ID: 1009558258

View in Genome Browser
Species Human (GRCh38)
Location 6:65203053-65203075
Sequence GGGCAGTGCCTGGACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009558258_1009558266 18 Left 1009558258 6:65203053-65203075 CCCTGAGAGTCCAGGCACTGCCC 0: 1
1: 0
2: 2
3: 26
4: 241
Right 1009558266 6:65203094-65203116 GTACTACTCCTGATCAACAAAGG 0: 1
1: 0
2: 2
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009558258 Original CRISPR GGGCAGTGCCTGGACTCTCA GGG (reversed) Intronic
900613994 1:3556175-3556197 GAGCAGAGCATGGACTCACAGGG - Intronic
900615492 1:3563880-3563902 GGGCAGGCTCTGGCCTCTCAGGG - Intronic
900992662 1:6105019-6105041 GGGCAGTGCCAGGACTACCTTGG + Exonic
901220984 1:7583665-7583687 GGGCAGTGACCAGACTCTGAGGG + Intronic
901614937 1:10531148-10531170 GTGCTCTGCCTGGAATCTCAAGG + Intronic
901871148 1:12140084-12140106 GTACAGTGCCTGGAATCCCAGGG + Intronic
903320767 1:22541860-22541882 GGTCAAGGCATGGACTCTCAAGG + Intergenic
903590005 1:24447742-24447764 GGGCACTGCTTGGACTAGCACGG - Intronic
903860515 1:26361677-26361699 GAGCAGTGCCGGGACTCCCCTGG - Exonic
904246886 1:29194287-29194309 TGGCACAGCCAGGACTCTCAAGG - Intronic
904605744 1:31696693-31696715 TGGCACTGCCTAGACCCTCACGG - Intronic
904760378 1:32799396-32799418 GGGCAGAGACTGGAGACTCATGG + Intronic
904823583 1:33260269-33260291 GGGCAGAGCCTGGACTATTAAGG - Intronic
905851493 1:41278145-41278167 GGCCAGTGCCTGGCATATCACGG + Intergenic
905905306 1:41614109-41614131 GGGCAGTGCAGGGACTCAGATGG + Intronic
906109085 1:43311653-43311675 GGGCACTGCCAGGAGACTCAGGG - Exonic
906953041 1:50349793-50349815 CCCCAGTGCCTGGACCCTCAGGG + Intergenic
907477547 1:54715707-54715729 CGGCAGTGCCTGGCCTCGCCCGG - Intronic
911147454 1:94566652-94566674 GGGCAGGGCCAGGAGTCACAAGG + Intergenic
912566854 1:110593466-110593488 GGTCTCTGCCTGGACCCTCATGG + Intergenic
913068578 1:115279835-115279857 GGGCATTGCTTGGACTCTCAAGG - Intergenic
913104366 1:115598222-115598244 GGGCAGTGGGTGCACGCTCATGG - Intergenic
916582808 1:166123704-166123726 GGGCAGTTCCTGGGATCTCAGGG + Intronic
917122589 1:171657196-171657218 GGGCTAAGCCTGGACTTTCAAGG - Intergenic
917730237 1:177867767-177867789 GGGCAGAGCCTGGTGTTTCAGGG + Intergenic
917962193 1:180154433-180154455 GGGCAGTTCCTGGGCTCCCGCGG - Intergenic
918144113 1:181740863-181740885 GGGCCCTGTCTGGATTCTCATGG + Intronic
919724757 1:200874256-200874278 GCGCGCTGCCTGGACTCCCAAGG + Intergenic
920221653 1:204408161-204408183 GGGAAGTTGCTTGACTCTCATGG - Intronic
921189393 1:212696376-212696398 GGGCAGTGCCAGGGCACTGATGG + Intronic
922706471 1:227793269-227793291 GGGCTGTGCCAGGCCTCGCAGGG + Intergenic
922728236 1:227936018-227936040 GGGCAGAGCGTGGGCTCTGAAGG - Intronic
923102124 1:230824938-230824960 TGCCAGAGCCTTGACTCTCAAGG + Intergenic
