 391
Right 1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG 0: 1
1: 0
2: 10
3: 62
4: 317
1009547098_1009547102 10 Left 1009547098 6:65033882-65033904 CCCTGTGCCTGGAAAAGCTGCAA 0: 5
1: 170
2: 282
3: 723
4: 1149
Right 1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG 0: 1
1: 0
2: 10
3: 62
4: 317
1009547096_1009547102 26 Left 1009547096 6:65033866-65033888 CCACTGACAGCTTGCACCCTGTG 0: 5
1: 190
2: 500
3: 965
4: 1611
Right 1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG 0: 1
1: 0
2: 10
3: 62
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009547102 Original CRISPR CCAATCTGTGAGAGCAGCCC TGG Intronic
902243776 1:15105770-15105792 CCAATAGGGAAGAGCAGCCCAGG - Intronic
902795514 1:18798424-18798446 CTAGTGTGTGTGAGCAGCCCTGG - Intergenic
902816255 1:18918305-18918327 CCACTCTCCCAGAGCAGCCCTGG - Intronic
903787826 1:25873237-25873259 CCAACCTGGGAGCCCAGCCCTGG + Intergenic
905496215 1:38389994-38390016 CCAACCTGTGAGAGCATCCCTGG - Intergenic
905537627 1:38735606-38735628 ACAAGCTGGGAGAGCATCCCTGG + Intergenic
907934898 1:59033248-59033270 CCAGTGTGTGAGAGCTGGCCTGG + Intergenic
909459527 1:75894066-75894088 TAAATTTGTGAGAGGAGCCCTGG + Intronic
909700299 1:78514232-78514254 CCAACCTGTGTGAGCAGCCACGG + Intronic
909728933 1:78870911-78870933 CCAACCTATGAAAGCAGCCATGG - Intergenic
909958626 1:81807499-81807521 CCAATCTTTGAGAGCATCTTAGG - Intronic
910374209 1:86551610-86551632 CCAATCTAACAGAGCAGCACAGG + Intronic
911149368 1:94582577-94582599 GCAATCTGTGATGGCAGCTCAGG - Intergenic
911644127 1:100320566-100320588 TCAACCTGTGAGATCAGCCATGG + Intergenic
912854927 1:113159169-113159191 CCAATATGTGATGGCTGCCCTGG + Intergenic
915036797 1:152934584-152934606 ACAATTTGTGAGTGCACCCCTGG + Intergenic
916288066 1:163132606-163132628 CCAACCTGAGAGAGCAGCCATGG + Intronic
916455519 1:164967605-164967627 CCAATCTATGATGGCAGCTCAGG + Intergenic
917276293 1:173335337-173335359 TAAATTTGTGAGAGGAGCCCTGG + Intergenic
919364318 1:196637931-196637953 GTAATTTGTGATAGCAGCCCTGG + Intergenic
919420856 1:197368679-197368701 CCAACCTGAGACAGCAGCCAAGG - Intronic
919473748 1:198010033-198010055 GCAGCCTGTGAAAGCAGCCCAGG - Intergenic
920012569 1:202879936-202879958 TCAAACTGTTAGAGCAGCCCCGG + Exonic
920268417 1:204744301-204744323 CCCATCTGGCACAGCAGCCCTGG - Intergenic
920287330 1:204890053-204890075 CCTATCTCTGAGAGCTGCTCTGG + Intronic
920672645 1:208016145-208016167 CCAGCCTGTGACAGCAGCACTGG - Intergenic
921282983 1:213585579-213585601 TGAATGTGTGAGAACAGCCCAGG + Intergenic
921841744 1:219836047-219836069 TCAAACTGTGAGAGCTGCTCAGG + Intronic
921948232 1:220903635-220903657 TCAATTTGTGACAGCAGCCTAGG - Intergenic
922097931 1:222458433-222458455 CCACCCTGTGAGAGCAACCATGG + Intergenic
924330602 1:242937020-242937042 CCACACTCTGAGATCAGCCCGGG + Intergenic
924759187 1:246968429-246968451 CCAGCCTGTGAGAGCGGCCATGG - Intronic
1062881284 10:980218-980240 CCAACTGGTGAGAGCAGCCCAGG - Intergenic
1064965386 10:21010944-21010966 CCAATATCTGAGACCAGTCCAGG + Intronic
1066150040 10:32606494-32606516 CCAACCTGTAAGAGCAGCTTTGG + Intronic
1067193154 10:44089583-44089605 CCAAGCAGAGAGAACAGCCCGGG + Intergenic
1069104038 10:64360690-64360712 CCAATATGTGATGACAGCCCCGG + Intergenic
1069656410 10:70092492-70092514 GCATTTTGTTAGAGCAGCCCAGG + Intronic
1069794870 10:71045633-71045655 CAACGCTGTGAGAGCAGGCCAGG - Intergenic
1070418068 10:76208690-76208712 GTAATCTGTTAGAGCAGCCATGG + Intronic
1070687991 10:78504067-78504089 CCAATCTGTGACATCTGCCGTGG - Intergenic
