ID: 1009548980

View in Genome Browser
Species Human (GRCh38)
Location 6:65061797-65061819
Sequence CCTCATAGGAACCATCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009548977_1009548980 11 Left 1009548977 6:65061763-65061785 CCATCTGGGCTAAATCACACTGT 0: 1
1: 0
2: 1
3: 13
4: 114
Right 1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 98
1009548974_1009548980 26 Left 1009548974 6:65061748-65061770 CCTCAATTGCTTGCACCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009548980 Original CRISPR CCTCATAGGAACCATCATGT AGG Intronic
901364012 1:8729850-8729872 CCTGATGTGAACCATCATATGGG - Intronic
905335949 1:37244632-37244654 TCTCATAGCAACTAGCATGTAGG - Intergenic
906800766 1:48735073-48735095 CCTCATAGCAACCCTACTGTTGG - Intronic
907614140 1:55906847-55906869 GCACCTAGGAACCATGATGTTGG + Intergenic
908331736 1:63077460-63077482 CCTTATAGGCACCTTGATGTTGG + Intergenic
912581211 1:110722630-110722652 CCTCACAGGACCCATCAGCTGGG - Intergenic
921503843 1:215942073-215942095 CCTCATTGGAACCTTCAGATGGG - Intronic
922757860 1:228106394-228106416 CCTCCTAGGAACCAACCTGAGGG + Intergenic
1064355670 10:14615371-14615393 GCTGATAGGAACGATCTTGTAGG + Intronic
1065607699 10:27436449-27436471 CCAAATAGGAACAATGATGTGGG + Intergenic
1066306590 10:34150119-34150141 CCTTATAGAAATCATCATATTGG + Intronic
1067419590 10:46134403-46134425 CCTCAAAGGAGCCATAGTGTGGG - Intergenic
1067426429 10:46215008-46215030 CCTCAAAGGAGCCATAGTGTGGG + Intergenic
1067504941 10:46841000-46841022 CCTCAAAGGAGCCATAGTGTGGG - Intergenic
1070440476 10:76437895-76437917 CCTCATAACAACCATAAGGTAGG + Intronic
1074688643 10:115982527-115982549 CCAGATAGGAACTATAATGTTGG - Intergenic
1074727221 10:116324383-116324405 GCTCATTGGGACCATCCTGTGGG - Intergenic
1075722703 10:124596786-124596808 CCTCATATTCACCATCATGGTGG - Intronic
1080248096 11:30202286-30202308 CCTCATAGAAAACATCTTCTGGG - Intergenic
1082109326 11:48256981-48257003 CCTCATTGGACCAATGATGTTGG - Intergenic
1084637826 11:70404700-70404722 ATTCATAAGAAACATCATGTAGG + Intronic
1085382449 11:76132414-76132436 CCTCAGAGGAAACATTTTGTAGG + Intronic
1086342167 11:85857676-85857698 CCTCATAGATAGCATCAAGTGGG + Intronic
1092952654 12:13521850-13521872 CCTCATATGAACCACTATATAGG - Intergenic
1093971516 12:25380294-25380316 CAACATAGGTACCATCATGTTGG + Intergenic
1097136001 12:56856252-56856274 CCTCATAGGAACCATGAGTCAGG - Intergenic
1097350806 12:58546700-58546722 CTTTATAGTAACCTTCATGTTGG + Intronic
1097351444 12:58553484-58553506 CCTGATAGGAAACACCAAGTAGG + Intronic
1100068574 12:90681916-90681938 CCTCATAGGGAACATGATGGAGG + Intergenic
1101323764 12:103696813-103696835 GCTCATAGGAACAAGCATGCAGG - Intronic
1102594181 12:113979847-113979869 CTTCATAGGCACCATCTTGGAGG + Intergenic
1108321881 13:49297877-49297899 CTTCTTAGGAAACATCATGAGGG - Intergenic
1109957971 13:69593110-69593132 ACTCAAAAGAACCCTCATGTGGG - Intergenic
1110267089 13:73551001-73551023 CCCCACAGGGTCCATCATGTAGG + Intergenic
1111999865 13:95200081-95200103 CCTCCTGGGAATCATCAAGTGGG - Intronic
1112284331 13:98090632-98090654 CCTCTCAGCAACCACCATGTAGG - Intergenic
1112796789 13:103065988-103066010 CCTCACAGGATTCATCCTGTCGG - Exonic
1120492018 14:85190226-85190248 CCCCATAGGAATCCTCCTGTTGG - Intergenic
1124338082 15:28872268-28872290 CCTCATAAACACCATCATATTGG - Intergenic
1131461620 15:92621855-92621877 CCTGGTAGGAACCTTAATGTTGG - Intronic
1135116656 16:19729495-19729517 CCTTATAGTTTCCATCATGTTGG + Intronic
1140935914 16:79670075-79670097 CCTCCTAGGCACCAGCCTGTTGG - Intergenic
1144509310 17:15861688-15861710 CCTCTTAGGGACCACCCTGTTGG - Intergenic
1147433213 17:40387141-40387163 CCTATTAGGAATGATCATGTAGG - Intergenic
1150564352 17:66325514-66325536 CCTTATAGGAACCATAATTAAGG + Intronic
1157098616 18:44709970-44709992 TGTCAAAGGAACCATCAAGTGGG + Intronic
1160748223 19:721183-721205 CCTTAGAGGAACCCTCAGGTCGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