1067295372 10:44972561-44972583 GGGCACTGGCTGGACTCTGCAGG + Intronic
1067415201 10:46097375-46097397 GGGCAGAGCATGGACCCTGAAGG + Intergenic
1068634829 10:59337293-59337315 TGCCAGTGCCTGCACTCTAAGGG - Intronic
1068657530 10:59590953-59590975 GGACAGTCCCTTGACTCTCATGG + Intergenic
1069566676 10:69468097-69468119 GGGCGGGGGCTGGAGTCTCATGG - Intronic
1069898767 10:71695257-71695279 GGGCAGAGCCTGGGCTTTCGAGG - Intronic
1070287645 10:75095316-75095338 GTCCAGTGCCTGGCCTCTTATGG + Intronic
1071531173 10:86391334-86391356 GGGTGGTGCCTCCACTCTCAAGG - Intergenic
1071778024 10:88810849-88810871 GGGAAATGCCCGGACTCTCAAGG + Intronic
1071963579 10:90830960-90830982 TGGCAGAGCCTGAACTCTGAAGG - Intronic
1073726132 10:106233128-106233150 GGACAGAGCGTGGACTCTCTTGG + Intergenic
1074134771 10:110616875-110616897 AGGCAGCTCATGGACTCTCAGGG + Intergenic
1074556257 10:114493286-114493308 GGGCAATCTCTGGACTCTTAAGG + Intronic
1075072935 10:119330985-119331007 GGGCAATGCCTGGAAGCTTATGG - Intronic
1075612494 10:123864975-123864997 GTGCAATGCCTGCCCTCTCACGG + Intronic
1076538217 10:131196578-131196600 GATCAGTGCCTGGACTTTCATGG + Intronic
1076696511 10:132249813-132249835 GGGCAGTGCGGAGACCCTCATGG - Intronic
1077111212 11:863013-863035 GGGCTGTGCCTGCACTCACCAGG - Intronic
1077219357 11:1408552-1408574 GTCCAGGGCCTGGACCCTCAAGG + Intronic
1077562269 11:3271325-3271347 GGGCTTTGCCTGGACCTTCACGG + Intergenic
1077568163 11:3317145-3317167 GGGCTTTGCCTGGACCTTCACGG + Intergenic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084056599 11:66638069-66638091 GGGGAGCTCCGGGACTCTCAAGG + Intronic
1084313650 11:68331379-68331401 GGGCAGGGCCTGGCCCCACAAGG - Intronic
1085284255 11:75349885-75349907 GGGCACTGCCAGGCCCCTCATGG - Intronic
1086964935 11:93017905-93017927 GGGCAGGGACTGGGCTCTCAAGG + Intergenic
1087588008 11:100147197-100147219 GGACCCTGCCTGGAGTCTCAGGG - Intronic
1088015133 11:105049322-105049344 TGGCAGTGCATGAAGTCTCAAGG - Intronic
1089360543 11:117883261-117883283 GGGCTGTGCCTGGCCTTTCTTGG + Intergenic
1089733289 11:120532858-120532880 GGGCAGTGCCTGGAGACTTAGGG + Intronic
1089783028 11:120887593-120887615 GGGCAGTGCCTGGCCTATACAGG - Intronic
1089787098 11:120915557-120915579 GGGCATTGGCTGGGCTCGCACGG - Intronic
1090382715 11:126338190-126338212 GGGCATTCCCTGGCCTCTCCAGG - Intronic
1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG + Intergenic
1091302133 11:134514578-134514600 GGGCATTGCCAGGACTGTGAAGG - Intergenic
1094094251 12:26686060-26686082 GGGCAATGCCTGGAATGTAATGG + Intronic
1095562542 12:43583278-43583300 GTGCAGTGCCTGGAATATCATGG - Intergenic
1096517741 12:52166497-52166519 GTGCAATGCCTGGACTTTGAAGG - Intergenic
1097179376 12:57162591-57162613 GGGAAGTGCCTTCACTCCCAGGG - Intronic