1071666983 10:87568135-87568157 CCAACCAATGAGAGCAGCCCTGG + Intergenic
1072295967 10:94009834-94009856 CCAACCTGCGAGAGCAGCCATGG - Intronic
1072918241 10:99553627-99553649 GCACTCTGTTACAGCAGCCCTGG - Intergenic
1073979919 10:109142834-109142856 TCAACCTGTGAGAGCAGCCTTGG + Intergenic
1074208806 10:111308933-111308955 CCACTGTGTGACAGGAGCCCAGG - Intergenic
1076720654 10:132391197-132391219 CCAGTCTGTGTGAGCTGCCCAGG + Intergenic
1076763772 10:132619432-132619454 CCAACCCATGAGAGCAGTCCTGG - Intronic
1077892725 11:6431207-6431229 CCCCTCAGTGAGTGCAGCCCAGG + Exonic
1079465215 11:20723583-20723605 CCAACCTATGAAAGCAGCTCTGG - Intronic
1079903952 11:26222367-26222389 CCAATCTGTGAGAGTATCCATGG - Intergenic
1081181720 11:39992386-39992408 ACAACCTGTGAGAGCAGCCTTGG + Intergenic
1081579095 11:44339793-44339815 CCAAGCTCACAGAGCAGCCCAGG - Intergenic
1082932324 11:58621471-58621493 CCATGCTGTGATAGCTGCCCAGG + Intronic
1083277277 11:61603895-61603917 ACAATCTGTCCCAGCAGCCCAGG + Intergenic
1083550112 11:63581752-63581774 CCAATATGTGATGGCACCCCTGG + Intronic
1083634849 11:64115056-64115078 CCAGCCTGGGAGGGCAGCCCTGG - Intronic
1084055144 11:66627099-66627121 CCAAGCTGTGCCAGCAGTCCAGG + Exonic
1084308912 11:68304615-68304637 CCAATCTGTAAGAGCAGCCATGG + Intergenic
1084666815 11:70580808-70580830 CCAGACTTTGAGAGCAGCACAGG - Intronic
1084769262 11:71332039-71332061 CAAGTCTATGAGTGCAGCCCTGG - Intergenic
1085085779 11:73665800-73665822 GCAAACTGTCTGAGCAGCCCAGG + Intergenic
1085830497 11:79895646-79895668 CCAACCTGTGAGAGCTGCATGGG - Intergenic
1088440707 11:109867233-109867255 GAAGGCTGTGAGAGCAGCCCAGG + Intergenic
1089820965 11:121225906-121225928 CCAACCTGTGAAAGCAGCTCAGG - Intergenic
1090556832 11:127885308-127885330 CCAGCCTGTGAAAGCAGCCAGGG - Intergenic
1090599806 11:128358522-128358544 CAAGTATCTGAGAGCAGCCCAGG + Intergenic
1091316539 11:134617882-134617904 CCAACCAATGAGAGCAGCCATGG + Intergenic
1091921604 12:4309139-4309161 CCAAAGTTTGAGAGCAGCCAGGG - Intergenic
1092697652 12:11191218-11191240 CCAACCTGTGAGAGCTGCTCAGG - Intergenic
1093018948 12:14185478-14185500 CCCATATCTGGGAGCAGCCCTGG - Intergenic
1094777392 12:33746152-33746174 CCAATGAGTGAAAGCAGCCAGGG + Intergenic
1095049219 12:37541954-37541976 CCTGGCTGAGAGAGCAGCCCAGG - Intergenic
1095836754 12:46647889-46647911 CCAGCCTGTGAAAGCAGCCAGGG - Intergenic
1096675265 12:53222642-53222664 CCCATCTGTGTGTGCATCCCAGG + Intronic
1098253449 12:68592255-68592277 CCAACCTATGAGAGCAGCTGCGG - Intergenic
1098939486 12:76518389-76518411 CCAACCTGTGAGAGCAGCCATGG - Intronic
1099136587 12:78911507-78911529 CAAATATGTGAGAGAAGACCTGG + Intronic
1099365306 12:81759633-81759655 CCATTGTGTGAAAGAAGCCCAGG - Intergenic
1099948395 12:89271919-89271941 CTATTTTGTGATAGCAGCCCTGG + Intergenic
1100170562 12:91970498-91970520 CCAGCCTATGAGAGCAGCCATGG - Intergenic
1103327231 12:120129743-120129765 CCAAGCTGTGGGACCAGCCAGGG - Intronic
1103861810 12:124021287-124021309 ACATTCTGTGAGAGCAGACTTGG + Intronic
1103962285 12:124616676-124616698 CCAAAATCTGACAGCAGCCCTGG - Intergenic
1104485917 12:129151022-129151044 CACATCCATGAGAGCAGCCCTGG - Intronic
1104666814 12:130653455-130653477 CTAACCTGTGAGAGCAGCCGTGG - Intronic
1104917513 12:132273518-132273540 CAGCTCTGTGTGAGCAGCCCTGG + Intronic
1105212271 13:18264038-18264060 CTAATCTTTGATAGCAGACCAGG + Intergenic
1105264659 13:18805195-18805217 CCAGTCCATGAGAGCAGCCATGG + Intergenic
1107119491 13:36781231-36781253 CCAACCTGTGAGAGTAGCCACGG - Intergenic
1107404299 13:40098428-40098450 CCAGTCTGTGGGGGCAGCCAAGG - Intergenic
