ID: 1009548351

View in Genome Browser
Species Human (GRCh38)
Location 6:65052187-65052209
Sequence TACCCAACCCCATTTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009548351 Original CRISPR TACCCAACCCCATTTAGTTC TGG Intronic
901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG + Intronic
901361448 1:8704177-8704199 TACCCACCCACAATTAATTCTGG + Intronic
906346137 1:45015757-45015779 TACCCTACCCCATGTAGTTCTGG - Intergenic
918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG + Intergenic
919132685 1:193471126-193471148 AACCAAGCCCCATTTATTTCTGG + Intergenic
1063417685 10:5887766-5887788 TGCCCAACCGCATCTTGTTCAGG - Intronic
1066170276 10:32836073-32836095 TACACAACTAAATTTAGTTCTGG + Intronic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1068797214 10:61096843-61096865 TACAGATCCCAATTTAGTTCTGG + Intergenic
1073948379 10:108778743-108778765 AACCCAACCCCATTAAGATGTGG - Intergenic
1088130572 11:106484191-106484213 CACCCAAACCCATAAAGTTCAGG - Intergenic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1100387418 12:94116630-94116652 TACCCAACACCATTTATTTAAGG + Intergenic
1103081996 12:118031589-118031611 TAGCCTACCCCATTTTGGTCTGG + Exonic
1106483413 13:30153829-30153851 TACAGAACCCCAGTGAGTTCTGG + Intergenic
1110182563 13:72635131-72635153 TACCTAAGCCCATTTGGTTGAGG + Intergenic
1121090960 14:91182365-91182387 TACCTAACCCCATCTGCTTCTGG - Intronic
1124898367 15:33798683-33798705 TAACAAACCCCATTTTGTTCAGG - Intronic
1126033892 15:44529587-44529609 AAACCAACCCCTTTTAATTCTGG - Intergenic
1134049132 16:11124687-11124709 TACCCAGTGCCATTCAGTTCAGG + Intronic
1136725449 16:32353614-32353636 TTCCCTACCCCATTAAGTTATGG - Intergenic
1136843780 16:33559670-33559692 TTCCCTACCCCATTAAGTTATGG - Intergenic
1138276905 16:55741650-55741672 CACCCAACCCCATTTCCTTGAGG - Intergenic
1138286143 16:55811779-55811801 CACCCAACCCCATTTCCTTGAGG + Intronic
1203000982 16_KI270728v1_random:164142-164164 TTCCCTACCCCATTAAGTTATGG + Intergenic
1203132584 16_KI270728v1_random:1700545-1700567 TTCCCTACCCCATTAAGTTATGG + Intergenic
1203153945 16_KI270728v1_random:1859968-1859990 TTCCCTACCCCATTAAGTTATGG - Intergenic
1142861706 17:2766148-2766170 AACCCAACCTCTTTTAGATCCGG + Intergenic
1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG + Intergenic
1146008799 17:29178727-29178749 TTCCCCACCCTTTTTAGTTCAGG - Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1153355450 18:4129691-4129713 TACCCACGCCAATTTAGTACTGG + Intronic
1157447049 18:47754030-47754052 TCCCCAACCCCAATTGTTTCTGG + Intergenic
1159863924 18:73682471-73682493 TACCTAAAACCATTTTGTTCTGG + Intergenic
1165071246 19:33256078-33256100 AACCCAACCCCACTCAGATCCGG - Intergenic
925386774 2:3467554-3467576 AACCCAGCCCCAGTAAGTTCCGG + Intronic
926977626 2:18531080-18531102 TACCCACTGCCATGTAGTTCAGG - Intergenic
930787752 2:55286984-55287006 TACTCATCCCCTTTCAGTTCTGG + Intergenic
931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG + Intronic
931708940 2:64970785-64970807 TAAACAACCCCATCTTGTTCAGG - Intergenic
943387202 2:187216777-187216799 TCCCCAACCCCATTCCCTTCTGG - Intergenic
945511639 2:210710183-210710205 TAGCCAACCACATCTAATTCAGG - Intergenic
1173277895 20:41600404-41600426 TACCCTACTCCGCTTAGTTCTGG - Intronic
1182412500 22:30199106-30199128 TCCCCAACCTAATTTTGTTCTGG + Intergenic
1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG + Intergenic
954784430 3:53082539-53082561 TACACAGCCCCCTTTAGCTCTGG - Intronic
955707051 3:61738220-61738242 TACCCAACCACATTTAAATAGGG + Intronic
961620118 3:128217384-128217406 TACCCAACCCCATTTCACCCTGG - Intronic
969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG + Intergenic
971716042 4:30178693-30178715 TACCCAATCTCATGTATTTCTGG - Intergenic
976958513 4:90935677-90935699 TTCCCAACCCAATTTAGTCCTGG - Intronic
983769827 4:171535570-171535592 TACCCAACCTCAGGTAGTTTGGG + Intergenic
984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG + Intronic
996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG + Intergenic
1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG + Intronic
1007304292 6:40892187-40892209 TCCCCAACCCCCTTTAATTAGGG + Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1011453716 6:87524278-87524300 TACCAAATCCCAATGAGTTCTGG + Intronic
1014073125 6:117205817-117205839 TGCCCTCCCTCATTTAGTTCAGG + Intergenic
1022582889 7:31574477-31574499 AACCCAACACCATTTTTTTCTGG - Intronic
1033141208 7:138828487-138828509 CACCCACCCCCATTTATTCCAGG + Intronic
1041834780 8:62199134-62199156 TACCCAACTCCAGGTATTTCAGG + Intergenic
1044478848 8:92661056-92661078 TACCCACCCATATTTAATTCAGG - Intergenic
1045560254 8:103254755-103254777 CCCCCAACCCCAGTCAGTTCAGG - Intergenic
1048506224 8:135024674-135024696 TGCCCAAGCTCATATAGTTCAGG + Intergenic
1051131181 9:13862706-13862728 TGTCCAGCCCCATTTATTTCAGG - Intergenic
1055201726 9:73671464-73671486 AACCCAACCCCTTTTTCTTCAGG + Intergenic
1185956246 X:4494158-4494180 TACCCAATCTCATCTACTTCTGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1189773941 X:44453256-44453278 TTTCCTATCCCATTTAGTTCAGG - Intergenic
1198231424 X:134693150-134693172 TGCCCACCCCCATGTATTTCAGG + Intronic
1198384148 X:136112280-136112302 TTCCCTATCCCATTTATTTCAGG + Intergenic
1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG + Intronic
1200980669 Y:9260693-9260715 ATCCCACACCCATTTAGTTCTGG - Intergenic
1201744567 Y:17357625-17357647 TACCCAGTCCCATCTACTTCTGG - Intergenic