1103199209 12:119072780-119072802 GTGAAGTGCCTGGAATCTCAGGG - Intronic
1103524880 12:121560997-121561019 GGGCAGTGCCTGGAGTTCCTAGG + Intronic
1103642461 12:122362853-122362875 GGGCAATGCCATGACTCTAAAGG + Intronic
1105310944 13:19210325-19210347 GTCCAGTGCCTGTAATCTCAGGG + Intergenic
1105361178 13:19717910-19717932 GTCCAGTGCCTGTAATCTCAGGG + Intronic
1106229339 13:27809710-27809732 GGGCAGTTCCTGGAAACGCAGGG + Intergenic
1106414591 13:29535993-29536015 TGGCAGGGCCTGCATTCTCACGG + Exonic
1106554333 13:30797240-30797262 GGGGAGTTCCTGGACCCTCAGGG - Intergenic
1107174793 13:37387890-37387912 GGCCAGTGTGTGGACTTTCATGG + Intergenic
1109268057 13:60223589-60223611 GCTCAGGGCCTGGACTCCCAGGG - Intergenic
1114432130 14:22670751-22670773 GGGCAGTGCCAGCACTCCCTTGG - Intergenic
1119031674 14:71197480-71197502 GGGCAGAGCCTGAACTCGAAAGG - Intergenic
1122401841 14:101472005-101472027 GGGCAGCTCCTGGACTCACTGGG + Intergenic
1122794369 14:104198633-104198655 GGCCAGTGGCTGGACTCCCTGGG - Intergenic
1124034177 15:26038900-26038922 GGGATGTGCCTGGCCTCACATGG + Intergenic
1124375405 15:29126172-29126194 GGGCCGGGCCTCCACTCTCAGGG + Intronic
1127133286 15:55890977-55890999 AGGCAGTGCCTGGTCACTGAGGG + Intronic
1127660369 15:61095020-61095042 GGACAGTGCCTGGAATATCATGG + Intronic
1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG + Intronic
1129850169 15:78789301-78789323 GGCCAGTGCCTGCCCTCTCTGGG - Intronic
1130064689 15:80594018-80594040 GGGCATTGGCTGAACTTTCATGG - Exonic
1130252092 15:82306275-82306297 GGCCAGTGCCTGCCCTCTCTGGG + Intergenic
1130647972 15:85745184-85745206 GGGCAGTGCCTGGACGGACCCGG + Exonic
1131986878 15:98051624-98051646 GTGCTTTGCCTGGATTCTCATGG - Intergenic
1132953861 16:2580674-2580696 GAGCTGTGCCTGGACCCTCACGG - Intronic
1132960484 16:2619489-2619511 GAGCTGTGCCTGGACCCTCACGG + Intergenic
1134100909 16:11450698-11450720 GGGCAAGGCCTGGACCCTAAAGG - Exonic
1135170070 16:20176125-20176147 GGGCGGTGTCTGGAATTTCAAGG + Intergenic
1136027246 16:27476570-27476592 GAGCAGTGCCTGTGGTCTCATGG - Intronic
1138337400 16:56264009-56264031 AGGCAGTGGCTGGAATCTGAGGG + Intronic
1138609987 16:58115260-58115282 GAGCAGTACCTGCACTCTGAGGG + Exonic
1141144911 16:81522358-81522380 GGGCACTGCATAGACCCTCAGGG - Intronic
1141651323 16:85394618-85394640 TGGCAGGGCCTGCAATCTCAAGG - Intergenic
1142416538 16:89946454-89946476 GGCCAGTGCCTGGACACAGAGGG - Intergenic
1143650823 17:8263498-8263520 GGGCAGTCCCTGGCCTCCAAAGG - Intronic
1144468224 17:15514108-15514130 GAGCAGAGGCTGGACTTTCAAGG + Intronic
1144952313 17:19000865-19000887 GGGCAGGGCCCGGACACTGACGG - Intronic
1145018192 17:19412321-19412343 GGGCAGAGCTTGGCCTCTCTGGG + Intronic
1146667428 17:34714539-34714561 GGGCAGTGTCTCTGCTCTCAGGG - Intergenic