1107812643 13:44215214-44215236 GTAATTTGTTAGAGCAGCCCTGG - Intergenic
1108896442 13:55334696-55334718 ACAACCTGTGAGATCAGCCTAGG + Intergenic
1110410671 13:75201036-75201058 CCACTCCATGACAGCAGCCCAGG + Intergenic
1111207848 13:85035581-85035603 CCAGCCTATGAGAGCAGCCATGG + Intergenic
1111318105 13:86586878-86586900 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
1111457998 13:88508666-88508688 CCAAACTGTAAGAGCAGCCATGG - Intergenic
1111519481 13:89381634-89381656 CCTCTGTGTGAGAGCAGCCCTGG - Intergenic
1111997088 13:95175864-95175886 GCATTTTGTGAGGGCAGCCCTGG + Intronic
1113530629 13:111022707-111022729 CCAATGTTTGATAGCAGCACAGG + Intergenic
1114140293 14:19901650-19901672 CCAACTTGTGAGAGCAGCCATGG + Intergenic
1114634199 14:24178216-24178238 GGAATGTGTGAGTGCAGCCCAGG + Exonic
1115140768 14:30168629-30168651 CCAACCCATAAGAGCAGCCCTGG - Intronic
1115889694 14:38012705-38012727 ACATCCTGTGAGAGCAGCCTTGG + Intronic
1116383118 14:44296834-44296856 TCAACCTGTGAGAGCAGCCGTGG - Intergenic
1117881886 14:60320416-60320438 CCAGCCTGTGAGAGCAGCCATGG + Intergenic
1118200133 14:63663765-63663787 CCACTCTGCAAGAGCAGCCTGGG - Intergenic
1118755326 14:68838866-68838888 TCAATCTGTGAGAGCAGACACGG + Intergenic
1119645536 14:76345891-76345913 GCAATTTGTGACAGCAGCCCTGG - Intronic
1120031765 14:79649831-79649853 CCATTCTGTTATAGCAGCCAAGG - Intronic
1120268229 14:82277692-82277714 CCAGCCTGTGAGAGCAGCCATGG + Intergenic
1122442370 14:101740884-101740906 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
1123165704 14:106323335-106323357 GCAGTCTCTGAGATCAGCCCTGG - Intergenic
1124623334 15:31292743-31292765 CCAATCTGTGGGAGGATCCAGGG + Intergenic
1129190013 15:73931665-73931687 TCAGTCCCTGAGAGCAGCCCTGG + Intronic
1130913173 15:88284730-88284752 CCAGCCTGTCAGAGCCGCCCCGG + Intergenic
1131246000 15:90793480-90793502 CCAATGTGTGAGAACAGCAGTGG - Intronic
1132905301 16:2279358-2279380 CCAGGCTCTGAGAGCAGCTCTGG - Intronic
1133857024 16:9559256-9559278 CAAATAGGTGTGAGCAGCCCAGG + Intergenic
1133980799 16:10631922-10631944 GTAATTTGTGATAGCAGCCCTGG + Intronic
1134346183 16:13393884-13393906 CCAACTTGTCAGAGCATCCCAGG - Intergenic
1137035278 16:35564736-35564758 CCTATCTGTGGGATTAGCCCAGG + Intergenic
1140235876 16:73158159-73158181 CCAGGCTGGGACAGCAGCCCCGG + Intergenic
1141761202 16:86029742-86029764 CTGATCCCTGAGAGCAGCCCTGG - Intergenic
1142226942 16:88882107-88882129 CCCAGCTGTCAGCGCAGCCCAGG - Intronic
1142633257 17:1239984-1240006 CCAGACTTTGAGACCAGCCCCGG - Intergenic
1143200320 17:5108980-5109002 GGAATCTCTGGGAGCAGCCCAGG - Exonic
1146937129 17:36818902-36818924 CCACCCTGTGAGCTCAGCCCTGG + Intergenic
1147364393 17:39950975-39950997 TCAATCTGTGAGCAAAGCCCAGG + Intergenic
1147923188 17:43931244-43931266 CCTGTCTGGGAGAGGAGCCCAGG + Intergenic
1148340244 17:46869101-46869123 GCCTTCTTTGAGAGCAGCCCTGG + Intronic
1148340466 17:46870492-46870514 CCTGTCTGGGAGAGGAGCCCAGG + Intronic
1148480924 17:47958943-47958965 GCCATCTGCAAGAGCAGCCCTGG - Intergenic
1149025134 17:52018327-52018349 CCAACCTGTGAGAGCAGCCGTGG + Intronic
1151878428 17:76880464-76880486 CAGAGGTGTGAGAGCAGCCCCGG + Intronic
1151902082 17:77022954-77022976 ACAACCTGTGAGAGCAGCCATGG + Intergenic
1152568543 17:81111192-81111214 CCCAGCAGTGAGAGGAGCCCCGG - Intronic
1154423736 18:14256365-14256387 CCAGTCCATGAGAGCAGCCATGG - Intergenic
1155773383 18:29727463-29727485 ACAATCTGTGAGAGCAGCTTCGG + Intergenic
1156527304 18:37778830-37778852 CCATTCTCTGAGAGGAGACCCGG - Intergenic
