ID: 1009548258

View in Genome Browser
Species Human (GRCh38)
Location 6:65050250-65050272
Sequence TAGCACTTACAACGAACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009548255_1009548258 12 Left 1009548255 6:65050215-65050237 CCTATATGCTTGCTGCCAAAATA 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1009548254_1009548258 13 Left 1009548254 6:65050214-65050236 CCCTATATGCTTGCTGCCAAAAT 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1009548256_1009548258 -3 Left 1009548256 6:65050230-65050252 CCAAAATAACCTTAGCATGTTAG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009548258 Original CRISPR TAGCACTTACAACGAACTAA AGG Intronic
906450148 1:45938924-45938946 TAGAACATACAAAGAACTCAAGG - Intronic
909575949 1:77176717-77176739 TAGCACTGATAACTAACTGATGG - Intronic
1063290548 10:4742117-4742139 TAGCATTTACAACAAACCCATGG - Intergenic
1064760432 10:18613525-18613547 TACCATTAACAATGAACTAATGG + Intronic
1069516499 10:69081911-69081933 TAGGACTTACAAAAAACTATAGG - Intergenic
1069938854 10:71939681-71939703 AAGGGCTTACAACTAACTAAGGG - Intergenic
1070567732 10:77616407-77616429 TAGCACTTGCTACAAACCAAGGG - Intronic
1074013467 10:109508204-109508226 TATGACTTGCAACCAACTAATGG - Intergenic
1080531998 11:33185561-33185583 TAGCACTTATAGAGAACTATTGG - Intergenic
1082680857 11:56167897-56167919 TAGCTCTTACAAACAACAAATGG - Intergenic
1084719182 11:70893159-70893181 TAGCACTTACCAAGTACTACAGG - Intronic
1086329972 11:85744201-85744223 GAGCACTTACTACGTGCTAATGG + Intronic
1087964115 11:104391490-104391512 TAGCAGTGACAACCAACTATTGG - Intergenic
1097323973 12:58255150-58255172 TAGGACATACAACAAACAAATGG - Intergenic
1099198261 12:79645480-79645502 TAGCCCTTACACAGCACTAATGG - Intronic
1101932008 12:109022313-109022335 GGACACTTACAAGGAACTAAAGG + Intergenic
1102717954 12:114990410-114990432 TATCACTTACAAGGCACCAAAGG - Intergenic
1106375067 13:29178127-29178149 TAGAATTTACAGCGAACTACCGG + Intronic
1110633799 13:77741218-77741240 TAGCAGTCACAAAGAACTATTGG + Intronic
1125628009 15:41124873-41124895 TAATACTTTCAAAGAACTAAAGG - Intergenic
1138435428 16:56996508-56996530 TACCACTTGCCACGAACTGAAGG - Intronic
1149111973 17:53045438-53045460 TATGACTTACAAAGAACTTATGG - Intergenic
1152878526 17:82802256-82802278 TAGCACTTGAAACAAACTGAAGG - Intronic
1154203883 18:12320445-12320467 TAGGACTTAAAAGGAACAAAAGG + Intronic
1154509194 18:15077188-15077210 TAGCACTTACAACCATCTAGTGG - Intergenic
1156408028 18:36801123-36801145 TAGCATTCACAACCAAGTAATGG - Intronic
1165257044 19:34584099-34584121 TAACACTTTCACAGAACTAAGGG - Intergenic
931030269 2:58167838-58167860 TAGCAATTTCAACGAACTTAGGG + Intronic
931745656 2:65289688-65289710 TAGCACTTAAAATGAACTTGGGG - Intergenic
932138278 2:69251106-69251128 TGGCACTTAAAACCAAGTAAAGG - Intergenic
941807519 2:169723932-169723954 TAGCACTTACGAGCAAGTAAAGG + Intronic
944507446 2:200427158-200427180 TACCACTTACAAAGATCAAAAGG + Intronic
946979842 2:225198469-225198491 TAGCACTCACAGTGAATTAATGG - Intergenic
1169759519 20:9075909-9075931 AAGCACTTACAGCTAACAAAAGG - Intronic
1169995029 20:11546788-11546810 TACTCCTTACAAGGAACTAAAGG - Intergenic
1170348179 20:15410264-15410286 TAGTACTTACGACTATCTAATGG + Intronic
1176788876 21:13294626-13294648 TAGCACTTACAACCATCTAGTGG + Intergenic
1177988039 21:28002766-28002788 TAGCACTTACAACCATCTAGTGG + Intergenic
951463923 3:22980727-22980749 TACCCCTTACAAAGTACTAATGG + Intergenic
964447783 3:156778441-156778463 TAGCACCTACAACTTGCTAATGG - Intergenic
966553577 3:181232489-181232511 GAGCACTCACAACCAAATAATGG + Intergenic
970662141 4:18297313-18297335 TAGAACTTCCAAAGAAATAAGGG + Intergenic
971887020 4:32463566-32463588 AAGCACTTCCAAAGACCTAATGG + Intergenic
974612079 4:64230161-64230183 TAGGACTTAAAACAAATTAAAGG - Intergenic
977610629 4:99026425-99026447 TAGCATTTGAAACGACCTAATGG + Intronic
979825140 4:125223392-125223414 TATTACTTATAACAAACTAATGG + Intergenic
986462094 5:7983049-7983071 TAACACTTACAATGAACGTATGG - Intergenic
987070316 5:14330761-14330783 TAGCACCTACAATGAAATACAGG - Exonic
994860837 5:105191151-105191173 TAGCTCTTCAAACAAACTAATGG + Intergenic
1000430056 5:161140989-161141011 TAGCACTTAGAACAAGCTTAGGG + Intergenic
1000450329 5:161378446-161378468 TAGCCCTTAAAATGAGCTAATGG + Intronic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG + Intronic
1014766946 6:125417675-125417697 TTGCACTTACAAGGAATCAAGGG - Intergenic
1015555576 6:134458271-134458293 TAGCAGTTGCAATGAACTGAAGG - Intergenic
1021289851 7:18829636-18829658 TAGCACTTGCAAACAACTGAAGG + Intronic
1021528521 7:21617052-21617074 TAGAACTTAGCACGAAATAAAGG - Intronic
1023404308 7:39815617-39815639 TAACACATACAAGAAACTAATGG - Intergenic
1036834139 8:12045093-12045115 TAGCACTAACAACAAACAACTGG - Intergenic
1036855983 8:12291658-12291680 TAGCACTAACAACAAACAACTGG - Intergenic
1043756582 8:84011220-84011242 TATCACTTACAGGGAACTAGTGG - Intergenic
1046628104 8:116596871-116596893 TAGCACTTAGAACTCAATAAAGG + Intergenic
1053210156 9:36220822-36220844 TAGCAGTTACAAAGGAGTAAAGG + Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1057863954 9:98664523-98664545 TTGCATTTACATAGAACTAATGG + Intronic
1188438199 X:30186337-30186359 TAGTACTTATAATGTACTAATGG - Intergenic