1148245121 17:46025342-46025364 AGGCAGTGATTGGGCTCTCACGG - Exonic
1149257356 17:54841704-54841726 GAGAAGTGCATGGGCTCTCAGGG + Intergenic
1149989315 17:61372588-61372610 GGGCAGTGGCTGGTCTCAAAGGG - Intronic
1151387424 17:73763597-73763619 GCCCACTGCCTGGACCCTCAGGG - Intergenic
1152737992 17:82006890-82006912 CGGCAGGGCCTGGGGTCTCAGGG - Intronic
1154356292 18:13625020-13625042 CGCCAGGGCCTGGACTCCCAGGG - Intronic
1157285313 18:46373564-46373586 GCACAGTGCCTGGACGCTGAGGG + Intronic
1157571481 18:48715137-48715159 GGGCAGAGCCTGGGCTAGCAGGG + Intronic
1158425664 18:57337899-57337921 GTGGAGTGACTGGACTGTCAGGG - Intergenic
1158910394 18:62055505-62055527 GGGAAGTGCCTGGGCTATAAAGG + Intronic
1160368762 18:78352925-78352947 GGACAGATCCTGGACTCTCTCGG + Intergenic
1160678393 19:402360-402382 GGGCAGTGCGTGGCTTCTCTGGG - Intergenic
1160923533 19:1531904-1531926 GGGGAGTGCCTGGTCCCCCAGGG - Intronic
1161257487 19:3317406-3317428 GGGCAGAGCCTGGCCTCTGCAGG + Intergenic
1164584186 19:29455755-29455777 GATGACTGCCTGGACTCTCAGGG - Intergenic
1165059264 19:33196848-33196870 GGGTAGTGCCAGGACCCTGAAGG - Intronic
1166134253 19:40765995-40766017 CGGCAGTGCCTGGACTCATTTGG + Intergenic
1166224596 19:41387188-41387210 GGGCAGAGCCTGGAAACTCTTGG - Intronic
1168075989 19:53981344-53981366 GGGCAGGGCCTGGACTCGCTGGG + Intronic
1168271715 19:55253548-55253570 GGGCGCTGCCTGGGTTCTCAGGG - Intronic
1168469220 19:56627440-56627462 GGGCAGTGCCAGGCCACACAGGG + Intergenic
925338686 2:3117588-3117610 GGGAATTGCCTGGACTTTGATGG - Intergenic
925802929 2:7619371-7619393 GGGCTGTGCATGTACTCACAGGG - Intergenic
926108355 2:10166442-10166464 GAACAGAGCCTGGTCTCTCAGGG + Intronic
926385568 2:12332732-12332754 GGCCAGTGCCTACATTCTCAAGG + Intergenic
927100894 2:19787069-19787091 GGGCAGTGCCTGGATGGTTAAGG + Intergenic
927146439 2:20169327-20169349 GAGGAGTGCCTGGACTGTGAGGG + Intergenic
929639036 2:43557357-43557379 GGGCAGTTCATAGTCTCTCAGGG + Intronic
929933625 2:46277459-46277481 GGGCAGTGCTTGGTTGCTCAGGG + Intergenic
932265749 2:70365703-70365725 GGGCAGTGCCTGGGGACTGAAGG + Intergenic
933283305 2:80356507-80356529 GGACAGTGGCTGGCCTATCATGG - Intronic
934322915 2:91983696-91983718 GGCCAGGGCCAGGGCTCTCAGGG - Intergenic
934716878 2:96549657-96549679 GGTCTGTGCCTGGCCTGTCAGGG + Intronic
935719784 2:105969783-105969805 GGGCAGTGTCTATACTCTCTGGG - Intergenic
935817887 2:106864229-106864251 TGGCAGTGCCTGTAGTCTCCAGG - Intronic
936454891 2:112665485-112665507 AGGCAGTGCCAGAACTCTGAGGG - Intergenic
936528650 2:113259555-113259577 GGGAAGTTTCTGGACTCTCCAGG - Intronic
937792782 2:125980069-125980091 GGGCAGGGCCAGGATTCCCAAGG + Intergenic
938120095 2:128627030-128627052 GGGCAGTTCCTGTACTCCCCGGG + Intergenic
938307933 2:130267301-130267323 GGTCTGTGCCTGGACCCTCTAGG + Intergenic