1157591327 18:48837847-48837869 CCAACCTGTCCCAGCAGCCCTGG + Intronic
1157793764 18:50557306-50557328 CCACTCTATGAGAACAGCCCAGG + Intergenic
1159127717 18:64244612-64244634 CCAATCTGTCAGAGCAATCATGG - Intergenic
1164099970 19:22045910-22045932 CCAATCTGTGGGCTGAGCCCAGG + Intergenic
1164180781 19:22816629-22816651 CCAATCTGTGGGCTGAGCCCAGG - Intergenic
1164237409 19:23349301-23349323 CCAATATGTGATGGCATCCCTGG + Intronic
1165083562 19:33326516-33326538 CAAATATGTAAGACCAGCCCGGG + Intergenic
1168327374 19:55545171-55545193 CCTGTCTGTGGGAGCAGGCCAGG + Intronic
925459522 2:4048382-4048404 CCCATCAGTGAGAGCAGCTCTGG + Intergenic
926598298 2:14814339-14814361 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
926926278 2:17991338-17991360 CCAGCCTGTGAAAGCAGCCAGGG + Intronic
927578341 2:24219410-24219432 CACTCCTGTGAGAGCAGCCCTGG + Intronic
928235729 2:29537760-29537782 CCAATCTGTGGGAGCAGCCATGG + Intronic
928620747 2:33085292-33085314 GCAATTTGTTAGAGCAGCCCTGG + Intronic
930024898 2:47024026-47024048 GCCATCTGGGAGGGCAGCCCTGG - Intronic
930720309 2:54631637-54631659 CCTTTCGGTGAAAGCAGCCCTGG + Intronic
932484277 2:72073176-72073198 CCAATATGTGAGGTCACCCCTGG - Intergenic
934015860 2:87881186-87881208 ACAACCTGTGAGAGCAGGCATGG - Intergenic
934301352 2:91778364-91778386 CTAATCTTTGATAGCAGACCAGG - Intergenic
934494341 2:94784349-94784371 CCAGTCCATGAGAGCAGCCATGG + Intergenic
935224031 2:101038002-101038024 CCACCCTGAGAAAGCAGCCCTGG + Intronic
935699800 2:105801645-105801667 CTACCCTGTGAGAGCAGCCTCGG + Intronic
937327937 2:121003257-121003279 TCAACCTGTGAGAGCAGCTATGG + Intergenic
937493084 2:122389810-122389832 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
937616034 2:123923192-123923214 CTAATCTGTGAGAGCAGCATGGG - Intergenic
937827963 2:126388512-126388534 CCAGCCTGTGAAAGCAGCCACGG + Intergenic
939243652 2:139594850-139594872 CCAGCCTGTGAGAGCAGCTGTGG + Intergenic
940149301 2:150581476-150581498 GCAATTTGTTACAGCAGCCCAGG + Intergenic
940824276 2:158393140-158393162 CAAATGTGTGAGAGCAAACCTGG + Intronic
940919032 2:159287116-159287138 CCAATCTGGGAGACCGGCCTCGG - Intergenic
940992675 2:160113941-160113963 CCTCTCTGTGGGAACAGCCCAGG + Intronic
942977242 2:182032681-182032703 ACAAGCTGTGTGAGCTGCCCTGG + Intronic
943889706 2:193271278-193271300 CCAACCTGTTAGAACAGCCATGG - Intergenic
946399092 2:219459484-219459506 ACAGACTGTCAGAGCAGCCCAGG - Intronic
947183303 2:227431937-227431959 CCAACCCATGAGAGCAGCCATGG - Intergenic
947328136 2:228999992-229000014 CCAGTTTGTGAAAGCAGCCCTGG + Intronic
948263438 2:236621143-236621165 GGGAGCTGTGAGAGCAGCCCAGG + Intergenic
948728268 2:239947652-239947674 CCGGTGTGTGAGAGGAGCCCCGG - Intronic
948864570 2:240768769-240768791 CCCAGCTCTGTGAGCAGCCCAGG + Intronic
1169351486 20:4871652-4871674 TCATTCTGTGGGAGCAGCCAGGG + Intronic
1169955440 20:11097703-11097725 TCACTCTGTGAGATCAGCCCAGG - Intergenic
1170719138 20:18859907-18859929 CCAATCCATGAGAGCAGTCATGG + Intergenic
1170818840 20:19739053-19739075 GTAATTTGTGACAGCAGCCCTGG + Intergenic
1171424150 20:25039090-25039112 CTGCTCTGTGGGAGCAGCCCTGG - Intronic
1172640036 20:36435433-36435455 CACAGCTGTGAGGGCAGCCCTGG - Intronic
1175844270 20:62050475-62050497 CCACCCGCTGAGAGCAGCCCGGG + Intronic
1176267960 20:64220624-64220646 TCCAGCTGTGAGGGCAGCCCAGG + Intronic
1177328797 21:19629306-19629328 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
1177734534 21:25072631-25072653 CCAACCCTTGAGAGCAGCCATGG - Intergenic
1178029228 21:28505483-28505505 CCAGCCTATGAGAGCAGCCTTGG - Intergenic