927637691 2:24828029-24828051 CCTCATCGCCACCATCATGCTGG - Exonic
934158236 2:89222985-89223007 CCTCATAGGGAAAATAATGTGGG + Intergenic
934209028 2:89959439-89959461 CCTCATAGGGAAAATAATGTGGG - Intergenic
935313839 2:101811672-101811694 CTTCATAGCAAACACCATGTGGG - Intronic
936073209 2:109384835-109384857 CCACATGGGAACCATCGGGTTGG - Intronic
936084284 2:109455962-109455984 CCACGTGGGAACCATCATGCAGG + Intronic
936243265 2:110806231-110806253 CCTCACAGGAAGCATCATAAGGG - Intronic
940628071 2:156201562-156201584 ACTGAAAGGAACCCTCATGTAGG - Intergenic
943601775 2:189930224-189930246 CTTCAAGTGAACCATCATGTTGG - Intronic
945477551 2:210303527-210303549 TCTCATAGGACCCACCATGATGG + Intronic
946027408 2:216680089-216680111 CCTCAGAGGAACCAGAATGGGGG + Intronic
1171563401 20:26151819-26151841 CATCATAGTAAAAATCATGTGGG - Intergenic
1173537728 20:43828800-43828822 CCTCACAACAACCATCAAGTAGG - Intergenic
950335786 3:12191800-12191822 CCTCATTGGCACCACCATGTGGG - Intergenic
953705612 3:45227609-45227631 CATCACAGCAACCACCATGTGGG - Intergenic
957007567 3:74968112-74968134 CCAGTTAGGAACCATTATGTGGG + Intergenic
959021658 3:101194005-101194027 CCTCATAGGCATCAACTTGTAGG + Intergenic
959229419 3:103629575-103629597 ACCCAAAGGAAGCATCATGTGGG - Intergenic
964754701 3:160082937-160082959 CCTCATGGGCAACATCAGGTGGG - Intergenic
964756366 3:160093578-160093600 CCTCATGGGCAAGATCATGTGGG - Intergenic
965666078 3:171094722-171094744 TCTCACAGAAAGCATCATGTAGG - Intronic
967187696 3:186959606-186959628 CCCCATATGAACCATCAAGAAGG + Intronic
970419294 4:15890288-15890310 CCTCAAAGGCACCATCTTGGAGG - Intergenic
971988082 4:33853191-33853213 CATCATAGTAAAAATCATGTGGG + Intergenic
973265191 4:48203535-48203557 TCACATGGGGACCATCATGTTGG - Intronic
975479013 4:74857111-74857133 CCTCACAGTGACCATCATGGTGG - Intergenic
976123439 4:81807627-81807649 TCTCAGAGGAAGCATCGTGTAGG - Intronic
976823467 4:89233519-89233541 CCTAATAGGATGCCTCATGTTGG - Intergenic
977320404 4:95507636-95507658 CCTGATCACAACCATCATGTTGG + Intronic
981511857 4:145566364-145566386 CAGCACAGGAACCATGATGTGGG - Intergenic
984175994 4:176417631-176417653 CTTCATAGGACCCATGATGAGGG - Intergenic
985099654 4:186446022-186446044 CCTCATAGCAACCATATTCTAGG + Intronic
989373924 5:40739680-40739702 CTGCATAGGAAGCATAATGTTGG - Intronic
991550635 5:67832034-67832056 CTTCATAGGGACCATTATGTTGG + Intergenic
993982231 5:94557055-94557077 CCTGGTAGGAAACATCATTTTGG + Intronic
997594933 5:135100823-135100845 TCTCATGGGAACCAGCCTGTGGG - Intronic
998661129 5:144238971-144238993 TCTGATAGGAGCCAGCATGTGGG + Intronic
1006839348 6:37018454-37018476 GCCAATAGGAACCATCATGATGG - Intronic
1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG + Intronic
1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG + Intergenic
1012016755 6:93862595-93862617 CCTGATAGGAACCATTCTTTAGG - Intergenic
1014557742 6:122854098-122854120 CCTAATATTAACCATCATGCCGG + Intergenic
1016703317 6:147078146-147078168 CCTCAGAGGAGCAATCATGAAGG + Intergenic
1016743018 6:147548304-147548326 CCTCAGAGAGACCATCATTTCGG + Intronic
1025274309 7:57562510-57562532 CATCATAGTAAAAATCATGTGGG + Intergenic
1027927332 7:84483367-84483389 CCTGATAGTAACCCTAATGTTGG + Intronic
1030689955 7:112522183-112522205 CCTCATAGTAACCCCCATGAAGG - Intergenic
1039417646 8:37409401-37409423 CCTCATATTAACCATCATGGAGG - Intergenic
1039690234 8:39856020-39856042 CCTCAAAGGAACAATAATGAAGG + Intergenic
1041755928 8:61313176-61313198 CCTCAGAGGAATCATCCTGCAGG + Intronic
1045511338 8:102814269-102814291 CATCAAAGGAACCCACATGTTGG - Intergenic
1049517118 8:143066124-143066146 CATCATTGGAAACATCATGGAGG - Intergenic
1057754375 9:97820122-97820144 CCTCACAGATAACATCATGTGGG + Intergenic
1058941312 9:109815334-109815356 CCTGATAGGAAATAACATGTAGG + Intronic
1190342123 X:49305226-49305248 TCTCATAGTAACCTTCCTGTGGG + Intronic