938447401 2:131389539-131389561 GGTCTGTGCCTGGACCCTCTAGG - Intergenic
940213285 2:151277920-151277942 TGGAAGTACATGGACTCTCAGGG + Intronic
941812657 2:169768998-169769020 GAGGCGTGCCTGGGCTCTCAGGG + Intronic
942087390 2:172456126-172456148 GGGAAGTGCCTGCTCTCTAAGGG - Intronic
943666876 2:190618324-190618346 TAGCAGTTCCTGGACTCTCAAGG + Intergenic
945907864 2:215615007-215615029 GGGCAGGGCTTGAACTGTCAGGG - Intergenic
946930521 2:224665810-224665832 AGTCAGTGCCTGGTCTTTCAAGG - Intergenic
948571549 2:238920861-238920883 GCTCAGTGCCTGGACTTGCATGG + Intergenic
948721646 2:239904622-239904644 GGGCAGGGCCTGCAGTCTCTAGG - Intronic
948722246 2:239908426-239908448 GGGCAGGGCCTGCAGTCTCCAGG - Intronic
948860793 2:240751746-240751768 AGGCAGGGCCTGGACCCCCAGGG - Intronic
948887023 2:240889596-240889618 AGGGTGTGCCTGGACTCTCCTGG + Intronic
948915130 2:241030568-241030590 GACAAGTGCCTGGACTCACAGGG - Exonic
1168930533 20:1619798-1619820 GGCCTGTCCCTGGACTTTCAGGG - Intronic
1170697146 20:18669328-18669350 GGGAAGGGACAGGACTCTCAAGG - Intronic
1171298533 20:24039700-24039722 GCCCAGTGCCTGGGCTCTGAGGG - Intergenic
1171439519 20:25148946-25148968 GGGCACTGCCTCGAGTCTCACGG - Intergenic
1173355087 20:42279831-42279853 AGACAGTGGCTGGACTCTCCAGG + Intronic
1173869600 20:46332976-46332998 GGGCAGGGCCTCGAGGCTCAAGG - Intergenic
1174194584 20:48764027-48764049 AGTCAGAGCCTGGACTCTGATGG - Intronic
1175148828 20:56917074-56917096 GCTCAGTGCCTGGTCTGTCATGG + Intergenic
1175863283 20:62161490-62161512 AGCCAGGGCCTGCACTCTCAGGG + Exonic
1176171755 20:63699374-63699396 AGGGAGTGCCTGGACTCTCCAGG + Exonic
1178316509 21:31570823-31570845 GCGCAGTGCCTGGAGCCTCAGGG + Intergenic
1179260170 21:39750919-39750941 GAGCAGTGCCTTGACTCCGAAGG + Intronic
1179313354 21:40216777-40216799 GGGCAGTGGCTGCCTTCTCATGG - Intronic
1179557784 21:42191435-42191457 GGGCAGCACCTGGACTGTCTTGG + Intergenic
1179820829 21:43935882-43935904 GGGCAGTGCCCTGGCTCTCCAGG + Intronic
1180701689 22:17784823-17784845 AGGCAGGCCCTGGACACTCATGG + Intergenic
1180818953 22:18811954-18811976 GGGCAGAGCCTGCAGACTCAGGG - Intergenic
1181205177 22:21246402-21246424 GGGCAGAGCCTGCAGACTCAGGG - Intergenic
1181466205 22:23112046-23112068 GGGCAGTGCCTGTCCTTTCCTGG - Intronic
1182101871 22:27663157-27663179 GGGCAGGGCCAGGACACACAGGG - Intergenic
1182464386 22:30505498-30505520 GGGCAGTGCCAGGCTGCTCAGGG + Intronic
1182520245 22:30880981-30881003 AGGCAGGGCCTGGACTCCCCAGG + Intronic
1183450252 22:37890185-37890207 GTGCAGTGCCTGGCCTATAATGG + Intergenic
1184283345 22:43451751-43451773 GAGCAGTGCCTGGACTCACCCGG - Intronic
1184699692 22:46162328-46162350 GGTCAGTCCCTGGAATGTCAGGG - Intronic
1203221748 22_KI270731v1_random:49013-49035 GGGCAGAGCCTGCAGACTCAGGG + Intergenic