1179487038 21:41717050-41717072 CCACACTGTGAGAGAAGACCTGG - Intergenic
1180363541 22:11920152-11920174 CCAGCCCGTGAGAGCAGCCATGG - Intergenic
1180685638 22:17664421-17664443 CCAGTCTGTGAAAGGAGCCGGGG - Intronic
1180815083 22:18784356-18784378 CTAATCTTTGATAGCAGACCAGG + Intergenic
1181201271 22:21218693-21218715 CTAATCTTTGATAGCAGACCAGG + Intronic
1181432319 22:22888886-22888908 TCGATCTGTGAGACCAGCCTGGG - Intronic
1181700472 22:24618271-24618293 CTAATCTTTGATAGCAGACCAGG - Intronic
1183378976 22:37481291-37481313 CCAATCTGGGAGAGCCGGACTGG - Intronic
1183757694 22:39785353-39785375 CCAAGATGAGAGAGCAGCCAGGG - Intronic
1185232535 22:49691438-49691460 GCATTCTGTGAGGGCAACCCAGG + Intergenic
1203225642 22_KI270731v1_random:76737-76759 CTAATCTTTGATAGCAGACCAGG - Intergenic
1203265186 22_KI270734v1_random:10047-10069 CTAATCTTTGATAGCAGACCAGG + Intergenic
951241159 3:20287715-20287737 TCAACCTGTGAGAGCAGCCATGG - Intergenic
952139201 3:30459403-30459425 CCAACCAGTGACAGCAGCCATGG + Intergenic
952928531 3:38341093-38341115 GCAATTTGTGAAAGCAGCTCAGG + Intergenic
953202214 3:40787673-40787695 CCAACCTGTGAGACCAACCATGG + Intergenic
953835395 3:46338830-46338852 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
954713317 3:52515470-52515492 CACATGTGTAAGAGCAGCCCCGG - Exonic
956563959 3:70614959-70614981 CCAACATGTGAGAGCAGCTGCGG - Intergenic
957903831 3:86533123-86533145 CCAACCTATGTGAGCAGCCTGGG - Intergenic
958046439 3:88289457-88289479 CCAGAATGTGAGACCAGCCCGGG - Intergenic
958841377 3:99209441-99209463 ACAACCTGTGAGGGCAGCCACGG - Intergenic
959224700 3:103564663-103564685 CCAATATGTGATGGCACCCCCGG + Intergenic
959862309 3:111229950-111229972 CCAACCCATGAGAGCAGCCTTGG + Intronic
960150694 3:114245967-114245989 CCAGCCTGTGAAAGCAGCCAGGG + Intergenic
962786069 3:138769038-138769060 CCAAACTGTGGGTGCAGACCCGG - Intronic
962976062 3:140446861-140446883 CCTTTCTGTTAGAGCAGCACAGG + Intronic
963511819 3:146256622-146256644 CCAACCTATGAGAGTAGCCATGG - Intergenic
963827392 3:149970520-149970542 CCAGCCTGTCAGCGCAGCCCCGG + Intronic
964092362 3:152892183-152892205 CCAACCTGTGAGAGCAGCTGTGG - Intergenic
965397228 3:168174230-168174252 CTAGTCTGTGAGAGCAGCCATGG - Intergenic
967281880 3:187831048-187831070 CAAATCTGTGAGTGGAGCCGAGG + Intergenic
968130470 3:196190138-196190160 CCAAGCTGGGCCAGCAGCCCAGG + Intergenic
969176983 4:5406289-5406311 CCAACCTGTGAAGGCAGCCGAGG - Intronic
969934340 4:10666263-10666285 GTAATTTGTTAGAGCAGCCCAGG + Intronic
970665661 4:18333553-18333575 CCAATCCATGAGAGCAGCTATGG - Intergenic
971060214 4:22959588-22959610 CCAAGCTGTAAAATCAGCCCAGG - Intergenic
972079753 4:35136365-35136387 CCAACCTGTGAGAACAGCCCTGG - Intergenic
973369125 4:49231205-49231227 CCAGTCTATGAGAGCAGCCATGG + Intergenic
973391915 4:49564211-49564233 CCAGTCTATGAGAGCAGCCATGG - Intergenic
974733249 4:65897167-65897189 ACAATCTGTGAGAGCAGATGTGG - Intergenic
977271012 4:94917358-94917380 TCAACCTGTGAGAGCAGCCATGG + Intronic
978492403 4:109323097-109323119 CCAGCCTGTGAAAGCAGCCAAGG - Intergenic
978983726 4:114983303-114983325 CCAGCCTGTGAAAGCAGCCATGG + Intronic
979087249 4:116428619-116428641 CCAGTCTGTGAAAGCAGCTGTGG + Intergenic
979499787 4:121426869-121426891 GTAATCTGTTATAGCAGCCCTGG - Intergenic
979610254 4:122682204-122682226 CCAGTCTGTGAAAGTAGCCATGG + Intergenic
979721508 4:123905497-123905519 CCAACCTGTGAAAGCAGCTGGGG + Intergenic
982189021 4:152834672-152834694 CCAACCAGTGAGAGCAGCCATGG - Intronic
982466883 4:155742950-155742972 TAAATTTGTGAGAGCAGCACTGG - Intergenic
982911159 4:161144451-161144473 CCAAGGTGTGAGAGCAGCCATGG + Intergenic
983032288 4:162817890-162817912 CCAATATGTGATATCACCCCTGG + Intergenic
984553257 4:181185188-181185210 CCAGCCTGTGAAAGCAGCCAGGG - Intergenic
985386418 4:189452634-189452656 CCAACCCATGAGAGCAGCCATGG + Intergenic
985803238 5:2019807-2019829 CCACTCTGTGAGAGGGGCCATGG - Intergenic
985998803 5:3613896-3613918 CCACACTGGGAGAGCAGCCAGGG + Intergenic
986345068 5:6827078-6827100 CCAAAGGGTGAGAGCAGCTCAGG - Intergenic
987106132 5:14641477-14641499 GCCAGCTGTGACAGCAGCCCTGG - Intergenic
987113551 5:14709187-14709209 CCAAACTGAGAAAGCAGGCCGGG - Exonic
987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG + Intergenic
988480171 5:31623306-31623328 TCAATCTGTGACAGCTCCCCAGG + Intergenic
988658484 5:33238478-33238500 CCAAACTGTGAGAGCAGCCTGGG - Intergenic
988770397 5:34427297-34427319 CCAGTCTGTGAAAGCAGCCATGG - Intergenic
989308201 5:39981581-39981603 CCAACCTGTGAAAGCAGCCATGG + Intergenic
990494643 5:56335202-56335224 CCAACCTTTGAGAGCAGCTATGG - Intergenic
990883705 5:60568624-60568646 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
991600716 5:68349119-68349141 CTAACCTGTGAGAGCAACCAAGG + Intergenic
993016914 5:82544717-82544739 ACAACCTGTCAGAGCAGCCTTGG + Intergenic
993328176 5:86567284-86567306 CCAACCTGTGAGACCATCCTTGG - Intergenic
993946559 5:94122725-94122747 CCAAACCATGAGAGCAGCCCTGG - Intergenic
995050805 5:107700713-107700735 CCAAACCATGAGAGCAGCACAGG + Intergenic
997489596 5:134262487-134262509 CCAATATGTGATGGCACCCCCGG - Intergenic
997639786 5:135441710-135441732 CCAAACTTGGAGAGCTGCCCCGG - Intergenic
998297560 5:140986226-140986248 CCCCTCTGTGTGAGCAGACCCGG + Intronic
998380876 5:141724519-141724541 CCAGCCTGTGAGAGCAGCCTTGG - Intergenic
999900293 5:156079777-156079799 ACAATCTGTGAGAGCAGCTGTGG - Intronic
1001112526 5:168909174-168909196 ACTATGTGTGAGAGCAGCTCGGG - Intronic
1001522953 5:172407993-172408015 CCAGCCTGGGAAAGCAGCCCTGG - Intronic
1001790632 5:174454709-174454731 CCCTTCTGTGAGATAAGCCCTGG + Intergenic
1002535037 5:179871591-179871613 GCACTCTGTGAGAGCATCCTCGG + Intronic
1002584260 5:180231937-180231959 CCAAGCTTTCAGAGGAGCCCTGG - Intergenic
1002774283 6:315444-315466 CCAGTCTGGGAGAGGAGTCCCGG - Intronic
1003137077 6:3441833-3441855 CCCATCTGTGACACCAGCCCAGG + Intronic
1003439292 6:6124250-6124272 CCAACCTGTGAGAGCAGCCATGG + Intergenic
1003709354 6:8571782-8571804 CCAGTCTGAGGGAGAAGCCCAGG + Intergenic
1005101166 6:22173702-22173724 CTAACCTGTGAAAGCAGCCTTGG + Intergenic
1008199202 6:48565094-48565116 CCAACCTGTGAAAGCAGCCATGG + Intergenic
1009547102 6:65033915-65033937 CCAATCTGTGAGAGCAGCCCTGG + Intronic
1009946399 6:70346808-70346830 TCAATCGGTGTGATCAGCCCAGG + Intergenic
1010650980 6:78455335-78455357 CCAGCCTGTGAAAGCAGCCAGGG - Intergenic
1010659725 6:78556065-78556087 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
1011245652 6:85318483-85318505 CTAATTTGTGATAGCAGCCCTGG + Intergenic
1011504610 6:88028116-88028138 ACAACCTGTGAAAGCAGCCATGG - Intergenic
1012039342 6:94184834-94184856 CCAGCCTGTGAGAGCAGCCATGG - Intergenic
1012120886 6:95365667-95365689 CCAACCCATGAGAGCAGCCCTGG - Intergenic
1013289858 6:108710521-108710543 CTTGTCTGTGAGGGCAGCCCAGG - Intergenic
1014294520 6:119602311-119602333 CCCATCTGTGACACCAGCACAGG + Intergenic
1014480083 6:121925507-121925529 CCAGTGTTTGAGAGCAGGCCAGG - Intergenic
1015662274 6:135589005-135589027 ACAACCTGTGAGAACAACCCTGG - Intergenic
1016414734 6:143820616-143820638 CCAGCCTGTGAGATCAGCCTGGG - Intronic