1203269078 22_KI270734v1_random:37807-37829 GGGCAGAGCCTGCAGACTCAGGG - Intergenic
949372933 3:3354717-3354739 GGGCAGGGACTGGGCCCTCACGG - Intergenic
950548714 3:13654003-13654025 CGGCAGTGCCAGGACTCTGTGGG - Intergenic
950656698 3:14441123-14441145 GGGCAGAGCCGGGACTCTCAGGG + Intronic
951356810 3:21677242-21677264 GGTCAGTGCTGGGATTCTCAGGG - Intronic
954078844 3:48200773-48200795 AGGCAGTACCTGGCCTTTCAGGG + Intergenic
954375546 3:50192454-50192476 GGTCACTGCCTGACCTCTCAAGG + Intronic
961367078 3:126406790-126406812 GGCCAGTGCCTTGCCTCCCAGGG - Intronic
963213927 3:142724211-142724233 GGGCCGTGCCAGGAGTCGCAGGG - Exonic
967229445 3:187323819-187323841 AGCCAGTGCATGGACTCTCAGGG + Intergenic
967310690 3:188103435-188103457 GGGCAGTCCCTAGAAGCTCAAGG + Intergenic
968703153 4:2066144-2066166 GGGCAGGGCCTGGAGGCCCAGGG + Exonic
968706285 4:2079992-2080014 GGGCAGTGCTTAGACCCCCACGG + Intronic
969568509 4:7994027-7994049 GGGCAGAGCCTGGACCCTGGAGG + Intronic
969903317 4:10370199-10370221 GGGTCGTACCTGGACTCTGAAGG + Intergenic
979473753 4:121130567-121130589 GGCCTGGGCCTGGCCTCTCAAGG + Intergenic
979975971 4:127196773-127196795 GGGCACTGCTTGAACTCTAATGG + Intergenic
981288575 4:143047592-143047614 AGGCAGGGCCTGGAGTCCCATGG + Intergenic
981775783 4:148365861-148365883 GGTCAGTGCCTGGAATTTCCGGG - Intronic
984767232 4:183408941-183408963 GGGCAGGGCCAGGCCTCCCAGGG + Intergenic
984818440 4:183859146-183859168 GGGCAGTTCCTGGGATCCCACGG + Intronic
985038044 4:185861166-185861188 GGTCAGTGCCTGAACTCCAAAGG + Intronic
986100447 5:4604497-4604519 GAGCAGTGCCTCAACTATCATGG - Intergenic
986273453 5:6253727-6253749 GGGCAGGGTCTGGAATCTGACGG + Intergenic
986519930 5:8604457-8604479 GGGCAGAGCCTGCAGTTTCAGGG - Intergenic
990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG + Intronic
997303764 5:132824316-132824338 CTGCAGTTCCTGGACACTCATGG + Exonic
997356091 5:133263923-133263945 GGGCAGAGCCTGGAGTATAATGG + Intronic
998596222 5:143533411-143533433 GGTTAATTCCTGGACTCTCAAGG + Intergenic
1001953408 5:175831663-175831685 GGGCCATGCCTGGCCTCTCTTGG - Intronic
1004265811 6:14147756-14147778 GGGCAGTTCTTGGACCATCAAGG - Intergenic
1005696794 6:28359250-28359272 GGGCACTTCCTGGACTCTCTAGG - Intronic
1006191231 6:32210798-32210820 TGGCAAGGCCTGGACTCACATGG + Exonic
1007106253 6:39285171-39285193 GGGCTGGTCCTGGCCTCTCAGGG + Intergenic
1007371441 6:41428865-41428887 GACCAGTGCCTGGACTCTACTGG + Intergenic
1007655983 6:43451233-43451255 GGGCAGTGCCAGGACGACCAGGG - Exonic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1010392064 6:75349325-75349347 GGGCAGAGCAGGGACTCTCCGGG - Intronic
1012679468 6:102161214-102161236 GAGAAATGCCTGGACTTTCAGGG + Intergenic
1015365550 6:132393556-132393578 GGAGAGCCCCTGGACTCTCATGG + Intronic