1019293312 7:260961-260983 CCAGCCTCTGAGAGCAACCCAGG - Intergenic
1019650594 7:2155714-2155736 CCAAAAGGTGAAAGCAGCCCAGG - Intronic
1019743517 7:2687604-2687626 GCCAGCTGTGAGTGCAGCCCTGG - Intronic
1020579077 7:9971610-9971632 CCAGTCTGTGAAAGCAACCTTGG + Intergenic
1020668190 7:11073521-11073543 CCAACCCATGAGAGCAGCCAAGG - Intronic
1021380097 7:19955997-19956019 CCAGCCTGTAAGAGCAGCCTTGG + Intergenic
1021621676 7:22555652-22555674 CAAATCTGGGAGAGCATCGCAGG - Intronic
1022595935 7:31713419-31713441 CCAGACTGTGAAAGCAGCCAGGG - Intergenic
1022633588 7:32109719-32109741 CCAAGCAGAGAGAGCAGCCATGG - Intronic
1024828450 7:53420194-53420216 CCAATCTGTAGGAGAAGCCCTGG - Intergenic
1024860580 7:53835348-53835370 CCAACCCATGAGAGCAGCCATGG + Intergenic
1024972406 7:55082735-55082757 GTGATCTGTTAGAGCAGCCCTGG - Intronic
1025295120 7:57770527-57770549 CTAGGCTGAGAGAGCAGCCCAGG - Intergenic
1025301058 7:57819957-57819979 CCTGGGTGTGAGAGCAGCCCAGG - Intergenic
1025782427 7:64613703-64613725 CCAATCTGTGGGCTGAGCCCAGG - Intergenic
1025933227 7:66012999-66013021 CCACTCTCTGAAAGCAGCCAGGG + Intergenic
1027180355 7:75935084-75935106 ACAGGCTGTGAGAGCAGCCTCGG + Intronic
1027586633 7:80066345-80066367 CCGACCTGTGAAAGCAGCCCTGG - Intergenic
1027677815 7:81181287-81181309 CCAACCCATGAGAGCAGCACTGG + Intronic
1028439174 7:90839018-90839040 CCAATATGTGATGGCACCCCCGG + Intronic
1030930843 7:115521865-115521887 CCAATCTGTAAGAACAGCTGAGG - Intergenic
1032702790 7:134397085-134397107 CCAGACTGTGAGAGGTGCCCAGG + Intergenic
1033261872 7:139850995-139851017 GCAATTTGTTAGAGAAGCCCTGG + Intronic
1033305585 7:140223166-140223188 CCAGTCAGTGTTAGCAGCCCTGG - Intergenic
1033552432 7:142459693-142459715 GCAGTCTGGGAGAGCAGCCTAGG + Intergenic
1033843548 7:145404031-145404053 ACAACCTGTGAGAGCAGCCATGG + Intergenic
1037863953 8:22427957-22427979 CCAGTATTTGAGACCAGCCCAGG + Intronic
1038642077 8:29337015-29337037 CCCAGCTGTTAGAGCCGCCCTGG - Exonic
1039330998 8:36536519-36536541 CCAATATGTGATGGCACCCCCGG - Intergenic
1039918967 8:41879776-41879798 CTGGTCTGTGAGAGGAGCCCTGG - Intronic
1040462988 8:47667386-47667408 CCAAAGTTTGAGACCAGCCCAGG + Intronic
1041443627 8:57926444-57926466 GCATTTTGTGATAGCAGCCCAGG - Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042394380 8:68275349-68275371 CCAAAGTTTGAGAGCAGCCTGGG - Intergenic
1042501590 8:69514969-69514991 CTAGCCTGTGAAAGCAGCCCAGG - Intronic
1045012151 8:97967709-97967731 ACAACCTGTGAGGGCAGCCTTGG - Intronic
1045561870 8:103271731-103271753 CCAGTCCATGAAAGCAGCCCTGG + Intergenic
1045678149 8:104631020-104631042 CCCATGTTTGAGACCAGCCCAGG + Intronic
1046962812 8:120127568-120127590 CCCATTTTTAAGAGCAGCCCTGG - Intronic
1047778138 8:128090545-128090567 CCAAACAGAGAGTGCAGCCCAGG + Intergenic
1048130702 8:131693886-131693908 CCAACCTATGAGAATAGCCCTGG - Intergenic
1048526291 8:135205996-135206018 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
1048670380 8:136712578-136712600 CCAATATGTGATGGCACCCCCGG + Intergenic
1048724798 8:137371377-137371399 CAAAGCTGTCACAGCAGCCCAGG - Intergenic
1049572826 8:143377671-143377693 CCACTCTATGGGATCAGCCCCGG - Intronic
1050532699 9:6604685-6604707 CAAATCTCTGGGAGCTGCCCAGG + Exonic
1051127613 9:13821859-13821881 CCAACCTGTGAGAGCAGTCATGG + Intergenic
1052004593 9:23330672-23330694 CCAGCCTGTGAGAGCAGCCATGG + Intergenic
1052341336 9:27367027-27367049 CCACTCTGTGAGAGCAGGGACGG + Intronic
1052877601 9:33578928-33578950 CCAGTCCATGAGAGCAGCCGTGG - Intergenic
1052878469 9:33584998-33585020 CCAGTCCATGAGAGCAGCCATGG - Intergenic
1053497512 9:38559211-38559233 CCAGTCCATGAGAGCAGCCATGG + Intronic
1053498387 9:38565280-38565302 CCAGTCCTTGAGAGCAGCCGTGG + Intronic
1053616344 9:39770312-39770334 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
1053898105 9:42764968-42764990 CCAGCCTGTGAAAGCAGCCGTGG + Intergenic
1053913228 9:42926194-42926216 CCAGTCCATGAGAGCAGCCATGG - Intergenic
1054237173 9:62572077-62572099 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
1054551309 9:66606588-66606610 CCAGCCTGTGAAAGCAGCCATGG + Intergenic
1057161552 9:92892189-92892211 CCAGTCCATGAGAGCAGCCGTGG + Intergenic
1057300220 9:93874223-93874245 CCAGCCTATGAGAGCAGCCCTGG - Intergenic
1057332550 9:94129256-94129278 CCAGCCTGTGAGAGTAGCCATGG + Intergenic
1057677847 9:97149767-97149789 CCAGTCCATGAGAGCAGCCGCGG + Intergenic
1058288522 9:103209717-103209739 CCAGTCTGTGAGAGCAGTCCTGG - Intergenic
1060757949 9:126226382-126226404 TGCCTCTGTGAGAGCAGCCCAGG + Intergenic
1061356279 9:130107676-130107698 CCACTTCGTGAGAGCAGCCAGGG + Intronic
1061807617 9:133145181-133145203 GCACTTTGTGACAGCAGCCCAGG + Intronic
1062261037 9:135663539-135663561 CCAAGCTGTGACAGCAGCCTGGG + Intronic
1187836589 X:23437580-23437602 TCAATGTGTGAGAGCAGCCATGG + Intergenic
1188016336 X:25111829-25111851 CCAACCTGTGAGAGCAGACATGG - Intergenic
1188865299 X:35306324-35306346 CCAGCCTGTGAGAGTAGCCGAGG + Intergenic
1188954129 X:36414225-36414247 CCATCCTGTAAGAGCAGCCATGG - Intergenic
1189071256 X:37866378-37866400 CCAGCCTGTGAAAGCAGCCGGGG - Intronic
1189695050 X:43654963-43654985 CCACTCTTAGAGACCAGCCCCGG - Intronic
1190772574 X:53527415-53527437 CCAGCCTGTGAAAGCAGCCGTGG + Intergenic
1191227888 X:58064798-58064820 CCACTCTGTGAGATCAATCCAGG + Intergenic
1192696019 X:73416812-73416834 CCAGCCTGTGAGAGCAGCCATGG - Intergenic
1193143484 X:78054135-78054157 CCAGCCTGTGAAAGCAGCTCTGG - Intergenic
1193520024 X:82518569-82518591 CCAGCCTGTGAAAGCAGCCATGG - Intergenic
1193724765 X:85025798-85025820 CCAATCCATAAGAGCAGCCCTGG - Intronic
1193865873 X:86729089-86729111 ACAACCTGTGAGAGCAGCACAGG + Intronic
1193911229 X:87309262-87309284 CCAGCCTGTGAAAGCAGCCAAGG - Intergenic
1194150774 X:90323197-90323219 GCAGTCTGTGAAATCAGCCCTGG - Intergenic
1194211975 X:91081516-91081538 CCAATCCTTGAGGGCAGCCATGG - Intergenic
1194541506 X:95178012-95178034 CCAACCTGTAAAAGCAGCCATGG + Intergenic
1194572898 X:95574699-95574721 CCAATCTGTGGGAGCAGCCATGG + Intergenic
1194856282 X:98933152-98933174 ACAGTCTGTGAGAGCAGCCACGG + Intergenic
1197186776 X:123596248-123596270 CCAATTTGTTATACCAGCCCAGG - Intergenic
1197516050 X:127430662-127430684 GCAATGTGTGAGAGCACCGCTGG + Intergenic
1197795285 X:130291611-130291633 CCAATATGTGATGGCACCCCTGG - Intergenic
1198282801 X:135158558-135158580 CCAATATGAGGGAGCAGCACAGG + Intronic
1198285078 X:135181508-135181530 CCAATCTGAGGGAACAGCACAGG + Intergenic
1198834990 X:140795461-140795483 CCAGCCTGTGAAAGCAGCCGGGG - Intergenic
1199128632 X:144157360-144157382 ACAACCTGTGAGAGCAGGCATGG + Intergenic
1199134551 X:144234967-144234989 ACAACCTGTGAGAGCAGCCTTGG + Intergenic
1199603362 X:149556795-149556817 CCAACCAGTGAGAGTAGCCATGG + Intergenic
1199647025 X:149922680-149922702 CCAACCAGTGAGAGTAGCCATGG - Intergenic
1200207402 X:154327036-154327058 ACAATCTATGAAAGAAGCCCAGG + Intronic
1201270324 Y:12247726-12247748 CCAATCTTTGATACCAGCCATGG + Intergenic
1201680543 Y:16640339-16640361 CCAATCTTTGATACCAGCCATGG - Intergenic
1201970605 Y:19789863-19789885 CCACCCTTTGAGAGCAGCCATGG + Intergenic