1017058214 6:150456635-150456657 GGCCAGGGGCTGGTCTCTCACGG + Intergenic
1017324698 6:153131409-153131431 GGGCGGGGCCGGGACTCTCGCGG - Intergenic
1017984419 6:159430780-159430802 GGGCAGTGCCTGCTTCCTCATGG - Intergenic
1019427832 7:985651-985673 GGAAGGTGCCTGGACTGTCAGGG - Intronic
1019478082 7:1253748-1253770 GGGGAGAGCCTGGACTCTTGTGG + Intergenic
1019577479 7:1744479-1744501 GGGAGGTGCCTGCACTCTCAGGG - Exonic
1019745941 7:2700422-2700444 GGGCAGGGCCTGGCCACTCCTGG - Exonic
1022179414 7:27903973-27903995 TGGGAGTGCTTGGAATCTCAGGG - Intronic
1023041432 7:36176163-36176185 GGGTGGGGCCTGGCCTCTCAGGG + Intronic
1023362802 7:39432989-39433011 ATGCAGTGCCTGGTCTCTCTAGG - Intronic
1032256219 7:130299151-130299173 GGGCAGAGCCTAGCCTCTCAGGG + Intronic
1032517667 7:132519007-132519029 GCACAGTGCCTGGAATCTCAAGG - Intronic
1035132631 7:156669713-156669735 GGGCAGGGCTGGGACTCCCAGGG + Intronic
1036791887 8:11726524-11726546 TGGCAGTGGCTGGACTCTGAGGG + Intronic
1037952229 8:23027041-23027063 GGGCAGTGCCTTAGCTCTCCTGG - Intronic
1038276632 8:26126806-26126828 GGGCAGTGCCTGGAATAAAAAGG - Intergenic
1038561732 8:28586715-28586737 GGGCAGTGAGTGGACACTCCTGG + Intergenic
1039586902 8:38714463-38714485 GGGCAGTGGCTGCACACACATGG - Intergenic
1040303759 8:46201584-46201606 GGGCAGGCCGTGGAATCTCAGGG + Intergenic
1045975885 8:108130499-108130521 GGGCAGTGCTTCCATTCTCATGG - Intergenic
1048823196 8:138398298-138398320 AGGCAGTGACTGGATTTTCAAGG + Intronic
1048978955 8:139692809-139692831 AGGCAGTGCCAGGCCACTCATGG - Intronic
1049873634 8:145000961-145000983 GGGAAGTGCCTGGAATGTCTGGG + Intergenic
1056244689 9:84682595-84682617 GGGAATTGCCTGGGCTCTCGAGG - Intronic
1057197040 9:93121033-93121055 GACCAGGCCCTGGACTCTCAGGG - Intergenic
1057271917 9:93656303-93656325 GGGCACTGACAGAACTCTCATGG + Intronic
1057296848 9:93851268-93851290 GGGAACTGCATGGAGTCTCAAGG - Intergenic
1058530728 9:105902529-105902551 GGGCAGTGCCTGGAGCATCTGGG + Intergenic
1058670458 9:107356894-107356916 GGACAGAGCCTGGCCCCTCAAGG + Intergenic
1059565563 9:115380294-115380316 TTGCAGTGGCAGGACTCTCATGG - Intronic
1060214576 9:121731067-121731089 GGGCAGGGCCTGGACCAACAGGG - Intronic
1060789789 9:126478391-126478413 GGGCAGGGCCTGGGGGCTCAGGG - Intronic
1060801546 9:126548623-126548645 GGGCAGGCGCTGGAGTCTCAGGG + Intergenic
1060999367 9:127894405-127894427 AGGCAGGGCCTTGACTCTCAGGG + Intronic
1061133641 9:128721572-128721594 GGACAGAGCCAGGACTCCCAGGG - Intronic
1062128698 9:134880881-134880903 GGGCATGGCCTGGGCTCTCCAGG + Exonic
1189160660 X:38805297-38805319 GGGCAGTGCCTGGAAGTCCAAGG + Exonic
1196741833 X:119032016-119032038 GAGCAGGGCCTGGTTTCTCACGG + Intergenic
1200878536 Y:8185593-8185615 GGGCAGTGCGTTGGCTCTCTTGG + Intergenic